VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacgaccgaccuugaggcaua"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
5465
.
Total Genes with multiple seed matches:
1307
.
Genes with at least one seed match:
NM_000015 NM_000026 NM_000028 NM_000031 NM_000037 NM_000040 NM_000043 NM_000046 NM_000049 NM_000052 NM_000061 NM_000069 NM_000070 NM_000074 NM_000081 NM_000091 NM_000092 NM_000097 NM_000103 NM_000104 NM_000116 NM_000131 NM_000132 NM_000133 NM_000136 NM_000139 NM_000140 NM_000142 NM_000151 NM_000180 NM_000197 NM_000199 NM_000210 NM_000213 NM_000219 NM_000222 NM_000230 NM_000232 NM_000239 NM_000240 NM_000243 NM_000245 NM_000246 NM_000252 NM_000254 NM_000260 NM_000261 NM_000264 NM_000266 NM_000268 NM_000283 NM_000293 NM_000296 NM_000298 NM_000302 NM_000303 NM_000318 NM_000321 NM_000322 NM_000332 NM_000337 NM_000348 NM_000351 NM_000362 NM_000368 NM_000373 NM_000375 NM_000378 NM_000383 NM_000394 NM_000403 NM_000405 NM_000406 NM_000410 NM_000411 NM_000418 NM_000428 NM_000429 NM_000430 NM_000431 NM_000433 NM_000435 NM_000436 NM_000439 NM_000441 NM_000448 NM_000449 NM_000450 NM_000457 NM_000474 NM_000476 NM_000484 NM_000486 NM_000497 NM_000503 NM_000525 NM_000527 NM_000539 NM_000545 NM_000547 NM_000550 NM_000551 NM_000555 NM_000565 NM_000566 NM_000573 NM_000574 NM_000575 NM_000587 NM_000593 NM_000595 NM_000598 NM_000599 NM_000604 NM_000609 NM_000611 NM_000614 NM_000617 NM_000618 NM_000620 NM_000623 NM_000624 NM_000628 NM_000632 NM_000634 NM_000641 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000647 NM_000651 NM_000661 NM_000663 NM_000664 NM_000671 NM_000682 NM_000686 NM_000694 NM_000702 NM_000717 NM_000719 NM_000720 NM_000721 NM_000723 NM_000724 NM_000738 NM_000744 NM_000750 NM_000757 NM_000758 NM_000759 NM_000767 NM_000771 NM_000779 NM_000782 NM_000786 NM_000787 NM_000800 NM_000809 NM_000821 NM_000826 NM_000828 NM_000843 NM_000849 NM_000860 NM_000861 NM_000864 NM_000875 NM_000876 NM_000877 NM_000879 NM_000885 NM_000890 NM_000896 NM_000899 NM_000903 NM_000909 NM_000916 NM_000918 NM_000923 NM_000934 NM_000947 NM_000950 NM_000953 NM_000959 NM_000961 NM_000964 NM_000965 NM_000983 NM_000991 NM_000994 NM_000997 NM_001001188 NM_001001323 NM_001001329 NM_001001342 NM_001001343 NM_001001344 NM_001001414 NM_001001419 NM_001001420 NM_001001481 NM_001001482 NM_001001483 NM_001001484 NM_001001523 NM_001001549 NM_001001550 NM_001001555 NM_001001560 NM_001001669 NM_001001680 NM_001001684 NM_001001685 NM_001001686 NM_001001689 NM_001001690 NM_001001693 NM_001001694 NM_001001696 NM_001001698 NM_001001701 NM_001001702 NM_001001706 NM_001001707 NM_001001709 NM_001001711 NM_001001713 NM_001001787 NM_001001789 NM_001001852 NM_001001870 NM_001001872 NM_001001874 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001938 NM_001002017 NM_001002018 NM_001002034 NM_001002244 NM_001002245 NM_001002246 NM_001002247 NM_001002248 NM_001002249 NM_001002260 NM_001002261 NM_001002262 NM_001002265 NM_001002266 NM_001002295 NM_001002758 NM_001002762 NM_001002799 NM_001002800 NM_001002810 NM_001002814 NM_001002838 NM_001002860 NM_001002909 NM_001002912 NM_001002915 NM_001003399 NM_001003656 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003682 NM_001003688 NM_001003690 NM_001003698 NM_001003699 NM_001003715 NM_001003716 NM_001003789 NM_001003795 NM_001003800 NM_001003945 NM_001004285 NM_001004286 NM_001004297 NM_001004299 NM_001004300 NM_001004304 NM_001004305 NM_001004307 NM_001004309 NM_001004313 NM_001004316 NM_001004317 NM_001004336 NM_001004339 NM_001004344 NM_001004356 NM_001004358 NM_001004417 NM_001004421 NM_001004422 NM_001004430 NM_001004439 NM_001005158 NM_001005159 NM_001005210 NM_001005217 NM_001005242 NM_001005303 NM_001005340 NM_001005375 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005473 NM_001005502 NM_001005505 NM_001005609 NM_001005619 NM_001005731 NM_001005738 NM_001005752 NM_001005753 NM_001005781 NM_001005782 NM_001005785 NM_001005786 NM_001005922 NM_001006116 NM_001006604 NM_001006610 NM_001006623 NM_001006633 NM_001006637 NM_001006638 NM_001006639 NM_001006640 NM_001006641 NM_001006642 NM_001006643 NM_001006935 NM_001006936 NM_001006937 NM_001006945 NM_001007024 NM_001007025 NM_001007027 NM_001007073 NM_001007074 NM_001007094 NM_001007097 NM_001007156 NM_001007176 NM_001007188 NM_001007189 NM_001007214 NM_001007224 NM_001007231 NM_001007237 NM_001007239 NM_001007240 NM_001007241 NM_001007242 NM_001007254 NM_001007257 NM_001007271 NM_001007274 NM_001007275 NM_001007466 NM_001007471 NM_001007525 NM_001007529 NM_001007536 NM_001007540 NM_001007542 NM_001007543 NM_001007544 NM_001008215 NM_001008216 NM_001008226 NM_001008228 NM_001008229 NM_001008234 NM_001008239 NM_001008390 NM_001008391 NM_001008393 NM_001008396 NM_001008408 NM_001008409 NM_001008487 NM_001008490 NM_001008493 NM_001008494 NM_001008495 NM_001008528 NM_001008537 NM_001008539 NM_001008564 NM_001008658 NM_001008693 NM_001008701 NM_001008707 NM_001008708 NM_001008710 NM_001008711 NM_001008726 NM_001008742 NM_001008744 NM_001008745 NM_001008781 NM_001008783 NM_001008895 NM_001008925 NM_001009584 NM_001009612 NM_001009877 NM_001009880 NM_001009883 NM_001009894 NM_001009899 NM_001009905 NM_001009913 NM_001009922 NM_001009931 NM_001009944 NM_001009954 NM_001009955 NM_001009956 NM_001009993 NM_001009996 NM_001010000 NM_001010846 NM_001010852 NM_001010853 NM_001010864 NM_001010867 NM_001010871 NM_001010882 NM_001010883 NM_001010891 NM_001010898 NM_001010910 NM_001010913 NM_001010915 NM_001010923 NM_001010925 NM_001010934 NM_001010976 NM_001010985 NM_001011513 NM_001011514 NM_001011537 NM_001011538 NM_001011539 NM_001011540 NM_001011655 NM_001011658 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011708 NM_001012274 NM_001012339 NM_001012391 NM_001012393 NM_001012418 NM_001012420 NM_001012426 NM_001012427 NM_001012446 NM_001012509 NM_001012515 NM_001012614 NM_001012642 NM_001012659 NM_001012711 NM_001012732 NM_001012733 NM_001012734 NM_001012753 NM_001012754 NM_001012756 NM_001012761 NM_001012763 NM_001012957 NM_001012961 NM_001012964 NM_001012965 NM_001012966 NM_001012968 NM_001012979 NM_001012981 NM_001012982 NM_001012987 NM_001013000 NM_001013005 NM_001013398 NM_001013399 NM_001013406 NM_001013615 NM_001013629 NM_001013633 NM_001013644 NM_001013648 NM_001013649 NM_001013661 NM_001013664 NM_001013674 NM_001013676 NM_001013677 NM_001013678 NM_001013681 NM_001013690 NM_001013692 NM_001013693 NM_001013697 NM_001013704 NM_001013710 NM_001013711 NM_001013713 NM_001013715 NM_001013727 NM_001013839 NM_001014342 NM_001014380 NM_001014440 NM_001014449 NM_001014451 NM_001014797 NM_001014811 NM_001014839 NM_001014841 NM_001014972 NM_001015002 NM_001015045 NM_001015048 NM_001015049 NM_001015508 NM_001015882 NM_001015883 NM_001015887 NM_001017361 NM_001017370 NM_001017371 NM_001017392 NM_001017395 NM_001017396 NM_001017415 NM_001017416 NM_001017420 NM_001017424 NM_001017425 NM_001017440 NM_001017523 NM_001017524 NM_001017528 NM_001017529 NM_001017530 NM_001017980 NM_001017992 NM_001017995 NM_001018003 NM_001018009 NM_001018053 NM_001018055 NM_001018057 NM_001018058 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018072 NM_001018081 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018100 NM_001018101 NM_001018109 NM_001018115 NM_001018116 NM_001023563 NM_001023565 NM_001023567 NM_001024215 NM_001024216 NM_001024372 NM_001024593 NM_001024631 NM_001024657 NM_001024670 NM_001024681 NM_001024688 NM_001024733 NM_001024808 NM_001024843 NM_001024855 NM_001024858 NM_001024912 NM_001024921 NM_001024948 NM_001024956 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025105 NM_001025107 NM_001025194 NM_001025195 NM_001025231 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001038 NM_001041 NM_001043 NM_001044 NM_001047 NM_001050 NM_001056 NM_001066 NM_001080 NM_001083 NM_001092 NM_001093 NM_001099 NM_001111 NM_001114 NM_001116 NM_001125 NM_001126 NM_001128 NM_001132 NM_001140 NM_001152 NM_001157 NM_001164 NM_001167 NM_001172 NM_001174 NM_001177 NM_001186 NM_001190 NM_001204 NM_001216 NM_001222 NM_001224 NM_001226 NM_001230 NM_001232 NM_001235 NM_001243 NM_001248 NM_001252 NM_001257 NM_001259 NM_001264 NM_001266 NM_001276 NM_001277 NM_001278 NM_001279 NM_001282 NM_001286 NM_001298 NM_001303 NM_001304 NM_001310 NM_001315 NM_001319 NM_001328 NM_001332 NM_001336 NM_001357 NM_001360 NM_001362 NM_001388 NM_001399 NM_001406 NM_001419 NM_001421 NM_001422 NM_001423 NM_001432 NM_001439 NM_001440 NM_001448 NM_001452 NM_001460 NM_001462 NM_001470 NM_001490 NM_001491 NM_001495 NM_001498 NM_001502 NM_001504 NM_001511 NM_001542 NM_001546 NM_001548 NM_001558 NM_001560 NM_001563 NM_001584 NM_001585 NM_001609 NM_001617 NM_001621 NM_001622 NM_001642 NM_001649 NM_001655 NM_001659 NM_001677 NM_001678 NM_001682 NM_001690 NM_001695 NM_001699 NM_001712 NM_001720 NM_001721 NM_001730 NM_001745 NM_001748 NM_001756 NM_001759 NM_001761 NM_001771 NM_001777 NM_001791 NM_001798 NM_001800 NM_001801 NM_001816 NM_001830 NM_001843 NM_001852 NM_001858 NM_001859 NM_001860 NM_001874 NM_001875 NM_001879 NM_001883 NM_001892 NM_001894 NM_001897 NM_001901 NM_001903 NM_001905 NM_001921 NM_001939 NM_001941 NM_001948 NM_001949 NM_001963 NM_001966 NM_001969 NM_001970 NM_001979 NM_001980 NM_001982 NM_001991 NM_001992 NM_001995 NM_002000 NM_002006 NM_002015 NM_002017 NM_002019 NM_002023 NM_002025 NM_002029 NM_002032 NM_002034 NM_002040 NM_002051 NM_002052 NM_002053 NM_002055 NM_002062 NM_002071 NM_002076 NM_002080 NM_002084 NM_002094 NM_002096 NM_002098 NM_002099 NM_002102 NM_002105 NM_002116 NM_002119 NM_002126 NM_002133 NM_002149 NM_002156 NM_002158 NM_002192 NM_002232 NM_002236 NM_002239 NM_002241 NM_002247 NM_002251 NM_002253 NM_002267 NM_002271 NM_002279 NM_002281 NM_002283 NM_002298 NM_002336 NM_002349 NM_002355 NM_002357 NM_002359 NM_002372 NM_002374 NM_002375 NM_002392 NM_002393 NM_002397 NM_002398 NM_002404 NM_002408 NM_002417 NM_002433 NM_002439 NM_002468 NM_002473 NM_002478 NM_002480 NM_002481 NM_002485 NM_002499 NM_002504 NM_002507 NM_002510 NM_002518 NM_002522 NM_002545 NM_002547 NM_002552 NM_002556 NM_002557 NM_002563 NM_002567 NM_002570 NM_002581 NM_002586 NM_002591 NM_002598 NM_002610 NM_002612 NM_002617 NM_002623 NM_002628 NM_002641 NM_002644 NM_002646 NM_002649 NM_002655 NM_002656 NM_002657 NM_002658 NM_002662 NM_002663 NM_002693 NM_002696 NM_002711 NM_002713 NM_002716 NM_002719 NM_002725 NM_002731 NM_002737 NM_002740 NM_002743 NM_002759 NM_002760 NM_002763 NM_002774 NM_002775 NM_002813 NM_002814 NM_002816 NM_002821 NM_002822 NM_002827 NM_002840 NM_002842 NM_002848 NM_002857 NM_002862 NM_002871 NM_002874 NM_002878 NM_002879 NM_002886 NM_002893 NM_002899 NM_002901 NM_002911 NM_002926 NM_002937 NM_002941 NM_002945 NM_002955 NM_002969 NM_002973 NM_002990 NM_002996 NM_003003 NM_003009 NM_003010 NM_003012 NM_003014 NM_003017 NM_003023 NM_003026 NM_003031 NM_003032 NM_003035 NM_003042 NM_003043 NM_003045 NM_003046 NM_003068 NM_003074 NM_003075 NM_003081 NM_003103 NM_003104 NM_003111 NM_003112 NM_003131 NM_003141 NM_003150 NM_003152 NM_003156 NM_003161 NM_003165 NM_003173 NM_003178 NM_003189 NM_003203 NM_003212 NM_003216 NM_003217 NM_003224 NM_003236 NM_003239 NM_003241 NM_003246 NM_003247 NM_003249 NM_003257 NM_003262 NM_003264 NM_003266 NM_003270 NM_003281 NM_003286 NM_003295 NM_003297 NM_003307 NM_003309 NM_003319 NM_003320 NM_003324 NM_003330 NM_003336 NM_003339 NM_003343 NM_003345 NM_003348 NM_003352 NM_003356 NM_003362 NM_003366 NM_003368 NM_003369 NM_003388 NM_003390 NM_003391 NM_003395 NM_003400 NM_003405 NM_003415 NM_003417 NM_003419 NM_003421 NM_003423 NM_003438 NM_003439 NM_003456 NM_003458 NM_003463 NM_003471 NM_003472 NM_003474 NM_003478 NM_003489 NM_003507 NM_003574 NM_003575 NM_003589 NM_003590 NM_003594 NM_003600 NM_003605 NM_003615 NM_003617 NM_003622 NM_003629 NM_003631 NM_003633 NM_003644 NM_003645 NM_003657 NM_003662 NM_003663 NM_003666 NM_003670 NM_003671 NM_003672 NM_003677 NM_003680 NM_003681 NM_003684 NM_003687 NM_003693 NM_003696 NM_003701 NM_003705 NM_003713 NM_003714 NM_003715 NM_003734 NM_003749 NM_003757 NM_003770 NM_003772 NM_003773 NM_003774 NM_003776 NM_003799 NM_003804 NM_003808 NM_003822 NM_003824 NM_003825 NM_003831 NM_003840 NM_003842 NM_003850 NM_003851 NM_003855 NM_003861 NM_003869 NM_003870 NM_003872 NM_003874 NM_003877 NM_003884 NM_003885 NM_003887 NM_003889 NM_003895 NM_003899 NM_003909 NM_003913 NM_003916 NM_003921 NM_003930 NM_003932 NM_003938 NM_003939 NM_003941 NM_003950 NM_003951 NM_003953 NM_003958 NM_003959 NM_003966 NM_003972 NM_003976 NM_003980 NM_003981 NM_003983 NM_003994 NM_003998 NM_004036 NM_004040 NM_004048 NM_004050 NM_004060 NM_004062 NM_004063 NM_004077 NM_004078 NM_004079 NM_004080 NM_004081 NM_004093 NM_004094 NM_004099 NM_004101 NM_004104 NM_004105 NM_004112 NM_004129 NM_004132 NM_004134 NM_004140 NM_004142 NM_004155 NM_004164 NM_004186 NM_004193 NM_004200 NM_004202 NM_004207 NM_004229 NM_004233 NM_004261 NM_004264 NM_004265 NM_004267 NM_004268 NM_004273 NM_004275 NM_004282 NM_004293 NM_004296 NM_004302 NM_004308 NM_004311 NM_004316 NM_004331 NM_004334 NM_004337 NM_004338 NM_004346 NM_004350 NM_004356 NM_004360 NM_004367 NM_004370 NM_004371 NM_004375 NM_004377 NM_004380 NM_004391 NM_004392 NM_004397 NM_004402 NM_004412 NM_004422 NM_004426 NM_004428 NM_004434 NM_004437 NM_004438 NM_004449 NM_004457 NM_004464 NM_004479 NM_004482 NM_004485 NM_004486 NM_004488 NM_004494 NM_004505 NM_004507 NM_004513 NM_004514 NM_004518 NM_004529 NM_004537 NM_004539 NM_004554 NM_004557 NM_004570 NM_004571 NM_004572 NM_004586 NM_004598 NM_004600 NM_004612 NM_004619 NM_004622 NM_004624 NM_004625 NM_004626 NM_004635 NM_004650 NM_004651 NM_004663 NM_004669 NM_004676 NM_004686 NM_004687 NM_004696 NM_004707 NM_004711 NM_004716 NM_004725 NM_004731 NM_004734 NM_004735 NM_004736 NM_004738 NM_004742 NM_004744 NM_004745 NM_004767 NM_004768 NM_004772 NM_004774 NM_004778 NM_004780 NM_004781 NM_004782 NM_004795 NM_004797 NM_004798 NM_004804 NM_004805 NM_004817 NM_004818 NM_004826 NM_004840 NM_004844 NM_004845 NM_004850 NM_004858 NM_004859 NM_004862 NM_004863 NM_004866 NM_004871 NM_004873 NM_004878 NM_004887 NM_004894 NM_004898 NM_004907 NM_004912 NM_004914 NM_004925 NM_004927 NM_004928 NM_004931 NM_004947 NM_004949 NM_004952 NM_004959 NM_004961 NM_004970 NM_004983 NM_004985 NM_004992 NM_004993 NM_005009 NM_005010 NM_005014 NM_005020 NM_005026 NM_005032 NM_005036 NM_005044 NM_005046 NM_005047 NM_005054 NM_005056 NM_005060 NM_005063 NM_005068 NM_005069 NM_005076 NM_005079 NM_005082 NM_005086 NM_005093 NM_005095 NM_005096 NM_005105 NM_005107 NM_005108 NM_005109 NM_005110 NM_005116 NM_005117 NM_005119 NM_005128 NM_005137 NM_005144 NM_005147 NM_005149 NM_005157 NM_005160 NM_005180 NM_005183 NM_005184 NM_005185 NM_005188 NM_005189 NM_005190 NM_005197 NM_005215 NM_005216 NM_005238 NM_005244 NM_005262 NM_005263 NM_005270 NM_005277 NM_005279 NM_005291 NM_005308 NM_005311 NM_005329 NM_005334 NM_005337 NM_005342 NM_005353 NM_005359 NM_005370 NM_005373 NM_005387 NM_005389 NM_005398 NM_005400 NM_005402 NM_005411 NM_005414 NM_005417 NM_005419 NM_005431 NM_005446 NM_005449 NM_005458 NM_005461 NM_005463 NM_005465 NM_005492 NM_005496 NM_005500 NM_005502 NM_005504 NM_005508 NM_005509 NM_005513 NM_005522 NM_005530 NM_005534 NM_005539 NM_005540 NM_005546 NM_005552 NM_005562 NM_005565 NM_005578 NM_005581 NM_005590 NM_005591 NM_005608 NM_005613 NM_005652 NM_005655 NM_005658 NM_005662 NM_005670 NM_005677 NM_005678 NM_005687 NM_005699 NM_005704 NM_005715 NM_005722 NM_005727 NM_005730 NM_005732 NM_005738 NM_005739 NM_005752 NM_005765 NM_005766 NM_005775 NM_005779 NM_005786 NM_005793 NM_005802 NM_005807 NM_005810 NM_005813 NM_005816 NM_005821 NM_005828 NM_005840 NM_005842 NM_005845 NM_005853 NM_005857 NM_005859 NM_005860 NM_005867 NM_005868 NM_005872 NM_005879 NM_005898 NM_005900 NM_005903 NM_005906 NM_005909 NM_005914 NM_005918 NM_005924 NM_005940 NM_005943 NM_005955 NM_005966 NM_005971 NM_005990 NM_005993 NM_005999 NM_006003 NM_006005 NM_006011 NM_006013 NM_006017 NM_006018 NM_006020 NM_006030 NM_006040 NM_006044 NM_006045 NM_006054 NM_006055 NM_006056 NM_006057 NM_006061 NM_006065 NM_006074 NM_006089 NM_006096 NM_006106 NM_006116 NM_006122 NM_006133 NM_006134 NM_006138 NM_006139 NM_006145 NM_006148 NM_006156 NM_006159 NM_006162 NM_006166 NM_006178 NM_006180 NM_006201 NM_006203 NM_006205 NM_006206 NM_006210 NM_006213 NM_006224 NM_006237 NM_006239 NM_006241 NM_006242 NM_006245 NM_006257 NM_006262 NM_006276 NM_006277 NM_006278 NM_006282 NM_006283 NM_006288 NM_006291 NM_006293 NM_006294 NM_006298 NM_006306 NM_006315 NM_006323 NM_006329 NM_006335 NM_006355 NM_006357 NM_006359 NM_006366 NM_006369 NM_006371 NM_006375 NM_006390 NM_006393 NM_006403 NM_006410 NM_006419 NM_006435 NM_006449 NM_006452 NM_006455 NM_006457 NM_006459 NM_006464 NM_006465 NM_006481 NM_006499 NM_006502 NM_006508 NM_006510 NM_006516 NM_006517 NM_006527 NM_006530 NM_006532 NM_006534 NM_006539 NM_006544 NM_006549 NM_006559 NM_006561 NM_006564 NM_006569 NM_006572 NM_006577 NM_006583 NM_006587 NM_006589 NM_006596 NM_006598 NM_006599 NM_006600 NM_006603 NM_006606 NM_006609 NM_006612 NM_006614 NM_006618 NM_006620 NM_006622 NM_006624 NM_006628 NM_006641 NM_006649 NM_006653 NM_006658 NM_006660 NM_006661 NM_006672 NM_006680 NM_006698 NM_006699 NM_006703 NM_006708 NM_006716 NM_006718 NM_006729 NM_006731 NM_006736 NM_006737 NM_006738 NM_006746 NM_006748 NM_006761 NM_006771 NM_006777 NM_006778 NM_006780 NM_006785 NM_006788 NM_006791 NM_006802 NM_006806 NM_006807 NM_006811 NM_006825 NM_006827 NM_006832 NM_006847 NM_006854 NM_006858 NM_006859 NM_006867 NM_006869 NM_006873 NM_006876 NM_006878 NM_006879 NM_006880 NM_006881 NM_006882 NM_006892 NM_006902 NM_006907 NM_006914 NM_006915 NM_006918 NM_006926 NM_006943 NM_006947 NM_006955 NM_006963 NM_006974 NM_006979 NM_006980 NM_006981 NM_006984 NM_006989 NM_006990 NM_006995 NM_006999 NM_007000 NM_007010 NM_007011 NM_007021 NM_007022 NM_007024 NM_007036 NM_007038 NM_007040 NM_007043 NM_007049 NM_007050 NM_007055 NM_007073 NM_007077 NM_007081 NM_007086 NM_007107 NM_007117 NM_007129 NM_007131 NM_007137 NM_007139 NM_007144 NM_007150 NM_007163 NM_007168 NM_007173 NM_007174 NM_007177 NM_007182 NM_007187 NM_007198 NM_007200 NM_007202 NM_007203 NM_007207 NM_007212 NM_007213 NM_007216 NM_007231 NM_007236 NM_007242 NM_007249 NM_007257 NM_007270 NM_007306 NM_007312 NM_007313 NM_007315 NM_007325 NM_007335 NM_007336 NM_007338 NM_007341 NM_007345 NM_007354 NM_007360 NM_007362 NM_007364 NM_007370 NM_007371 NM_007375 NM_012074 NM_012075 NM_012080 NM_012089 NM_012092 NM_012093 NM_012096 NM_012102 NM_012119 NM_012134 NM_012146 NM_012157 NM_012161 NM_012173 NM_012192 NM_012193 NM_012198 NM_012207 NM_012211 NM_012213 NM_012215 NM_012225 NM_012231 NM_012237 NM_012239 NM_012247 NM_012252 NM_012262 NM_012275 NM_012281 NM_012285 NM_012286 NM_012288 NM_012296 NM_012304 NM_012306 NM_012309 NM_012311 NM_012312 NM_012314 NM_012316 NM_012318 NM_012320 NM_012321 NM_012325 NM_012327 NM_012332 NM_012381 NM_012382 NM_012384 NM_012393 NM_012395 NM_012396 NM_012399 NM_012400 NM_012413 NM_012417 NM_012420 NM_012423 NM_012424 NM_012429 NM_012430 NM_012434 NM_012436 NM_012443 NM_012463 NM_012464 NM_012465 NM_013230 NM_013231 NM_013232 NM_013238 NM_013243 NM_013253 NM_013254 NM_013255 NM_013257 NM_013275 NM_013281 NM_013284 NM_013286 NM_013296 NM_013306 NM_013309 NM_013315 NM_013322 NM_013323 NM_013341 NM_013364 NM_013365 NM_013373 NM_013374 NM_013375 NM_013381 NM_013386 NM_013400 NM_013402 NM_013412 NM_013438 NM_013446 NM_013447 NM_013449 NM_013943 NM_013958 NM_013959 NM_013962 NM_014002 NM_014011 NM_014014 NM_014015 NM_014016 NM_014028 NM_014030 NM_014033 NM_014034 NM_014038 NM_014048 NM_014069 NM_014089 NM_014096 NM_014106 NM_014110 NM_014112 NM_014138 NM_014141 NM_014154 NM_014157 NM_014161 NM_014166 NM_014171 NM_014178 NM_014207 NM_014216 NM_014217 NM_014218 NM_014219 NM_014226 NM_014228 NM_014231 NM_014240 NM_014246 NM_014256 NM_014276 NM_014283 NM_014284 NM_014310 NM_014324 NM_014331 NM_014339 NM_014347 NM_014349 NM_014350 NM_014369 NM_014374 NM_014379 NM_014382 NM_014388 NM_014391 NM_014393 NM_014396 NM_014397 NM_014398 NM_014412 NM_014418 NM_014430 NM_014434 NM_014435 NM_014456 NM_014458 NM_014459 NM_014467 NM_014468 NM_014480 NM_014495 NM_014496 NM_014497 NM_014506 NM_014507 NM_014513 NM_014517 NM_014518 NM_014552 NM_014554 NM_014556 NM_014563 NM_014571 NM_014573 NM_014575 NM_014584 NM_014585 NM_014586 NM_014591 NM_014601 NM_014602 NM_014607 NM_014614 NM_014616 NM_014628 NM_014629 NM_014631 NM_014634 NM_014635 NM_014636 NM_014647 NM_014649 NM_014653 NM_014655 NM_014661 NM_014668 NM_014671 NM_014679 NM_014680 NM_014682 NM_014702 NM_014703 NM_014704 NM_014711 NM_014714 NM_014717 NM_014720 NM_014723 NM_014724 NM_014726 NM_014728 NM_014729 NM_014731 NM_014732 NM_014734 NM_014735 NM_014736 NM_014742 NM_014746 NM_014747 NM_014751 NM_014754 NM_014755 NM_014757 NM_014758 NM_014762 NM_014765 NM_014766 NM_014770 NM_014774 NM_014783 NM_014787 NM_014789 NM_014792 NM_014800 NM_014802 NM_014805 NM_014810 NM_014815 NM_014828 NM_014832 NM_014839 NM_014840 NM_014844 NM_014849 NM_014850 NM_014853 NM_014854 NM_014862 NM_014864 NM_014867 NM_014870 NM_014872 NM_014873 NM_014879 NM_014880 NM_014882 NM_014883 NM_014884 NM_014885 NM_014888 NM_014897 NM_014898 NM_014899 NM_014901 NM_014902 NM_014904 NM_014906 NM_014910 NM_014912 NM_014920 NM_014921 NM_014924 NM_014930 NM_014932 NM_014934 NM_014935 NM_014936 NM_014945 NM_014946 NM_014948 NM_014952 NM_014953 NM_014955 NM_014959 NM_014960 NM_014964 NM_014965 NM_014978 NM_014982 NM_014985 NM_014991 NM_015003 NM_015008 NM_015020 NM_015022 NM_015032 NM_015033 NM_015035 NM_015039 NM_015049 NM_015051 NM_015066 NM_015071 NM_015074 NM_015075 NM_015076 NM_015077 NM_015079 NM_015080 NM_015085 NM_015086 NM_015087 NM_015088 NM_015090 NM_015092 NM_015101 NM_015111 NM_015113 NM_015115 NM_015127 NM_015129 NM_015130 NM_015137 NM_015141 NM_015148 NM_015150 NM_015162 NM_015163 NM_015170 NM_015185 NM_015193 NM_015194 NM_015199 NM_015200 NM_015202 NM_015203 NM_015206 NM_015208 NM_015214 NM_015219 NM_015230 NM_015236 NM_015254 NM_015260 NM_015264 NM_015266 NM_015267 NM_015270 NM_015271 NM_015272 NM_015274 NM_015275 NM_015277 NM_015288 NM_015289 NM_015305 NM_015310 NM_015317 NM_015318 NM_015319 NM_015327 NM_015328 NM_015329 NM_015336 NM_015344 NM_015345 NM_015346 NM_015349 NM_015352 NM_015353 NM_015354 NM_015366 NM_015367 NM_015368 NM_015375 NM_015378 NM_015383 NM_015393 NM_015394 NM_015396 NM_015433 NM_015435 NM_015436 NM_015455 NM_015458 NM_015460 NM_015463 NM_015470 NM_015475 NM_015485 NM_015506 NM_015517 NM_015530 NM_015533 NM_015540 NM_015548 NM_015553 NM_015554 NM_015555 NM_015557 NM_015564 NM_015565 NM_015567 NM_015568 NM_015578 NM_015585 NM_015595 NM_015605 NM_015621 NM_015635 NM_015640 NM_015651 NM_015654 NM_015655 NM_015657 NM_015678 NM_015683 NM_015686 NM_015691 NM_015696 NM_015713 NM_015718 NM_015725 NM_015833 NM_015834 NM_015836 NM_015840 NM_015841 NM_015850 NM_015865 NM_015866 NM_015878 NM_015881 NM_015910 NM_015935 NM_015939 NM_015946 NM_015948 NM_015959 NM_015964 NM_015980 NM_015981 NM_015987 NM_015993 NM_015995 NM_015999 NM_016018 NM_016026 NM_016040 NM_016045 NM_016046 NM_016050 NM_016072 NM_016078 NM_016079 NM_016081 NM_016083 NM_016085 NM_016090 NM_016114 NM_016123 NM_016125 NM_016140 NM_016152 NM_016156 NM_016169 NM_016173 NM_016195 NM_016196 NM_016200 NM_016206 NM_016210 NM_016221 NM_016224 NM_016227 NM_016228 NM_016232 NM_016240 NM_016242 NM_016247 NM_016249 NM_016257 NM_016260 NM_016261 NM_016262 NM_016263 NM_016272 NM_016282 NM_016297 NM_016320 NM_016329 NM_016331 NM_016333 NM_016338 NM_016343 NM_016351 NM_016363 NM_016373 NM_016376 NM_016406 NM_016412 NM_016418 NM_016426 NM_016428 NM_016429 NM_016433 NM_016436 NM_016441 NM_016447 NM_016452 NM_016453 NM_016476 NM_016484 NM_016507 NM_016513 NM_016519 NM_016533 NM_016540 NM_016544 NM_016548 NM_016551 NM_016552 NM_016557 NM_016561 NM_016575 NM_016577 NM_016581 NM_016590 NM_016599 NM_016607 NM_016617 NM_016626 NM_016628 NM_016641 NM_016643 NM_016647 NM_016649 NM_016734 NM_016830 NM_016930 NM_016946 NM_017412 NM_017414 NM_017415 NM_017420 NM_017423 NM_017424 NM_017435 NM_017437 NM_017439 NM_017460 NM_017483 NM_017485 NM_017486 NM_017488 NM_017516 NM_017520 NM_017523 NM_017541 NM_017547 NM_017548 NM_017551 NM_017553 NM_017554 NM_017555 NM_017556 NM_017559 NM_017563 NM_017575 NM_017576 NM_017577 NM_017580 NM_017582 NM_017583 NM_017588 NM_017599 NM_017611 NM_017617 NM_017623 NM_017626 NM_017628 NM_017634 NM_017637 NM_017638 NM_017644 NM_017645 NM_017649 NM_017651 NM_017652 NM_017654 NM_017655 NM_017656 NM_017662 NM_017666 NM_017669 NM_017671 NM_017681 NM_017684 NM_017688 NM_017692 NM_017697 NM_017699 NM_017701 NM_017705 NM_017706 NM_017707 NM_017709 NM_017712 NM_017713 NM_017714 NM_017723 NM_017728 NM_017736 NM_017737 NM_017740 NM_017741 NM_017751 NM_017760 NM_017763 NM_017768 NM_017770 NM_017772 NM_017774 NM_017776 NM_017779 NM_017786 NM_017789 NM_017801 NM_017821 NM_017824 NM_017829 NM_017832 NM_017836 NM_017837 NM_017842 NM_017844 NM_017847 NM_017849 NM_017850 NM_017856 NM_017863 NM_017866 NM_017872 NM_017875 NM_017879 NM_017885 NM_017891 NM_017893 NM_017896 NM_017904 NM_017913 NM_017924 NM_017925 NM_017927 NM_017933 NM_017939 NM_017943 NM_017946 NM_017951 NM_017952 NM_017953 NM_017958 NM_017966 NM_017968 NM_017982 NM_017990 NM_017991 NM_017998 NM_017999 NM_018015 NM_018017 NM_018018 NM_018022 NM_018027 NM_018029 NM_018035 NM_018039 NM_018043 NM_018045 NM_018048 NM_018049 NM_018050 NM_018059 NM_018060 NM_018069 NM_018070 NM_018073 NM_018084 NM_018091 NM_018092 NM_018105 NM_018107 NM_018108 NM_018114 NM_018115 NM_018129 NM_018130 NM_018131 NM_018156 NM_018157 NM_018159 NM_018167 NM_018170 NM_018177 NM_018194 NM_018201 NM_018202 NM_018205 NM_018210 NM_018211 NM_018212 NM_018215 NM_018222 NM_018224 NM_018239 NM_018242 NM_018243 NM_018252 NM_018263 NM_018265 NM_018268 NM_018276 NM_018277 NM_018280 NM_018284 NM_018289 NM_018299 NM_018300 NM_018306 NM_018310 NM_018316 NM_018319 NM_018322 NM_018332 NM_018337 NM_018340 NM_018342 NM_018348 NM_018353 NM_018361 NM_018364 NM_018367 NM_018371 NM_018372 NM_018374 NM_018379 NM_018381 NM_018383 NM_018400 NM_018404 NM_018407 NM_018409 NM_018416 NM_018424 NM_018439 NM_018440 NM_018445 NM_018447 NM_018452 NM_018461 NM_018462 NM_018470 NM_018471 NM_018472 NM_018480 NM_018482 NM_018485 NM_018489 NM_018490 NM_018491 NM_018566 NM_018579 NM_018602 NM_018662 NM_018668 NM_018674 NM_018683 NM_018684 NM_018689 NM_018691 NM_018724 NM_018837 NM_018841 NM_018845 NM_018846 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018930 NM_018940 NM_018941 NM_018944 NM_018945 NM_018947 NM_018951 NM_018962 NM_018963 NM_018964 NM_018969 NM_018970 NM_018975 NM_018976 NM_018981 NM_018982 NM_018999 NM_019001 NM_019007 NM_019011 NM_019013 NM_019014 NM_019016 NM_019020 NM_019028 NM_019042 NM_019043 NM_019044 NM_019046 NM_019054 NM_019063 NM_019064 NM_019067 NM_019069 NM_019081 NM_019089 NM_019094 NM_019096 NM_019099 NM_019119 NM_019556 NM_019590 NM_019595 NM_019605 NM_019610 NM_019616 NM_019618 NM_019644 NM_019841 NM_019842 NM_019844 NM_019846 NM_019863 NM_019886 NM_020037 NM_020038 NM_020062 NM_020116 NM_020119 NM_020123 NM_020125 NM_020127 NM_020128 NM_020131 NM_020132 NM_020133 NM_020134 NM_020139 NM_020141 NM_020142 NM_020143 NM_020144 NM_020148 NM_020150 NM_020151 NM_020163 NM_020167 NM_020168 NM_020177 NM_020184 NM_020198 NM_020200 NM_020208 NM_020211 NM_020213 NM_020215 NM_020223 NM_020237 NM_020242 NM_020245 NM_020311 NM_020312 NM_020313 NM_020319 NM_020337 NM_020338 NM_020340 NM_020341 NM_020346 NM_020347 NM_020360 NM_020363 NM_020364 NM_020367 NM_020371 NM_020374 NM_020381 NM_020384 NM_020390 NM_020403 NM_020405 NM_020420 NM_020440 NM_020443 NM_020444 NM_020445 NM_020447 NM_020448 NM_020451 NM_020452 NM_020453 NM_020465 NM_020472 NM_020473 NM_020475 NM_020476 NM_020477 NM_020526 NM_020535 NM_020546 NM_020550 NM_020552 NM_020553 NM_020630 NM_020638 NM_020640 NM_020650 NM_020655 NM_020663 NM_020665 NM_020666 NM_020673 NM_020682 NM_020686 NM_020698 NM_020699 NM_020702 NM_020713 NM_020714 NM_020715 NM_020717 NM_020724 NM_020739 NM_020746 NM_020747 NM_020749 NM_020751 NM_020752 NM_020754 NM_020760 NM_020762 NM_020766 NM_020769 NM_020770 NM_020772 NM_020773 NM_020776 NM_020781 NM_020782 NM_020789 NM_020792 NM_020796 NM_020801 NM_020802 NM_020803 NM_020805 NM_020807 NM_020808 NM_020810 NM_020815 NM_020816 NM_020821 NM_020825 NM_020826 NM_020832 NM_020834 NM_020844 NM_020850 NM_020853 NM_020856 NM_020870 NM_020871 NM_020886 NM_020894 NM_020895 NM_020896 NM_020899 NM_020909 NM_020914 NM_020917 NM_020918 NM_020919 NM_020921 NM_020922 NM_020925 NM_020927 NM_020936 NM_020940 NM_020947 NM_020948 NM_020951 NM_020952 NM_020954 NM_020957 NM_020962 NM_020980 NM_020983 NM_020993 NM_021015 NM_021020 NM_021030 NM_021033 NM_021034 NM_021036 NM_021044 NM_021045 NM_021061 NM_021079 NM_021083 NM_021088 NM_021090 NM_021094 NM_021097 NM_021101 NM_021116 NM_021128 NM_021131 NM_021137 NM_021141 NM_021143 NM_021148 NM_021153 NM_021163 NM_021164 NM_021167 NM_021168 NM_021181 NM_021184 NM_021187 NM_021190 NM_021201 NM_021215 NM_021239 NM_021240 NM_021252 NM_021615 NM_021637 NM_021638 NM_021642 NM_021643 NM_021644 NM_021648 NM_021649 NM_021722 NM_021723 NM_021728 NM_021735 NM_021736 NM_021737 NM_021783 NM_021785 NM_021798 NM_021812 NM_021813 NM_021815 NM_021821 NM_021823 NM_021828 NM_021831 NM_021903 NM_021904 NM_021905 NM_021910 NM_021913 NM_021914 NM_021915 NM_021916 NM_021923 NM_021925 NM_021931 NM_021935 NM_021938 NM_021942 NM_021943 NM_021945 NM_021949 NM_021957 NM_021961 NM_021962 NM_021973 NM_021977 NM_021984 NM_021987 NM_021990 NM_021999 NM_022002 NM_022037 NM_022050 NM_022062 NM_022071 NM_022073 NM_022074 NM_022080 NM_022085 NM_022087 NM_022090 NM_022096 NM_022097 NM_022098 NM_022103 NM_022116 NM_022119 NM_022123 NM_022126 NM_022131 NM_022132 NM_022133 NM_022135 NM_022137 NM_022139 NM_022140 NM_022143 NM_022144 NM_022145 NM_022151 NM_022154 NM_022164 NM_022171 NM_022173 NM_022336 NM_022341 NM_022343 NM_022351 NM_022359 NM_022361 NM_022369 NM_022405 NM_022458 NM_022459 NM_022463 NM_022465 NM_022473 NM_022477 NM_022479 NM_022482 NM_022484 NM_022487 NM_022491 NM_022497 NM_022549 NM_022553 NM_022568 NM_022570 NM_022648 NM_022663 NM_022716 NM_022726 NM_022727 NM_022744 NM_022749 NM_022751 NM_022753 NM_022754 NM_022755 NM_022758 NM_022760 NM_022766 NM_022767 NM_022771 NM_022776 NM_022777 NM_022787 NM_022810 NM_022819 NM_022828 NM_022831 NM_022836 NM_022843 NM_022894 NM_022895 NM_022901 NM_022905 NM_022910 NM_022912 NM_022916 NM_022965 NM_023005 NM_023007 NM_023016 NM_023018 NM_023037 NM_023038 NM_023073 NM_023080 NM_023105 NM_023106 NM_023107 NM_023108 NM_023109 NM_023111 NM_023923 NM_023924 NM_023926 NM_023927 NM_023928 NM_023937 NM_023938 NM_023939 NM_023943 NM_023947 NM_024009 NM_024021 NM_024022 NM_024035 NM_024037 NM_024043 NM_024052 NM_024055 NM_024063 NM_024068 NM_024076 NM_024087 NM_024092 NM_024094 NM_024102 NM_024105 NM_024107 NM_024110 NM_024294 NM_024300 NM_024312 NM_024325 NM_024332 NM_024342 NM_024344 NM_024345 NM_024419 NM_024422 NM_024423 NM_024424 NM_024425 NM_024426 NM_024490 NM_024511 NM_024513 NM_024522 NM_024546 NM_024551 NM_024554 NM_024557 NM_024558 NM_024563 NM_024569 NM_024571 NM_024573 NM_024585 NM_024586 NM_024587 NM_024590 NM_024593 NM_024594 NM_024595 NM_024598 NM_024607 NM_024614 NM_024620 NM_024621 NM_024623 NM_024624 NM_024625 NM_024627 NM_024628 NM_024638 NM_024646 NM_024656 NM_024661 NM_024686 NM_024700 NM_024701 NM_024709 NM_024711 NM_024713 NM_024718 NM_024733 NM_024738 NM_024747 NM_024751 NM_024758 NM_024761 NM_024769 NM_024770 NM_024771 NM_024778 NM_024779 NM_024781 NM_024782 NM_024784 NM_024786 NM_024789 NM_024792 NM_024794 NM_024795 NM_024798 NM_024809 NM_024812 NM_024818 NM_024824 NM_024843 NM_024845 NM_024854 NM_024861 NM_024863 NM_024875 NM_024878 NM_024881 NM_024884 NM_024887 NM_024889 NM_024893 NM_024907 NM_024915 NM_024917 NM_024924 NM_024939 NM_024945 NM_024946 NM_024971 NM_024974 NM_024989 NM_025023 NM_025026 NM_025027 NM_025040 NM_025042 NM_025048 NM_025049 NM_025057 NM_025058 NM_025059 NM_025072 NM_025074 NM_025078 NM_025082 NM_025083 NM_025084 NM_025090 NM_025097 NM_025125 NM_025134 NM_025144 NM_025146 NM_025164 NM_025168 NM_025180 NM_025191 NM_025202 NM_025203 NM_025208 NM_025212 NM_025216 NM_025218 NM_025222 NM_025250 NM_025251 NM_025265 NM_030379 NM_030380 NM_030381 NM_030569 NM_030578 NM_030588 NM_030593 NM_030594 NM_030621 NM_030623 NM_030625 NM_030627 NM_030633 NM_030636 NM_030637 NM_030639 NM_030640 NM_030643 NM_030644 NM_030650 NM_030660 NM_030664 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030673 NM_030754 NM_030759 NM_030762 NM_030766 NM_030767 NM_030773 NM_030780 NM_030781 NM_030787 NM_030791 NM_030793 NM_030799 NM_030805 NM_030806 NM_030808 NM_030810 NM_030812 NM_030817 NM_030820 NM_030884 NM_030891 NM_030899 NM_030911 NM_030915 NM_030918 NM_030925 NM_030927 NM_030934 NM_030938 NM_030939 NM_030949 NM_030950 NM_030952 NM_030953 NM_030962 NM_030971 NM_030980 NM_030981 NM_031200 NM_031211 NM_031215 NM_031226 NM_031244 NM_031281 NM_031296 NM_031302 NM_031305 NM_031308 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031409 NM_031411 NM_031412 NM_031417 NM_031418 NM_031422 NM_031426 NM_031437 NM_031439 NM_031444 NM_031445 NM_031448 NM_031453 NM_031461 NM_031462 NM_031468 NM_031469 NM_031474 NM_031476 NM_031479 NM_031482 NM_031483 NM_031485 NM_031845 NM_031846 NM_031847 NM_031849 NM_031857 NM_031860 NM_031866 NM_031887 NM_031888 NM_031899 NM_031908 NM_031911 NM_031912 NM_031949 NM_031952 NM_031954 NM_032010 NM_032012 NM_032013 NM_032014 NM_032039 NM_032105 NM_032107 NM_032116 NM_032141 NM_032148 NM_032151 NM_032160 NM_032167 NM_032174 NM_032179 NM_032196 NM_032208 NM_032221 NM_032222 NM_032229 NM_032239 NM_032257 NM_032264 NM_032268 NM_032276 NM_032279 NM_032285 NM_032288 NM_032294 NM_032296 NM_032311 NM_032314 NM_032317 NM_032318 NM_032322 NM_032323 NM_032329 NM_032336 NM_032347 NM_032354 NM_032364 NM_032373 NM_032374 NM_032382 NM_032401 NM_032404 NM_032408 NM_032415 NM_032421 NM_032423 NM_032436 NM_032440 NM_032444 NM_032445 NM_032446 NM_032449 NM_032451 NM_032472 NM_032485 NM_032491 NM_032495 NM_032501 NM_032505 NM_032508 NM_032514 NM_032515 NM_032521 NM_032524 NM_032529 NM_032532 NM_032538 NM_032539 NM_032554 NM_032558 NM_032561 NM_032564 NM_032572 NM_032581 NM_032582 NM_032584 NM_032587 NM_032608 NM_032620 NM_032632 NM_032644 NM_032646 NM_032664 NM_032689 NM_032701 NM_032706 NM_032711 NM_032735 NM_032750 NM_032753 NM_032758 NM_032765 NM_032770 NM_032775 NM_032780 NM_032781 NM_032782 NM_032783 NM_032785 NM_032788 NM_032796 NM_032804 NM_032805 NM_032813 NM_032815 NM_032817 NM_032822 NM_032824 NM_032828 NM_032831 NM_032832 NM_032833 NM_032845 NM_032846 NM_032850 NM_032859 NM_032865 NM_032866 NM_032871 NM_032873 NM_032876 NM_032886 NM_032892 NM_032895 NM_032901 NM_032906 NM_032918 NM_032932 NM_032933 NM_032937 NM_032947 NM_032950 NM_032951 NM_032952 NM_032953 NM_032954 NM_032968 NM_032969 NM_032973 NM_032976 NM_032977 NM_032982 NM_032983 NM_032984 NM_032991 NM_032992 NM_032994 NM_032995 NM_032998 NM_033012 NM_033013 NM_033017 NM_033018 NM_033056 NM_033062 NM_033064 NM_033070 NM_033083 NM_033091 NM_033102 NM_033103 NM_033107 NM_033119 NM_033127 NM_033130 NM_033133 NM_033135 NM_033136 NM_033137 NM_033141 NM_033143 NM_033158 NM_033159 NM_033170 NM_033171 NM_033172 NM_033173 NM_033181 NM_033198 NM_033206 NM_033210 NM_033211 NM_033224 NM_033238 NM_033239 NM_033240 NM_033242 NM_033244 NM_033245 NM_033247 NM_033250 NM_033252 NM_033266 NM_033271 NM_033281 NM_033285 NM_033288 NM_033296 NM_033319 NM_033331 NM_033332 NM_033346 NM_033357 NM_033360 NM_033364 NM_033387 NM_033389 NM_033393 NM_033409 NM_033421 NM_033423 NM_033425 NM_033426 NM_033428 NM_033430 NM_033437 NM_033439 NM_033446 NM_033449 NM_033467 NM_033484 NM_033505 NM_033512 NM_033535 NM_033540 NM_033542 NM_033548 NM_033550 NM_033631 NM_033633 NM_033634 NM_033635 NM_033636 NM_033637 NM_033640 NM_052821 NM_052822 NM_052827 NM_052828 NM_052832 NM_052847 NM_052859 NM_052861 NM_052869 NM_052878 NM_052880 NM_052882 NM_052884 NM_052885 NM_052886 NM_052890 NM_052898 NM_052900 NM_052901 NM_052905 NM_052910 NM_052919 NM_052926 NM_052928 NM_052941 NM_052954 NM_053002 NM_053023 NM_053024 NM_053029 NM_053044 NM_053046 NM_053055 NM_053056 NM_053064 NM_053279 NM_053282 NM_054016 NM_054111 NM_054114 NM_057090 NM_057091 NM_057160 NM_058183 NM_078469 NM_078470 NM_078476 NM_078483 NM_078628 NM_079421 NM_080282 NM_080390 NM_080491 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080546 NM_080551 NM_080564 NM_080592 NM_080625 NM_080631 NM_080645 NM_080650 NM_080660 NM_080664 NM_080666 NM_080732 NM_080737 NM_080740 NM_080758 NM_080759 NM_080760 NM_080818 NM_080821 NM_080836 NM_080863 NM_080867 NM_080870 NM_080872 NM_080876 NM_080911 NM_100264 NM_100486 NM_130440 NM_130442 NM_130759 NM_130783 NM_130786 NM_130788 NM_130792 NM_130798 NM_130807 NM_130809 NM_130810 NM_130811 NM_130830 NM_130848 NM_130906 NM_131916 NM_133170 NM_133177 NM_133178 NM_133265 NM_133269 NM_133271 NM_133272 NM_133273 NM_133274 NM_133277 NM_133278 NM_133334 NM_133367 NM_133368 NM_133373 NM_133378 NM_133432 NM_133437 NM_133444 NM_133445 NM_133448 NM_133451 NM_133452 NM_133463 NM_133473 NM_133477 NM_133480 NM_133481 NM_133482 NM_133490 NM_133496 NM_133509 NM_133625 NM_133627 NM_133628 NM_133629 NM_133630 NM_133631 NM_134421 NM_134422 NM_134423 NM_134424 NM_134431 NM_134434 NM_134445 NM_134446 NM_138287 NM_138293 NM_138300 NM_138319 NM_138328 NM_138343 NM_138348 NM_138357 NM_138360 NM_138369 NM_138375 NM_138384 NM_138399 NM_138400 NM_138423 NM_138424 NM_138428 NM_138429 NM_138430 NM_138444 NM_138450 NM_138456 NM_138457 NM_138467 NM_138473 NM_138476 NM_138479 NM_138554 NM_138556 NM_138557 NM_138558 NM_138574 NM_138636 NM_138638 NM_138640 NM_138691 NM_138694 NM_138703 NM_138713 NM_138714 NM_138722 NM_138723 NM_138731 NM_138732 NM_138734 NM_138768 NM_138773 NM_138777 NM_138787 NM_138793 NM_138799 NM_138813 NM_138925 NM_138926 NM_138927 NM_138967 NM_138969 NM_139005 NM_139012 NM_139014 NM_139016 NM_139067 NM_139076 NM_139131 NM_139132 NM_139177 NM_139182 NM_139207 NM_139211 NM_139212 NM_139245 NM_139265 NM_139267 NM_139276 NM_139277 NM_139278 NM_139279 NM_139280 NM_139283 NM_139290 NM_139319 NM_139321 NM_144502 NM_144503 NM_144504 NM_144567 NM_144580 NM_144585 NM_144588 NM_144599 NM_144607 NM_144609 NM_144613 NM_144618 NM_144621 NM_144622 NM_144628 NM_144632 NM_144644 NM_144664 NM_144667 NM_144671 NM_144682 NM_144684 NM_144687 NM_144706 NM_144707 NM_144712 NM_144728 NM_144729 NM_144732 NM_144733 NM_144734 NM_144767 NM_144770 NM_144949 NM_144966 NM_144967 NM_144968 NM_144970 NM_144973 NM_144977 NM_144984 NM_144990 NM_145005 NM_145010 NM_145011 NM_145013 NM_145015 NM_145021 NM_145025 NM_145033 NM_145035 NM_145043 NM_145044 NM_145055 NM_145059 NM_145071 NM_145115 NM_145117 NM_145165 NM_145166 NM_145179 NM_145212 NM_145231 NM_145259 NM_145261 NM_145263 NM_145272 NM_145273 NM_145277 NM_145279 NM_145286 NM_145295 NM_145306 NM_145307 NM_145312 NM_145325 NM_145341 NM_145342 NM_145349 NM_145350 NM_145351 NM_145352 NM_145638 NM_145639 NM_145640 NM_145641 NM_145642 NM_145648 NM_145649 NM_145650 NM_145655 NM_145660 NM_145689 NM_145693 NM_145698 NM_145716 NM_145735 NM_145753 NM_145754 NM_145759 NM_145762 NM_145763 NM_145799 NM_145804 NM_145809 NM_145818 NM_145865 NM_145868 NM_145869 NM_145872 NM_145906 NM_145909 NM_145912 NM_145913 NM_147128 NM_147134 NM_147147 NM_147148 NM_147152 NM_147161 NM_147180 NM_147187 NM_147194 NM_147195 NM_147196 NM_147202 NM_147777 NM_148169 NM_148170 NM_148171 NM_148174 NM_148571 NM_148842 NM_148904 NM_148905 NM_148906 NM_148907 NM_148908 NM_148909 NM_148921 NM_148960 NM_148961 NM_148975 NM_152133 NM_152221 NM_152222 NM_152235 NM_152244 NM_152245 NM_152247 NM_152253 NM_152257 NM_152261 NM_152263 NM_152266 NM_152269 NM_152271 NM_152274 NM_152280 NM_152288 NM_152291 NM_152300 NM_152304 NM_152308 NM_152309 NM_152314 NM_152320 NM_152321 NM_152322 NM_152332 NM_152333 NM_152340 NM_152341 NM_152357 NM_152362 NM_152363 NM_152365 NM_152367 NM_152374 NM_152375 NM_152376 NM_152377 NM_152381 NM_152389 NM_152391 NM_152392 NM_152395 NM_152399 NM_152400 NM_152403 NM_152405 NM_152406 NM_152409 NM_152411 NM_152416 NM_152418 NM_152420 NM_152433 NM_152437 NM_152439 NM_152440 NM_152449 NM_152451 NM_152453 NM_152454 NM_152458 NM_152459 NM_152462 NM_152475 NM_152491 NM_152496 NM_152497 NM_152515 NM_152538 NM_152547 NM_152551 NM_152568 NM_152570 NM_152571 NM_152581 NM_152583 NM_152587 NM_152588 NM_152595 NM_152619 NM_152621 NM_152624 NM_152626 NM_152629 NM_152641 NM_152652 NM_152667 NM_152673 NM_152675 NM_152678 NM_152680 NM_152681 NM_152682 NM_152686 NM_152690 NM_152693 NM_152695 NM_152698 NM_152701 NM_152717 NM_152722 NM_152729 NM_152753 NM_152754 NM_152763 NM_152765 NM_152774 NM_152776 NM_152786 NM_152787 NM_152793 NM_152832 NM_152834 NM_152835 NM_152836 NM_152837 NM_152840 NM_152842 NM_152864 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152880 NM_152881 NM_152882 NM_152883 NM_152890 NM_152897 NM_152909 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152933 NM_152934 NM_152942 NM_152943 NM_152988 NM_152990 NM_152994 NM_152995 NM_152999 NM_153010 NM_153015 NM_153026 NM_153027 NM_153033 NM_153034 NM_153040 NM_153042 NM_153043 NM_153044 NM_153045 NM_153050 NM_153051 NM_153207 NM_153217 NM_153218 NM_153220 NM_153231 NM_153232 NM_153233 NM_153235 NM_153239 NM_153240 NM_153244 NM_153255 NM_153256 NM_153257 NM_153259 NM_153261 NM_153262 NM_153263 NM_153264 NM_153271 NM_153274 NM_153281 NM_153282 NM_153283 NM_153284 NM_153285 NM_153286 NM_153320 NM_153332 NM_153335 NM_153343 NM_153344 NM_153346 NM_153365 NM_153367 NM_153378 NM_153381 NM_153451 NM_153456 NM_153487 NM_153499 NM_153500 NM_153607 NM_153611 NM_153619 NM_153620 NM_153683 NM_153688 NM_153691 NM_153703 NM_153705 NM_153708 NM_153714 NM_153715 NM_153717 NM_153812 NM_153818 NM_153824 NM_153837 NM_170604 NM_170686 NM_170706 NM_170707 NM_170708 NM_170709 NM_170710 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170721 NM_170738 NM_170739 NM_170740 NM_170746 NM_170750 NM_170754 NM_170768 NM_170771 NM_171825 NM_171982 NM_171998 NM_172003 NM_172024 NM_172037 NM_172058 NM_172059 NM_172060 NM_172069 NM_172087 NM_172088 NM_172089 NM_172099 NM_172110 NM_172111 NM_172112 NM_172113 NM_172159 NM_172160 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172193 NM_172206 NM_172211 NM_172216 NM_172217 NM_172219 NM_172220 NM_172226 NM_172239 NM_172240 NM_172241 NM_172242 NM_172312 NM_172337 NM_172345 NM_172373 NM_172387 NM_172388 NM_172389 NM_173042 NM_173043 NM_173044 NM_173060 NM_173076 NM_173078 NM_173079 NM_173083 NM_173087 NM_173088 NM_173089 NM_173090 NM_173164 NM_173170 NM_173191 NM_173192 NM_173193 NM_173194 NM_173195 NM_173198 NM_173200 NM_173214 NM_173216 NM_173217 NM_173342 NM_173354 NM_173355 NM_173462 NM_173463 NM_173464 NM_173470 NM_173473 NM_173476 NM_173477 NM_173478 NM_173495 NM_173511 NM_173513 NM_173519 NM_173529 NM_173531 NM_173536 NM_173537 NM_173546 NM_173547 NM_173555 NM_173558 NM_173561 NM_173562 NM_173564 NM_173578 NM_173580 NM_173587 NM_173588 NM_173591 NM_173602 NM_173611 NM_173613 NM_173617 NM_173622 NM_173623 NM_173626 NM_173630 NM_173632 NM_173638 NM_173639 NM_173640 NM_173641 NM_173644 NM_173649 NM_173651 NM_173654 NM_173657 NM_173667 NM_173669 NM_173675 NM_173676 NM_173682 NM_173689 NM_173700 NM_173728 NM_173795 NM_173799 NM_173805 NM_173807 NM_173808 NM_173809 NM_173822 NM_173823 NM_173827 NM_173834 NM_173844 NM_173848 NM_173851 NM_173854 NM_173855 NM_174858 NM_174871 NM_174895 NM_174899 NM_174900 NM_174914 NM_174934 NM_174936 NM_174937 NM_174947 NM_174952 NM_174959 NM_174976 NM_174977 NM_175038 NM_175062 NM_175063 NM_175066 NM_175069 NM_175071 NM_175072 NM_175073 NM_175078 NM_175085 NM_175567 NM_175568 NM_175569 NM_175610 NM_175709 NM_175719 NM_175720 NM_175721 NM_175722 NM_175723 NM_175733 NM_175736 NM_175738 NM_175767 NM_175848 NM_175849 NM_175850 NM_175864 NM_175871 NM_175876 NM_175884 NM_175888 NM_175898 NM_175900 NM_175901 NM_175908 NM_175913 NM_175921 NM_175922 NM_175923 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176787 NM_176792 NM_176800 NM_176815 NM_176816 NM_176823 NM_176825 NM_176853 NM_176871 NM_176875 NM_177402 NM_177405 NM_177414 NM_177436 NM_177438 NM_177441 NM_177453 NM_177454 NM_177532 NM_177551 NM_177937 NM_177947 NM_177948 NM_177965 NM_177968 NM_177972 NM_177974 NM_177978 NM_177979 NM_177990 NM_178000 NM_178001 NM_178002 NM_178003 NM_178034 NM_178123 NM_178126 NM_178136 NM_178140 NM_178151 NM_178152 NM_178153 NM_178170 NM_178228 NM_178314 NM_178353 NM_178422 NM_178432 NM_178445 NM_178452 NM_178491 NM_178494 NM_178505 NM_178509 NM_178514 NM_178516 NM_178517 NM_178520 NM_178544 NM_178550 NM_178556 NM_178557 NM_178563 NM_178564 NM_178566 NM_178569 NM_178580 NM_178583 NM_178585 NM_178586 NM_178816 NM_178818 NM_178829 NM_178831 NM_178842 NM_178849 NM_178858 NM_180976 NM_180977 NM_180989 NM_180991 NM_181041 NM_181076 NM_181077 NM_181078 NM_181079 NM_181265 NM_181285 NM_181286 NM_181287 NM_181288 NM_181290 NM_181292 NM_181293 NM_181294 NM_181295 NM_181298 NM_181299 NM_181311 NM_181312 NM_181313 NM_181314 NM_181333 NM_181354 NM_181359 NM_181430 NM_181431 NM_181453 NM_181481 NM_181482 NM_181483 NM_181489 NM_181491 NM_181504 NM_181507 NM_181508 NM_181509 NM_181523 NM_181524 NM_181531 NM_181534 NM_181558 NM_181578 NM_181618 NM_181621 NM_181659 NM_181671 NM_181709 NM_181714 NM_181727 NM_181740 NM_181741 NM_181742 NM_181762 NM_181776 NM_181777 NM_181782 NM_181784 NM_181785 NM_181789 NM_181807 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181837 NM_181838 NM_181844 NM_181846 NM_181871 NM_181877 NM_182314 NM_182487 NM_182495 NM_182500 NM_182502 NM_182506 NM_182507 NM_182508 NM_182513 NM_182517 NM_182524 NM_182533 NM_182534 NM_182540 NM_182554 NM_182564 NM_182565 NM_182568 NM_182580 NM_182584 NM_182586 NM_182587 NM_182595 NM_182596 NM_182607 NM_182609 NM_182623 NM_182633 NM_182637 NM_182638 NM_182662 NM_182663 NM_182664 NM_182665 NM_182678 NM_182685 NM_182686 NM_182688 NM_182699 NM_182700 NM_182701 NM_182729 NM_182740 NM_182742 NM_182743 NM_182746 NM_182757 NM_182758 NM_182765 NM_182790 NM_182791 NM_182798 NM_182799 NM_182801 NM_182802 NM_182812 NM_182827 NM_182832 NM_182847 NM_182848 NM_182903 NM_182909 NM_182918 NM_182919 NM_182922 NM_182925 NM_182926 NM_182948 NM_182964 NM_182975 NM_182978 NM_182984 NM_183004 NM_183006 NM_183010 NM_183040 NM_183050 NM_183065 NM_183078 NM_183238 NM_183352 NM_183357 NM_183372 NM_183373 NM_183376 NM_183380 NM_183387 NM_183419 NM_183420 NM_183421 NM_184231 NM_194071 NM_194252 NM_194259 NM_194260 NM_194261 NM_194272 NM_194278 NM_194282 NM_194283 NM_194285 NM_194286 NM_194287 NM_194288 NM_194289 NM_194294 NM_194295 NM_194298 NM_194303 NM_194309 NM_194310 NM_194313 NM_194314 NM_194317 NM_194319 NM_194324 NM_194356 NM_194430 NM_194431 NM_194434 NM_194451 NM_194454 NM_194455 NM_194456 NM_197939 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197956 NM_198061 NM_198074 NM_198086 NM_198098 NM_198123 NM_198124 NM_198151 NM_198152 NM_198153 NM_198156 NM_198181 NM_198182 NM_198194 NM_198196 NM_198264 NM_198267 NM_198278 NM_198289 NM_198291 NM_198312 NM_198316 NM_198320 NM_198324 NM_198329 NM_198381 NM_198391 NM_198392 NM_198399 NM_198402 NM_198403 NM_198433 NM_198434 NM_198435 NM_198436 NM_198437 NM_198439 NM_198442 NM_198459 NM_198460 NM_198461 NM_198465 NM_198474 NM_198476 NM_198484 NM_198485 NM_198490 NM_198493 NM_198513 NM_198526 NM_198532 NM_198545 NM_198549 NM_198562 NM_198564 NM_198569 NM_198584 NM_198586 NM_198595 NM_198596 NM_198682 NM_198699 NM_198715 NM_198720 NM_198793 NM_198797 NM_198798 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198841 NM_198844 NM_198847 NM_198849 NM_198859 NM_198887 NM_198893 NM_198900 NM_198920 NM_198926 NM_198938 NM_198939 NM_198940 NM_198956 NM_198968 NM_198971 NM_198974 NM_198992 NM_198993 NM_199003 NM_199040 NM_199044 NM_199045 NM_199050 NM_199053 NM_199072 NM_199076 NM_199078 NM_199131 NM_199139 NM_199162 NM_199168 NM_199176 NM_199177 NM_199182 NM_199192 NM_199193 NM_199245 NM_199246 NM_199249 NM_199250 NM_199259 NM_199260 NM_199261 NM_199321 NM_199329 NM_199343 NM_199355 NM_199413 NM_199414 NM_199415 NM_199420 NM_199421 NM_199436 NM_199440 NM_199459 NM_199462 NM_199511 NM_199512 NM_201259 NM_201260 NM_201261 NM_201263 NM_201266 NM_201278 NM_201279 NM_201281 NM_201348 NM_201403 NM_201413 NM_201414 NM_201428 NM_201429 NM_201430 NM_201431 NM_201432 NM_201433 NM_201453 NM_201543 NM_201544 NM_201545 NM_201548 NM_201550 NM_201565 NM_201570 NM_201571 NM_201572 NM_201590 NM_201591 NM_201592 NM_201593 NM_201596 NM_201597 NM_201599 NM_201625 NM_201628 NM_201629 NM_201633 NM_202004 NM_203281 NM_203282 NM_203298 NM_203306 NM_203307 NM_203327 NM_203329 NM_203330 NM_203331 NM_203341 NM_203342 NM_203343 NM_203372 NM_203381 NM_203382 NM_203395 NM_203403 NM_203406 NM_203422 NM_203446 NM_203447 NM_203448 NM_203451 NM_203452 NM_203453 NM_203459 NM_203463 NM_203481 NM_203487 NM_203510 NM_205836 NM_205849 NM_205857 NM_205860 NM_205861 NM_206538 NM_206809 NM_206810 NM_206811 NM_206812 NM_206813 NM_206814 NM_206839 NM_206855 NM_206866 NM_206893 NM_206894 NM_206909 NM_206910 NM_206911 NM_206914 NM_206926 NM_206933 NM_206938 NM_206939 NM_206940 NM_206944 NM_206945 NM_206946 NM_206947 NM_207009 NM_207015 NM_207035 NM_207111 NM_207116 NM_207119 NM_207168 NM_207172 NM_207285 NM_207303 NM_207309 NM_207311 NM_207321 NM_207325 NM_207330 NM_207331 NM_207333 NM_207334 NM_207335 NM_207344 NM_207348 NM_207352 NM_207356 NM_207358 NM_207359 NM_207362 NM_207366 NM_207372 NM_207376 NM_207379 NM_207380 NM_207381 NM_207383 NM_207387 NM_207394 NM_207400 NM_207405 NM_207406 NM_207411 NM_207422 NM_207429 NM_207432 NM_207440 NM_207446 NM_207447 NM_207448 NM_207454 NM_207462 NM_207463 NM_207465 NM_207467 NM_207470 NM_207472 NM_207474 NM_207475 NM_207478 NM_207482 NM_207483 NM_207486 NM_207488 NM_207489 NM_207495 NM_207497 NM_207500 NM_207502 NM_207504 NM_207505 NM_207517 NM_207644 NM_207645 NM_207646 NM_207660 NM_207661 NM_207662 NM_212460 NM_212464 NM_212465 NM_212467 NM_212469 NM_212555 NM_212556 NM_212558 NM_213566 NM_213568 NM_213589 NM_213594 NM_213604 NM_213606 NM_213609 NM_213651 NM_213652 NM_213653 NM_213654 NM_213662 NM_213723 NM_213726 NM_214711 XM_027236 XM_027307 XM_028810 XM_029962 XM_031689 XM_032571 XM_032901 XM_032945 XM_032996 XM_034274 XM_038436 XM_039570 XM_041126 XM_042698 XM_042833 XM_042936 XM_042978 XM_043493 XM_044178 XM_047355 XM_047550 XM_047554 XM_048592 XM_048898 XM_049237 XM_051017 XM_057107 XM_057296 XM_058628 XM_058720 XM_059318 XM_059482 XM_059832 XM_059929 XM_059954 XM_064190 XM_067585 XM_067605 XM_084467 XM_086360 XM_086761 XM_086937 XM_087137 XM_087353 XM_087386 XM_087672 XM_089384 XM_091331 XM_096317 XM_097977 XM_098828 XM_113228 XM_114000 XM_114047 XM_114090 XM_117117 XM_166140 XM_167147 XM_168530 XM_171054 XM_172801 XM_172995 XM_208204 XM_208522 XM_208835 XM_208847 XM_209097 XM_209227 XM_209554 XM_209607 XM_209700 XM_209741 XM_211805 XM_212170 XM_212326 XM_290342 XM_290502 XM_290597 XM_290615 XM_290734 XM_290737 XM_290777 XM_290809 XM_291017 XM_291020 XM_291075 XM_291105 XM_291344 XM_291947 XM_292765 XM_293687 XM_294261 XM_294521 XM_294765 XM_294993 XM_295155 XM_298151 XM_350880 XM_351948 XM_370541 XM_370603 XM_370607 XM_370654 XM_370696 XM_370709 XM_370839 XM_370843 XM_370878 XM_370899 XM_370928 XM_370932 XM_370995 XM_371074 XM_371116 XM_371132 XM_371176 XM_371204 XM_371254 XM_371302 XM_371304 XM_371311 XM_371399 XM_371461 XM_371488 XM_371590 XM_371617 XM_371664 XM_371680 XM_371769 XM_371777 XM_371797 XM_371801 XM_371820 XM_371823 XM_371838 XM_371891 XM_371933 XM_372035 XM_372038 XM_372039 XM_372045 XM_372090 XM_372097 XM_372110 XM_372118 XM_372121 XM_372193 XM_372205 XM_372248 XM_372556 XM_372723 XM_373290 XM_373477 XM_373500 XM_373539 XM_373645 XM_373690 XM_373695 XM_373742 XM_373744 XM_373748 XM_373750 XM_373865 XM_373883 XM_373885 XM_374003 XM_374012 XM_374013 XM_374064 XM_374069 XM_374093 XM_374094 XM_374101 XM_374112 XM_374260 XM_374270 XM_374317 XM_374343 XM_374422 XM_374435 XM_374484 XM_374491 XM_374529 XM_374586 XM_374765 XM_374767 XM_374768 XM_374781 XM_374842 XM_374912 XM_374915 XM_374945 XM_374973 XM_374983 XM_375007 XM_375018 XM_375090 XM_375272 XM_375275 XM_375292 XM_375307 XM_375357 XM_375373 XM_375491 XM_375558 XM_375590 XM_375606 XM_375608 XM_375747 XM_375816 XM_375838 XM_375853 XM_375928 XM_375929 XM_376018 XM_376049 XM_376062 XM_376207 XM_376241 XM_376254 XM_376269 XM_376318 XM_376372 XM_376386 XM_376412 XM_376522 XM_376550 XM_376558 XM_376586 XM_376679 XM_376680 XM_376720 XM_376783 XM_376784 XM_376795 XM_376843 XM_376869 XM_376902 XM_376905 XM_376981 XM_377041 XM_377053 XM_377476 XM_378203 XM_378236 XM_378240 XM_378250 XM_378272 XM_378273 XM_378279 XM_378299 XM_378312 XM_378327 XM_378331 XM_378368 XM_378389 XM_378398 XM_378421 XM_378437 XM_378454 XM_378456 XM_378460 XM_378473 XM_378507 XM_378512 XM_378516 XM_378529 XM_378542 XM_378544 XM_378545 XM_378546 XM_378550 XM_378558 XM_378567 XM_378573 XM_378608 XM_378617 XM_378620 XM_378655 XM_378667 XM_378678 XM_378692 XM_378700 XM_378703 XM_378735 XM_378738 XM_378741 XM_378743 XM_378746 XM_378751 XM_378783 XM_378786 XM_378793 XM_378795 XM_378798 XM_378799 XM_378810 XM_378824 XM_378843 XM_378852 XM_378866 XM_378874 XM_378876 XM_378914 XM_378917 XM_378946 XM_378964 XM_378971 XM_378976 XM_379006 XM_379030 XM_379041 XM_379060 XM_379075 XM_379078 XM_379086 XM_379097 XM_379100 XM_379111 XM_379114 XM_379141 XM_379145 XM_379154 XM_379156 XM_379164 XM_379173 XM_379204 XM_379206 XM_379215 XM_379243 XM_379273 XM_379276 XM_379280 XM_379288 XM_379295 XM_379318 XM_379363 XM_379371 XM_379372 XM_379378 XM_379380 XM_379381 XM_379391 XM_379403 XM_379406 XM_379417 XM_379437 XM_379452 XM_379454 XM_379459 XM_379477 XM_379485 XM_379506 XM_379510 XM_379512 XM_379515 XM_379530 XM_379534 XM_379535 XM_379543 XM_379547 XM_379573 XM_379582 XM_379592 XM_379595 XM_379597 XM_379623 XM_379634 XM_379637 XM_379684 XM_379705 XM_379716 XM_379722 XM_379798 XM_379933 XM_379934 XM_379967 XM_380092 XM_380104 XM_380127 XM_380131 XM_380135 XM_380139 XM_380154 XM_380159 XM_380160 XM_495795 XM_495798 XM_495807 XM_495814 XM_495844 XM_495867 XM_495890 XM_495902 XM_495909 XM_495939 XM_495950 XM_495970 XM_496036 XM_496037 XM_496041 XM_496044 XM_496049 XM_496081 XM_496088 XM_496103 XM_496134 XM_496156 XM_496191 XM_496223 XM_496239 XM_496281 XM_496299 XM_496349 XM_496351 XM_496354 XM_496373 XM_496379 XM_496394 XM_496399 XM_496431 XM_496434 XM_496519 XM_496537 XM_496547 XM_496549 XM_496581 XM_496597 XM_496603 XM_496622 XM_496653 XM_496692 XM_496701 XM_496703 XM_496726 XM_496780 XM_496781 XM_496844 XM_496849 XM_496879 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497010 XM_497036 XM_497056 XM_497072 XM_497080 XM_497181 XM_498421 XM_498436 XM_498439 XM_498442 XM_498449 XM_498452 XM_498456 XM_498457 XM_498460 XM_498465 XM_498467 XM_498473 XM_498474 XM_498481 XM_498490 XM_498497 XM_498500 XM_498510 XM_498534 XM_498537 XM_498540 XM_498544 XM_498549 XM_498555 XM_498558 XM_498563 XM_498564 XM_498568 XM_498569 XM_498572 XM_498575 XM_498582 XM_498589 XM_498593 XM_498594 XM_498597 XM_498611 XM_498614 XM_498629 XM_498649 XM_498660 XM_498681 XM_498683 XM_498724 XM_498732 XM_498750 XM_498824 XM_498825 XM_498831 XM_498845 XM_498850 XM_498852 XM_498853 XM_498865 XM_498872 XM_498882 XM_498883 XM_498884 XM_498889 XM_498901 XM_498907 XM_498926 XM_498929 XM_498932 XM_498954 XM_498958 XM_498960 XM_498981 XM_498991 XM_498992 XM_498998 XM_499005 XM_499008 XM_499020 XM_499045 XM_499046 XM_499047 XM_499057 XM_499065 XM_499071 XM_499084 XM_499093 XM_499105 XM_499117 XM_499120 XM_499125 XM_499130 XM_499136 XM_499137 XM_499142 XM_499147 XM_499148 XM_499149 XM_499152 XM_499177 XM_499182 XM_499257 XM_499298 XM_499309 XM_499366 XM_499502 XM_499505 XM_499515 XM_499524 XM_499539 XM_499556 XM_499564 XM_499566 XM_499569 XM_499572 XM_499579 XM_499585 XM_499586 XM_499590 XM_499595 XM_499597 XM_499602 XR_000182 XR_000190 XR_000192 XR_000216 XR_000217 XR_000256 XR_000265 XR_000268 XR_000272 XR_000293
Genes with multiple seed matches:
NM_000046 NM_000052 NM_000133 NM_000136 NM_000139 NM_000199 NM_000219 NM_000222 NM_000232 NM_000243 NM_000254 NM_000264 NM_000266 NM_000268 NM_000293 NM_000332 NM_000337 NM_000351 NM_000411 NM_000418 NM_000436 NM_000439 NM_000484 NM_000486 NM_000527 NM_000550 NM_000551 NM_000555 NM_000565 NM_000573 NM_000575 NM_000595 NM_000604 NM_000614 NM_000618 NM_000651 NM_000663 NM_000664 NM_000767 NM_000786 NM_000809 NM_000843 NM_000861 NM_000877 NM_000909 NM_000916 NM_000923 NM_000961 NM_000991 NM_000997 NM_001001684 NM_001001686 NM_001001698 NM_001001701 NM_001001709 NM_001001711 NM_001001789 NM_001001927 NM_001001938 NM_001002017 NM_001002018 NM_001002762 NM_001002799 NM_001002838 NM_001002860 NM_001002912 NM_001003399 NM_001003674 NM_001003675 NM_001003679 NM_001003688 NM_001003716 NM_001003795 NM_001004285 NM_001004286 NM_001004299 NM_001004336 NM_001004430 NM_001005217 NM_001005388 NM_001005609 NM_001006116 NM_001006637 NM_001006638 NM_001006935 NM_001006936 NM_001006937 NM_001007094 NM_001007097 NM_001007214 NM_001007224 NM_001007257 NM_001007471 NM_001007536 NM_001008234 NM_001008408 NM_001008493 NM_001008528 NM_001008537 NM_001008539 NM_001008564 NM_001008693 NM_001008781 NM_001008925 NM_001009880 NM_001009883 NM_001009913 NM_001010000 NM_001010846 NM_001010853 NM_001010864 NM_001010867 NM_001010883 NM_001010891 NM_001010898 NM_001011537 NM_001011538 NM_001011658 NM_001012393 NM_001012418 NM_001012761 NM_001012957 NM_001012968 NM_001012987 NM_001013629 NM_001013676 NM_001013677 NM_001013690 NM_001013692 NM_001013697 NM_001013704 NM_001014380 NM_001014797 NM_001015045 NM_001015048 NM_001015049 NM_001017424 NM_001017425 NM_001017440 NM_001017524 NM_001018053 NM_001018058 NM_001023563 NM_001024216 NM_001024843 NM_001024858 NM_001025068 NM_001025069 NM_001025100 NM_001025107 NM_001025252 NM_001025253 NM_001083 NM_001111 NM_001114 NM_001128 NM_001132 NM_001157 NM_001167 NM_001172 NM_001204 NM_001230 NM_001259 NM_001304 NM_001332 NM_001399 NM_001423 NM_001460 NM_001490 NM_001548 NM_001584 NM_001585 NM_001621 NM_001655 NM_001678 NM_001720 NM_001745 NM_001748 NM_001798 NM_001830 NM_001883 NM_001941 NM_002006 NM_002025 NM_002040 NM_002053 NM_002071 NM_002119 NM_002251 NM_002298 NM_002349 NM_002355 NM_002468 NM_002545 NM_002547 NM_002570 NM_002612 NM_002711 NM_002725 NM_002737 NM_002740 NM_002827 NM_002848 NM_002871 NM_002874 NM_002886 NM_002926 NM_002990 NM_002996 NM_003009 NM_003012 NM_003014 NM_003017 NM_003043 NM_003045 NM_003046 NM_003074 NM_003112 NM_003150 NM_003203 NM_003212 NM_003262 NM_003270 NM_003281 NM_003320 NM_003324 NM_003339 NM_003391 NM_003395 NM_003421 NM_003423 NM_003439 NM_003463 NM_003471 NM_003489 NM_003605 NM_003617 NM_003622 NM_003633 NM_003644 NM_003681 NM_003714 NM_003734 NM_003749 NM_003824 NM_003840 NM_003861 NM_003872 NM_003913 NM_003958 NM_003980 NM_004078 NM_004079 NM_004080 NM_004101 NM_004104 NM_004105 NM_004142 NM_004193 NM_004302 NM_004338 NM_004350 NM_004367 NM_004370 NM_004402 NM_004422 NM_004428 NM_004438 NM_004464 NM_004513 NM_004518 NM_004586 NM_004598 NM_004622 NM_004663 NM_004707 NM_004711 NM_004731 NM_004736 NM_004744 NM_004745 NM_004797 NM_004798 NM_004805 NM_004845 NM_004859 NM_004873 NM_004985 NM_004992 NM_005010 NM_005044 NM_005047 NM_005063 NM_005076 NM_005079 NM_005093 NM_005108 NM_005116 NM_005119 NM_005147 NM_005160 NM_005189 NM_005197 NM_005387 NM_005400 NM_005419 NM_005446 NM_005449 NM_005458 NM_005465 NM_005504 NM_005508 NM_005540 NM_005578 NM_005678 NM_005699 NM_005715 NM_005739 NM_005840 NM_005859 NM_005879 NM_005900 NM_005906 NM_005909 NM_006018 NM_006045 NM_006065 NM_006074 NM_006089 NM_006106 NM_006133 NM_006148 NM_006206 NM_006213 NM_006237 NM_006239 NM_006242 NM_006291 NM_006306 NM_006315 NM_006323 NM_006335 NM_006355 NM_006371 NM_006390 NM_006393 NM_006499 NM_006517 NM_006527 NM_006534 NM_006544 NM_006572 NM_006599 NM_006606 NM_006614 NM_006620 NM_006624 NM_006628 NM_006731 NM_006777 NM_006785 NM_006802 NM_006827 NM_006847 NM_006892 NM_006915 NM_006995 NM_007021 NM_007050 NM_007131 NM_007137 NM_007168 NM_007173 NM_007174 NM_007198 NM_007249 NM_007306 NM_007335 NM_007336 NM_007338 NM_007345 NM_007362 NM_012075 NM_012089 NM_012102 NM_012134 NM_012157 NM_012173 NM_012193 NM_012239 NM_012252 NM_012288 NM_012304 NM_012306 NM_012309 NM_012327 NM_012384 NM_012395 NM_012400 NM_012443 NM_012463 NM_012464 NM_012465 NM_013231 NM_013238 NM_013255 NM_013286 NM_013323 NM_013374 NM_013381 NM_013402 NM_013438 NM_013446 NM_013447 NM_013943 NM_014014 NM_014028 NM_014048 NM_014089 NM_014106 NM_014112 NM_014157 NM_014166 NM_014217 NM_014256 NM_014276 NM_014391 NM_014397 NM_014398 NM_014412 NM_014456 NM_014563 NM_014584 NM_014586 NM_014591 NM_014601 NM_014631 NM_014634 NM_014636 NM_014649 NM_014661 NM_014668 NM_014704 NM_014728 NM_014732 NM_014755 NM_014762 NM_014774 NM_014792 NM_014810 NM_014840 NM_014844 NM_014854 NM_014864 NM_014870 NM_014883 NM_014910 NM_014912 NM_014924 NM_014935 NM_014936 NM_014946 NM_014948 NM_014959 NM_014991 NM_015032 NM_015049 NM_015051 NM_015071 NM_015074 NM_015079 NM_015087 NM_015088 NM_015090 NM_015111 NM_015170 NM_015199 NM_015206 NM_015260 NM_015264 NM_015266 NM_015272 NM_015275 NM_015305 NM_015310 NM_015317 NM_015328 NM_015344 NM_015349 NM_015375 NM_015378 NM_015393 NM_015433 NM_015458 NM_015470 NM_015517 NM_015553 NM_015564 NM_015565 NM_015568 NM_015578 NM_015605 NM_015621 NM_015635 NM_015651 NM_015678 NM_015840 NM_015841 NM_015850 NM_015865 NM_015866 NM_015980 NM_015987 NM_016040 NM_016045 NM_016046 NM_016081 NM_016206 NM_016262 NM_016297 NM_016331 NM_016333 NM_016376 NM_016418 NM_016441 NM_016453 NM_016540 NM_016544 NM_016551 NM_016557 NM_016575 NM_016577 NM_016617 NM_016641 NM_017412 NM_017420 NM_017424 NM_017437 NM_017548 NM_017551 NM_017556 NM_017563 NM_017617 NM_017628 NM_017634 NM_017637 NM_017638 NM_017644 NM_017651 NM_017656 NM_017666 NM_017684 NM_017692 NM_017705 NM_017706 NM_017770 NM_017776 NM_017832 NM_017849 NM_017863 NM_017885 NM_017893 NM_017924 NM_017958 NM_017990 NM_017999 NM_018017 NM_018050 NM_018073 NM_018084 NM_018107 NM_018156 NM_018201 NM_018211 NM_018212 NM_018215 NM_018224 NM_018252 NM_018300 NM_018364 NM_018374 NM_018381 NM_018383 NM_018424 NM_018439 NM_018462 NM_018579 NM_018602 NM_018662 NM_018668 NM_018684 NM_018689 NM_018841 NM_018894 NM_018941 NM_018947 NM_018976 NM_018999 NM_019001 NM_019011 NM_019054 NM_019119 NM_019842 NM_020038 NM_020119 NM_020125 NM_020132 NM_020148 NM_020167 NM_020177 NM_020211 NM_020338 NM_020341 NM_020374 NM_020390 NM_020405 NM_020440 NM_020447 NM_020448 NM_020673 NM_020682 NM_020686 NM_020698 NM_020702 NM_020713 NM_020715 NM_020739 NM_020760 NM_020769 NM_020782 NM_020821 NM_020844 NM_020853 NM_020856 NM_020886 NM_020909 NM_020917 NM_020921 NM_020922 NM_020940 NM_020948 NM_020951 NM_020952 NM_020954 NM_020957 NM_021033 NM_021083 NM_021137 NM_021181 NM_021239 NM_021615 NM_021638 NM_021728 NM_021813 NM_021931 NM_021961 NM_022037 NM_022074 NM_022096 NM_022135 NM_022173 NM_022459 NM_022473 NM_022482 NM_022484 NM_022648 NM_022753 NM_022776 NM_022777 NM_022843 NM_022894 NM_022895 NM_022901 NM_023016 NM_023105 NM_023106 NM_023109 NM_023111 NM_023939 NM_023947 NM_024037 NM_024102 NM_024423 NM_024490 NM_024511 NM_024513 NM_024522 NM_024614 NM_024627 NM_024646 NM_024656 NM_024711 NM_024794 NM_024795 NM_024809 NM_024818 NM_024854 NM_024863 NM_024881 NM_024887 NM_024971 NM_024989 NM_025078 NM_025125 NM_025168 NM_025208 NM_025218 NM_025250 NM_030625 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030762 NM_030773 NM_030780 NM_030781 NM_030791 NM_030806 NM_030817 NM_030911 NM_030918 NM_030949 NM_030952 NM_030953 NM_030981 NM_031244 NM_031409 NM_031412 NM_031417 NM_031418 NM_031422 NM_031437 NM_031468 NM_031469 NM_031483 NM_031899 NM_032010 NM_032116 NM_032151 NM_032160 NM_032167 NM_032239 NM_032276 NM_032285 NM_032288 NM_032317 NM_032336 NM_032373 NM_032374 NM_032423 NM_032436 NM_032491 NM_032501 NM_032521 NM_032529 NM_032561 NM_032581 NM_032582 NM_032646 NM_032689 NM_032753 NM_032758 NM_032780 NM_032782 NM_032828 NM_032866 NM_032873 NM_032876 NM_032918 NM_032932 NM_032976 NM_032977 NM_033017 NM_033091 NM_033107 NM_033135 NM_033143 NM_033224 NM_033238 NM_033285 NM_033331 NM_033346 NM_033360 NM_033389 NM_033409 NM_033426 NM_033428 NM_033430 NM_033437 NM_033446 NM_033505 NM_033542 NM_033550 NM_033631 NM_052827 NM_052832 NM_052847 NM_052861 NM_052869 NM_052898 NM_053055 NM_053056 NM_053279 NM_078470 NM_078483 NM_078628 NM_080551 NM_080645 NM_080836 NM_080863 NM_080867 NM_080872 NM_130809 NM_130848 NM_133170 NM_133265 NM_133334 NM_133367 NM_133445 NM_133448 NM_133480 NM_133490 NM_138287 NM_138319 NM_138400 NM_138444 NM_138450 NM_138467 NM_138473 NM_138694 NM_138713 NM_138714 NM_138731 NM_138768 NM_138967 NM_139131 NM_139177 NM_139276 NM_139283 NM_144567 NM_144599 NM_144613 NM_144618 NM_144667 NM_144684 NM_145013 NM_145071 NM_145115 NM_145165 NM_145212 NM_145279 NM_145307 NM_145341 NM_145342 NM_145735 NM_145754 NM_145804 NM_145868 NM_145869 NM_147180 NM_152244 NM_152253 NM_152257 NM_152261 NM_152266 NM_152308 NM_152309 NM_152332 NM_152340 NM_152367 NM_152374 NM_152395 NM_152406 NM_152411 NM_152437 NM_152454 NM_152458 NM_152588 NM_152595 NM_152619 NM_152624 NM_152667 NM_152678 NM_152686 NM_152698 NM_152701 NM_152753 NM_152776 NM_152793 NM_152842 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152933 NM_152934 NM_153239 NM_153240 NM_153259 NM_153263 NM_153320 NM_153343 NM_153367 NM_153456 NM_153487 NM_153607 NM_153683 NM_153705 NM_153714 NM_153812 NM_170768 NM_172037 NM_172159 NM_172160 NM_172217 NM_172239 NM_172242 NM_172337 NM_173042 NM_173043 NM_173191 NM_173192 NM_173193 NM_173194 NM_173195 NM_173214 NM_173342 NM_173462 NM_173463 NM_173470 NM_173473 NM_173476 NM_173529 NM_173531 NM_173536 NM_173580 NM_173602 NM_173622 NM_173639 NM_173644 NM_173651 NM_173682 NM_173799 NM_173844 NM_173851 NM_173854 NM_174936 NM_174947 NM_174976 NM_175069 NM_175071 NM_175072 NM_175073 NM_175078 NM_175567 NM_175568 NM_175736 NM_175767 NM_175848 NM_175849 NM_175850 NM_175864 NM_175898 NM_175901 NM_175921 NM_176787 NM_176853 NM_177405 NM_177551 NM_177972 NM_177990 NM_178123 NM_178151 NM_178152 NM_178153 NM_178445 NM_178491 NM_178516 NM_178566 NM_178585 NM_178816 NM_178858 NM_181293 NM_181359 NM_181481 NM_181482 NM_181483 NM_181489 NM_181504 NM_181523 NM_181524 NM_181531 NM_181659 NM_181776 NM_181785 NM_181789 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181838 NM_182487 NM_182500 NM_182502 NM_182507 NM_182533 NM_182540 NM_182584 NM_182587 NM_182609 NM_182633 NM_182665 NM_182685 NM_182686 NM_182740 NM_182757 NM_182765 NM_182827 NM_182909 NM_182925 NM_182978 NM_183050 NM_183078 NM_183420 NM_183421 NM_184231 NM_194252 NM_194282 NM_194286 NM_194288 NM_194294 NM_194303 NM_194317 NM_197941 NM_198086 NM_198156 NM_198181 NM_198329 NM_198399 NM_198402 NM_198460 NM_198484 NM_198485 NM_198545 NM_198549 NM_198569 NM_198584 NM_198595 NM_198720 NM_198798 NM_198835 NM_198847 NM_198887 NM_198900 NM_198971 NM_198992 NM_199045 NM_199050 NM_199176 NM_199415 NM_199421 NM_199436 NM_199462 NM_201266 NM_201279 NM_201348 NM_201403 NM_201413 NM_201414 NM_201432 NM_201433 NM_201543 NM_201544 NM_201545 NM_201565 NM_201625 NM_203282 NM_203327 NM_203395 NM_203447 NM_203448 NM_203451 NM_203453 NM_203463 NM_205857 NM_205861 NM_206893 NM_206909 NM_206914 NM_206944 NM_206945 NM_206946 NM_206947 NM_207035 NM_207111 NM_207116 NM_207303 NM_207333 NM_207335 NM_207352 NM_207362 NM_207366 NM_207379 NM_207380 NM_207387 NM_207429 NM_207454 NM_207470 NM_207483 NM_207486 NM_207500 NM_207504 NM_207505 NM_207646 NM_212556 NM_212558 NM_213589 NM_213594 NM_213604 NM_213662 NM_213723 XM_027236 XM_027307 XM_028810 XM_031689 XM_032571 XM_032945 XM_042698 XM_042833 XM_042936 XM_047550 XM_047554 XM_048898 XM_058720 XM_059929 XM_064190 XM_067585 XM_067605 XM_086937 XM_087386 XM_087672 XM_117117 XM_166140 XM_171054 XM_172995 XM_208522 XM_209554 XM_209607 XM_290502 XM_290597 XM_290615 XM_290737 XM_290777 XM_290809 XM_291344 XM_294521 XM_294765 XM_370654 XM_370899 XM_370932 XM_371074 XM_371176 XM_371204 XM_371302 XM_371304 XM_371461 XM_371590 XM_371664 XM_371680 XM_371801 XM_371838 XM_372035 XM_372039 XM_372118 XM_372248 XM_372556 XM_373645 XM_373742 XM_373744 XM_374013 XM_374112 XM_374317 XM_374842 XM_374912 XM_375292 XM_375373 XM_375491 XM_375606 XM_375747 XM_375816 XM_375838 XM_375928 XM_376018 XM_376049 XM_376062 XM_376372 XM_376550 XM_376680 XM_376784 XM_376795 XM_376843 XM_376902 XM_376905 XM_377041 XM_377053 XM_378272 XM_378273 XM_378312 XM_378327 XM_378389 XM_378421 XM_378456 XM_378507 XM_378512 XM_378546 XM_378550 XM_378617 XM_378620 XM_378678 XM_378703 XM_378738 XM_378751 XM_378795 XM_378852 XM_378914 XM_378964 XM_379041 XM_379086 XM_379100 XM_379114 XM_379141 XM_379154 XM_379206 XM_379243 XM_379280 XM_379363 XM_379381 XM_379391 XM_379403 XM_379437 XM_379454 XM_379459 XM_379534 XM_379535 XM_379547 XM_379573 XM_379595 XM_379634 XM_379637 XM_379934 XM_380159 XM_380160 XM_495795 XM_495814 XM_495902 XM_495909 XM_495950 XM_495970 XM_496036 XM_496081 XM_496088 XM_496103 XM_496134 XM_496299 XM_496351 XM_496597 XM_496879 XM_496981 XM_496983 XM_496984 XM_496985 XM_497036 XM_497080 XM_498456 XM_498467 XM_498481 XM_498490 XM_498540 XM_498614 XM_498660 XM_498824 XM_498954 XM_498960 XM_499008 XM_499046 XM_499047 XM_499084 XM_499136 XM_499137 XM_499147 XM_499182 XM_499298 XM_499539 XM_499585 XM_499597 XR_000190 XR_000192
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)