siRNA Id: | virsi2331 |
Sense Sequence: | aguuguuagucuacguggac |
Length: | 20 |
GC Content (%): | 45 |
Virus Name: | Dengue Virus [DENV] |
Family of Virus: | Flaviviridae |
Virus Strain: | DENV-1-4 |
Target Gene: | 5'UTR |
Genbank Accession: | AY947539 |
Starting Position | 1 |
Ending Position: | 20 |
Cell Line: | Huh-7 |
Concentration: | 100nM |
Transfection Method: | RNAiMAX |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Dhamacon |
PubMed: | 21795337 |
Target Object (mRNA,Protein,etc): | Plaque Count |
Silencing Efficacy : | High |
siRNA sequence matching with Dengue Virus [DENV] reference genome: | ![]() |
Protein1: | Env |
Protein1 % inhibition: | High |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.