| siRNA Id: | virsi2331 |
| Sense Sequence: | aguuguuagucuacguggac |
| Length: | 20 |
| GC Content (%): | 45 |
| Virus Name: | Dengue Virus [DENV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | DENV-1-4 |
| Target Gene: | 5'UTR |
| Genbank Accession: | AY947539 |
| Starting Position | 1 |
| Ending Position: | 20 |
| Cell Line: | Huh-7 |
| Concentration: | 100nM |
| Transfection Method: | RNAiMAX |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 21795337 |
| Target Object (mRNA,Protein,etc): | Plaque Count |
| Silencing Efficacy : | High |
| siRNA sequence matching with Dengue Virus [DENV] reference genome: | ![]() |
| Protein1: | Env |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.
