VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"uaugguuuugggggccaaguc"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
5706
.
Total Genes with multiple seed matches:
1333
.
Genes with at least one seed match:
NM_000021 NM_000025 NM_000037 NM_000038 NM_000040 NM_000041 NM_000043 NM_000046 NM_000050 NM_000052 NM_000074 NM_000088 NM_000097 NM_000104 NM_000112 NM_000113 NM_000118 NM_000125 NM_000129 NM_000131 NM_000136 NM_000138 NM_000144 NM_000147 NM_000148 NM_000149 NM_000153 NM_000164 NM_000167 NM_000192 NM_000196 NM_000216 NM_000219 NM_000222 NM_000232 NM_000235 NM_000240 NM_000242 NM_000252 NM_000254 NM_000261 NM_000262 NM_000266 NM_000268 NM_000270 NM_000271 NM_000276 NM_000299 NM_000300 NM_000302 NM_000303 NM_000310 NM_000312 NM_000315 NM_000321 NM_000322 NM_000328 NM_000332 NM_000335 NM_000336 NM_000348 NM_000352 NM_000353 NM_000355 NM_000358 NM_000361 NM_000362 NM_000368 NM_000369 NM_000376 NM_000387 NM_000391 NM_000401 NM_000405 NM_000411 NM_000414 NM_000417 NM_000424 NM_000425 NM_000429 NM_000430 NM_000433 NM_000435 NM_000437 NM_000439 NM_000442 NM_000445 NM_000448 NM_000449 NM_000452 NM_000480 NM_000481 NM_000486 NM_000496 NM_000499 NM_000508 NM_000511 NM_000529 NM_000530 NM_000539 NM_000542 NM_000545 NM_000550 NM_000555 NM_000565 NM_000566 NM_000569 NM_000570 NM_000575 NM_000577 NM_000579 NM_000599 NM_000610 NM_000611 NM_000616 NM_000618 NM_000620 NM_000621 NM_000633 NM_000634 NM_000635 NM_000639 NM_000647 NM_000663 NM_000664 NM_000671 NM_000685 NM_000689 NM_000691 NM_000693 NM_000694 NM_000696 NM_000717 NM_000721 NM_000724 NM_000725 NM_000735 NM_000748 NM_000750 NM_000755 NM_000759 NM_000761 NM_000767 NM_000781 NM_000783 NM_000786 NM_000788 NM_000789 NM_000791 NM_000792 NM_000793 NM_000795 NM_000799 NM_000801 NM_000806 NM_000818 NM_000821 NM_000825 NM_000838 NM_000841 NM_000843 NM_000849 NM_000851 NM_000853 NM_000856 NM_000861 NM_000876 NM_000878 NM_000889 NM_000894 NM_000898 NM_000899 NM_000907 NM_000917 NM_000924 NM_000944 NM_000947 NM_000950 NM_000958 NM_000960 NM_000961 NM_000994 NM_000997 NM_000998 NM_001001188 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001394 NM_001001396 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001503 NM_001001522 NM_001001552 NM_001001557 NM_001001563 NM_001001660 NM_001001664 NM_001001669 NM_001001681 NM_001001684 NM_001001685 NM_001001690 NM_001001693 NM_001001694 NM_001001698 NM_001001709 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001936 NM_001001938 NM_001001974 NM_001001995 NM_001002000 NM_001002001 NM_001002002 NM_001002026 NM_001002034 NM_001002231 NM_001002232 NM_001002257 NM_001002260 NM_001002758 NM_001002762 NM_001002814 NM_001002844 NM_001002857 NM_001002858 NM_001002860 NM_001002861 NM_001002881 NM_001002912 NM_001002924 NM_001002926 NM_001003652 NM_001003656 NM_001003674 NM_001003675 NM_001003681 NM_001003682 NM_001003692 NM_001003715 NM_001003716 NM_001003794 NM_001003796 NM_001003800 NM_001003807 NM_001003812 NM_001003818 NM_001003927 NM_001003937 NM_001003940 NM_001003942 NM_001003943 NM_001004019 NM_001004285 NM_001004286 NM_001004300 NM_001004301 NM_001004304 NM_001004305 NM_001004307 NM_001004308 NM_001004313 NM_001004314 NM_001004315 NM_001004321 NM_001004325 NM_001004329 NM_001004334 NM_001004335 NM_001004339 NM_001004348 NM_001004360 NM_001004417 NM_001004421 NM_001004422 NM_001004432 NM_001004433 NM_001004434 NM_001004439 NM_001004441 NM_001005210 NM_001005271 NM_001005273 NM_001005303 NM_001005337 NM_001005366 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005409 NM_001005473 NM_001005505 NM_001005527 NM_001005609 NM_001005753 NM_001005852 NM_001005862 NM_001005920 NM_001006113 NM_001006115 NM_001006116 NM_001006600 NM_001006603 NM_001006604 NM_001006617 NM_001006619 NM_001006620 NM_001006621 NM_001006623 NM_001006624 NM_001006625 NM_001006656 NM_001006657 NM_001006945 NM_001007023 NM_001007073 NM_001007074 NM_001007094 NM_001007097 NM_001007156 NM_001007188 NM_001007225 NM_001007237 NM_001007246 NM_001007254 NM_001007269 NM_001007270 NM_001007279 NM_001007466 NM_001007542 NM_001007546 NM_001008215 NM_001008220 NM_001008222 NM_001008223 NM_001008224 NM_001008226 NM_001008228 NM_001008239 NM_001008390 NM_001008391 NM_001008392 NM_001008393 NM_001008396 NM_001008407 NM_001008408 NM_001008493 NM_001008494 NM_001008530 NM_001008537 NM_001008540 NM_001008657 NM_001008707 NM_001008710 NM_001008711 NM_001008726 NM_001008738 NM_001008745 NM_001008801 NM_001008895 NM_001008917 NM_001008925 NM_001009185 NM_001009553 NM_001009555 NM_001009565 NM_001009568 NM_001009584 NM_001009610 NM_001009612 NM_001009880 NM_001009883 NM_001009894 NM_001009899 NM_001009909 NM_001009913 NM_001009922 NM_001009931 NM_001009956 NM_001009957 NM_001009960 NM_001009992 NM_001010000 NM_001010846 NM_001010852 NM_001010853 NM_001010866 NM_001010867 NM_001010888 NM_001010891 NM_001010898 NM_001010902 NM_001010911 NM_001010913 NM_001010915 NM_001010917 NM_001010924 NM_001010926 NM_001010934 NM_001010972 NM_001010980 NM_001010983 NM_001010984 NM_001010986 NM_001011513 NM_001011514 NM_001011538 NM_001011540 NM_001011545 NM_001011547 NM_001011548 NM_001011549 NM_001011550 NM_001011551 NM_001011552 NM_001011554 NM_001011649 NM_001011655 NM_001011656 NM_001011657 NM_001011658 NM_001011666 NM_001011703 NM_001011708 NM_001011720 NM_001012239 NM_001012267 NM_001012274 NM_001012320 NM_001012329 NM_001012393 NM_001012418 NM_001012420 NM_001012423 NM_001012426 NM_001012427 NM_001012452 NM_001012454 NM_001012503 NM_001012508 NM_001012509 NM_001012626 NM_001012651 NM_001012659 NM_001012709 NM_001012729 NM_001012731 NM_001012732 NM_001012733 NM_001012734 NM_001012753 NM_001012754 NM_001012755 NM_001012756 NM_001012957 NM_001012960 NM_001012966 NM_001012981 NM_001012982 NM_001012988 NM_001012989 NM_001013031 NM_001013253 NM_001013254 NM_001013255 NM_001013403 NM_001013406 NM_001013436 NM_001013437 NM_001013440 NM_001013625 NM_001013627 NM_001013629 NM_001013640 NM_001013666 NM_001013670 NM_001013674 NM_001013675 NM_001013677 NM_001013681 NM_001013682 NM_001013683 NM_001013685 NM_001013693 NM_001013698 NM_001013699 NM_001013704 NM_001013707 NM_001013708 NM_001013710 NM_001013720 NM_001013722 NM_001013726 NM_001013839 NM_001013842 NM_001014373 NM_001014374 NM_001014380 NM_001014444 NM_001014797 NM_001014811 NM_001014839 NM_001014841 NM_001014975 NM_001015045 NM_001015051 NM_001015508 NM_001015877 NM_001015881 NM_001015886 NM_001017369 NM_001017370 NM_001017371 NM_001017392 NM_001017395 NM_001017423 NM_001017434 NM_001017440 NM_001017523 NM_001017535 NM_001017915 NM_001017923 NM_001017962 NM_001017979 NM_001017980 NM_001017992 NM_001017995 NM_001018003 NM_001018037 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018054 NM_001018057 NM_001018058 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018072 NM_001018089 NM_001018111 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001023563 NM_001023565 NM_001023582 NM_001024226 NM_001024227 NM_001024228 NM_001024380 NM_001024381 NM_001024460 NM_001024463 NM_001024610 NM_001024611 NM_001024630 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024688 NM_001024736 NM_001024808 NM_001024843 NM_001024847 NM_001024933 NM_001024948 NM_001025068 NM_001025069 NM_001025079 NM_001025080 NM_001025091 NM_001025107 NM_001025108 NM_001025109 NM_001025158 NM_001025159 NM_001025233 NM_001025252 NM_001025253 NM_001025266 NM_001039 NM_001043 NM_001044 NM_001045 NM_001047 NM_001048 NM_001049 NM_001056 NM_001063 NM_001066 NM_001067 NM_001080 NM_001087 NM_001089 NM_001090 NM_001093 NM_001095 NM_001099 NM_001101 NM_001104 NM_001111 NM_001112 NM_001114 NM_001121 NM_001125 NM_001128 NM_001140 NM_001148 NM_001160 NM_001167 NM_001186 NM_001189 NM_001196 NM_001198 NM_001204 NM_001219 NM_001222 NM_001224 NM_001230 NM_001233 NM_001237 NM_001238 NM_001244 NM_001247 NM_001248 NM_001257 NM_001259 NM_001260 NM_001262 NM_001267 NM_001274 NM_001284 NM_001286 NM_001290 NM_001291 NM_001296 NM_001298 NM_001302 NM_001304 NM_001319 NM_001333 NM_001334 NM_001336 NM_001337 NM_001338 NM_001362 NM_001380 NM_001386 NM_001387 NM_001390 NM_001393 NM_001399 NM_001400 NM_001401 NM_001406 NM_001407 NM_001414 NM_001415 NM_001417 NM_001421 NM_001424 NM_001427 NM_001428 NM_001431 NM_001433 NM_001447 NM_001454 NM_001455 NM_001457 NM_001478 NM_001490 NM_001504 NM_001511 NM_001519 NM_001521 NM_001535 NM_001542 NM_001543 NM_001547 NM_001548 NM_001560 NM_001584 NM_001585 NM_001587 NM_001609 NM_001610 NM_001616 NM_001620 NM_001624 NM_001628 NM_001631 NM_001634 NM_001636 NM_001649 NM_001650 NM_001652 NM_001655 NM_001657 NM_001658 NM_001664 NM_001679 NM_001681 NM_001684 NM_001695 NM_001699 NM_001701 NM_001707 NM_001711 NM_001713 NM_001717 NM_001719 NM_001721 NM_001723 NM_001728 NM_001731 NM_001737 NM_001739 NM_001743 NM_001745 NM_001753 NM_001754 NM_001756 NM_001759 NM_001761 NM_001773 NM_001777 NM_001793 NM_001795 NM_001797 NM_001798 NM_001802 NM_001806 NM_001821 NM_001831 NM_001844 NM_001847 NM_001852 NM_001858 NM_001859 NM_001870 NM_001875 NM_001878 NM_001879 NM_001888 NM_001908 NM_001918 NM_001921 NM_001935 NM_001937 NM_001941 NM_001942 NM_001945 NM_001946 NM_001949 NM_001963 NM_001964 NM_001966 NM_001987 NM_001992 NM_001993 NM_001998 NM_002000 NM_002015 NM_002022 NM_002023 NM_002024 NM_002025 NM_002030 NM_002031 NM_002033 NM_002038 NM_002039 NM_002045 NM_002048 NM_002049 NM_002053 NM_002056 NM_002062 NM_002063 NM_002069 NM_002070 NM_002076 NM_002077 NM_002086 NM_002089 NM_002099 NM_002103 NM_002110 NM_002111 NM_002118 NM_002122 NM_002128 NM_002130 NM_002139 NM_002143 NM_002146 NM_002147 NM_002149 NM_002158 NM_002163 NM_002167 NM_002190 NM_002193 NM_002198 NM_002200 NM_002203 NM_002204 NM_002210 NM_002212 NM_002222 NM_002223 NM_002228 NM_002239 NM_002246 NM_002251 NM_002261 NM_002262 NM_002268 NM_002275 NM_002285 NM_002298 NM_002304 NM_002309 NM_002310 NM_002311 NM_002314 NM_002319 NM_002339 NM_002340 NM_002345 NM_002346 NM_002349 NM_002351 NM_002353 NM_002355 NM_002357 NM_002359 NM_002362 NM_002364 NM_002373 NM_002375 NM_002381 NM_002383 NM_002384 NM_002387 NM_002388 NM_002398 NM_002399 NM_002401 NM_002416 NM_002417 NM_002418 NM_002419 NM_002428 NM_002430 NM_002441 NM_002444 NM_002460 NM_002461 NM_002465 NM_002473 NM_002474 NM_002479 NM_002480 NM_002481 NM_002485 NM_002501 NM_002504 NM_002505 NM_002507 NM_002508 NM_002514 NM_002518 NM_002523 NM_002538 NM_002540 NM_002545 NM_002547 NM_002556 NM_002558 NM_002561 NM_002563 NM_002564 NM_002566 NM_002569 NM_002581 NM_002582 NM_002587 NM_002588 NM_002590 NM_002594 NM_002603 NM_002604 NM_002608 NM_002609 NM_002610 NM_002611 NM_002613 NM_002628 NM_002629 NM_002633 NM_002634 NM_002644 NM_002649 NM_002653 NM_002655 NM_002657 NM_002662 NM_002667 NM_002677 NM_002703 NM_002706 NM_002711 NM_002713 NM_002716 NM_002718 NM_002719 NM_002725 NM_002730 NM_002733 NM_002734 NM_002737 NM_002738 NM_002745 NM_002747 NM_002755 NM_002756 NM_002758 NM_002762 NM_002763 NM_002767 NM_002775 NM_002776 NM_002805 NM_002807 NM_002813 NM_002816 NM_002820 NM_002824 NM_002827 NM_002832 NM_002833 NM_002834 NM_002848 NM_002860 NM_002869 NM_002871 NM_002874 NM_002878 NM_002879 NM_002881 NM_002886 NM_002897 NM_002928 NM_002938 NM_002940 NM_002959 NM_002990 NM_002998 NM_003004 NM_003010 NM_003011 NM_003012 NM_003017 NM_003020 NM_003022 NM_003023 NM_003024 NM_003025 NM_003026 NM_003032 NM_003036 NM_003037 NM_003038 NM_003042 NM_003043 NM_003045 NM_003049 NM_003051 NM_003063 NM_003068 NM_003071 NM_003077 NM_003084 NM_003086 NM_003103 NM_003104 NM_003111 NM_003112 NM_003115 NM_003129 NM_003130 NM_003131 NM_003132 NM_003137 NM_003143 NM_003144 NM_003147 NM_003153 NM_003156 NM_003157 NM_003161 NM_003162 NM_003178 NM_003186 NM_003188 NM_003189 NM_003190 NM_003199 NM_003202 NM_003203 NM_003206 NM_003212 NM_003222 NM_003234 NM_003236 NM_003242 NM_003247 NM_003255 NM_003256 NM_003262 NM_003268 NM_003274 NM_003281 NM_003285 NM_003307 NM_003320 NM_003324 NM_003330 NM_003334 NM_003336 NM_003337 NM_003344 NM_003348 NM_003359 NM_003362 NM_003363 NM_003373 NM_003378 NM_003379 NM_003388 NM_003390 NM_003392 NM_003399 NM_003403 NM_003404 NM_003406 NM_003407 NM_003409 NM_003417 NM_003421 NM_003423 NM_003425 NM_003433 NM_003435 NM_003438 NM_003449 NM_003452 NM_003455 NM_003457 NM_003458 NM_003461 NM_003463 NM_003467 NM_003474 NM_003476 NM_003479 NM_003483 NM_003486 NM_003490 NM_003498 NM_003501 NM_003502 NM_003506 NM_003516 NM_003526 NM_003559 NM_003566 NM_003568 NM_003574 NM_003576 NM_003578 NM_003589 NM_003605 NM_003613 NM_003615 NM_003617 NM_003619 NM_003620 NM_003622 NM_003624 NM_003629 NM_003633 NM_003634 NM_003636 NM_003644 NM_003647 NM_003648 NM_003649 NM_003651 NM_003660 NM_003661 NM_003663 NM_003672 NM_003677 NM_003680 NM_003681 NM_003682 NM_003690 NM_003704 NM_003706 NM_003713 NM_003714 NM_003719 NM_003726 NM_003730 NM_003735 NM_003736 NM_003737 NM_003740 NM_003741 NM_003743 NM_003748 NM_003749 NM_003759 NM_003763 NM_003764 NM_003768 NM_003774 NM_003781 NM_003783 NM_003786 NM_003796 NM_003799 NM_003800 NM_003811 NM_003819 NM_003822 NM_003828 NM_003834 NM_003839 NM_003841 NM_003842 NM_003855 NM_003856 NM_003861 NM_003863 NM_003872 NM_003873 NM_003874 NM_003877 NM_003882 NM_003885 NM_003888 NM_003889 NM_003893 NM_003895 NM_003899 NM_003909 NM_003930 NM_003933 NM_003938 NM_003939 NM_003941 NM_003950 NM_003955 NM_003958 NM_003983 NM_003985 NM_003994 NM_003995 NM_004003 NM_004028 NM_004032 NM_004037 NM_004039 NM_004041 NM_004050 NM_004059 NM_004064 NM_004077 NM_004086 NM_004089 NM_004091 NM_004093 NM_004096 NM_004101 NM_004112 NM_004116 NM_004117 NM_004120 NM_004124 NM_004131 NM_004132 NM_004140 NM_004143 NM_004145 NM_004155 NM_004161 NM_004170 NM_004171 NM_004184 NM_004188 NM_004193 NM_004198 NM_004202 NM_004209 NM_004229 NM_004233 NM_004235 NM_004242 NM_004258 NM_004263 NM_004272 NM_004273 NM_004274 NM_004275 NM_004277 NM_004286 NM_004287 NM_004290 NM_004293 NM_004302 NM_004308 NM_004309 NM_004319 NM_004321 NM_004326 NM_004327 NM_004331 NM_004338 NM_004342 NM_004346 NM_004348 NM_004354 NM_004355 NM_004360 NM_004368 NM_004370 NM_004376 NM_004382 NM_004386 NM_004391 NM_004393 NM_004394 NM_004397 NM_004398 NM_004399 NM_004402 NM_004411 NM_004412 NM_004414 NM_004423 NM_004426 NM_004431 NM_004434 NM_004437 NM_004438 NM_004444 NM_004448 NM_004454 NM_004464 NM_004469 NM_004482 NM_004485 NM_004488 NM_004494 NM_004497 NM_004503 NM_004505 NM_004513 NM_004518 NM_004529 NM_004535 NM_004536 NM_004539 NM_004549 NM_004554 NM_004567 NM_004568 NM_004586 NM_004588 NM_004593 NM_004598 NM_004610 NM_004612 NM_004614 NM_004618 NM_004619 NM_004622 NM_004624 NM_004628 NM_004629 NM_004631 NM_004650 NM_004653 NM_004655 NM_004665 NM_004676 NM_004681 NM_004687 NM_004696 NM_004703 NM_004706 NM_004709 NM_004710 NM_004711 NM_004713 NM_004717 NM_004727 NM_004728 NM_004734 NM_004738 NM_004740 NM_004744 NM_004745 NM_004748 NM_004756 NM_004759 NM_004760 NM_004761 NM_004762 NM_004782 NM_004788 NM_004789 NM_004790 NM_004795 NM_004796 NM_004797 NM_004798 NM_004802 NM_004803 NM_004804 NM_004817 NM_004827 NM_004834 NM_004835 NM_004840 NM_004842 NM_004845 NM_004851 NM_004854 NM_004859 NM_004863 NM_004866 NM_004874 NM_004892 NM_004900 NM_004904 NM_004905 NM_004906 NM_004912 NM_004913 NM_004914 NM_004932 NM_004933 NM_004941 NM_004943 NM_004947 NM_004952 NM_004956 NM_004964 NM_004968 NM_004982 NM_004985 NM_004988 NM_004992 NM_004999 NM_005008 NM_005010 NM_005023 NM_005026 NM_005027 NM_005032 NM_005036 NM_005038 NM_005042 NM_005046 NM_005063 NM_005069 NM_005076 NM_005077 NM_005079 NM_005088 NM_005093 NM_005094 NM_005095 NM_005105 NM_005108 NM_005109 NM_005110 NM_005112 NM_005117 NM_005118 NM_005140 NM_005148 NM_005155 NM_005156 NM_005160 NM_005164 NM_005168 NM_005169 NM_005181 NM_005188 NM_005189 NM_005197 NM_005198 NM_005201 NM_005202 NM_005207 NM_005208 NM_005211 NM_005220 NM_005226 NM_005229 NM_005230 NM_005233 NM_005241 NM_005244 NM_005247 NM_005253 NM_005254 NM_005263 NM_005264 NM_005266 NM_005270 NM_005271 NM_005281 NM_005282 NM_005297 NM_005308 NM_005313 NM_005314 NM_005318 NM_005324 NM_005329 NM_005338 NM_005347 NM_005361 NM_005367 NM_005373 NM_005374 NM_005375 NM_005378 NM_005380 NM_005385 NM_005388 NM_005392 NM_005397 NM_005399 NM_005417 NM_005419 NM_005420 NM_005433 NM_005434 NM_005436 NM_005446 NM_005463 NM_005467 NM_005471 NM_005472 NM_005475 NM_005476 NM_005487 NM_005491 NM_005500 NM_005502 NM_005503 NM_005504 NM_005506 NM_005507 NM_005509 NM_005530 NM_005539 NM_005540 NM_005541 NM_005542 NM_005546 NM_005551 NM_005566 NM_005574 NM_005575 NM_005578 NM_005596 NM_005602 NM_005604 NM_005606 NM_005608 NM_005610 NM_005634 NM_005635 NM_005636 NM_005647 NM_005652 NM_005656 NM_005664 NM_005665 NM_005668 NM_005679 NM_005692 NM_005705 NM_005712 NM_005715 NM_005721 NM_005722 NM_005724 NM_005725 NM_005729 NM_005730 NM_005732 NM_005736 NM_005739 NM_005741 NM_005768 NM_005772 NM_005775 NM_005779 NM_005785 NM_005795 NM_005808 NM_005816 NM_005819 NM_005829 NM_005831 NM_005840 NM_005841 NM_005852 NM_005859 NM_005860 NM_005861 NM_005863 NM_005876 NM_005877 NM_005887 NM_005891 NM_005896 NM_005901 NM_005902 NM_005903 NM_005906 NM_005909 NM_005920 NM_005931 NM_005933 NM_005935 NM_005937 NM_005942 NM_005943 NM_005950 NM_005964 NM_005967 NM_005981 NM_005985 NM_005986 NM_005992 NM_006005 NM_006011 NM_006026 NM_006030 NM_006033 NM_006035 NM_006040 NM_006043 NM_006045 NM_006047 NM_006048 NM_006056 NM_006057 NM_006058 NM_006060 NM_006061 NM_006069 NM_006074 NM_006076 NM_006089 NM_006091 NM_006109 NM_006110 NM_006111 NM_006123 NM_006125 NM_006132 NM_006135 NM_006139 NM_006148 NM_006153 NM_006178 NM_006180 NM_006184 NM_006187 NM_006202 NM_006203 NM_006206 NM_006208 NM_006210 NM_006211 NM_006212 NM_006224 NM_006232 NM_006235 NM_006241 NM_006242 NM_006245 NM_006252 NM_006257 NM_006282 NM_006283 NM_006288 NM_006289 NM_006293 NM_006298 NM_006299 NM_006306 NM_006310 NM_006312 NM_006321 NM_006323 NM_006327 NM_006328 NM_006330 NM_006335 NM_006341 NM_006343 NM_006348 NM_006361 NM_006366 NM_006372 NM_006375 NM_006383 NM_006393 NM_006403 NM_006404 NM_006408 NM_006430 NM_006438 NM_006439 NM_006449 NM_006452 NM_006457 NM_006459 NM_006460 NM_006464 NM_006466 NM_006474 NM_006475 NM_006481 NM_006487 NM_006492 NM_006493 NM_006495 NM_006499 NM_006502 NM_006505 NM_006517 NM_006524 NM_006532 NM_006534 NM_006539 NM_006540 NM_006541 NM_006544 NM_006546 NM_006548 NM_006549 NM_006555 NM_006557 NM_006559 NM_006564 NM_006572 NM_006581 NM_006586 NM_006593 NM_006595 NM_006596 NM_006597 NM_006599 NM_006606 NM_006620 NM_006621 NM_006624 NM_006628 NM_006636 NM_006640 NM_006646 NM_006650 NM_006651 NM_006658 NM_006661 NM_006665 NM_006671 NM_006680 NM_006685 NM_006694 NM_006697 NM_006699 NM_006700 NM_006716 NM_006725 NM_006729 NM_006731 NM_006734 NM_006738 NM_006742 NM_006745 NM_006748 NM_006756 NM_006763 NM_006765 NM_006777 NM_006779 NM_006782 NM_006785 NM_006796 NM_006799 NM_006805 NM_006807 NM_006809 NM_006815 NM_006825 NM_006826 NM_006827 NM_006834 NM_006836 NM_006844 NM_006845 NM_006846 NM_006867 NM_006873 NM_006875 NM_006877 NM_006888 NM_006889 NM_006902 NM_006903 NM_006907 NM_006924 NM_006930 NM_006936 NM_006938 NM_006940 NM_006943 NM_006951 NM_006952 NM_006955 NM_006963 NM_006974 NM_006979 NM_006981 NM_006984 NM_006990 NM_006996 NM_007006 NM_007011 NM_007013 NM_007021 NM_007027 NM_007030 NM_007034 NM_007042 NM_007043 NM_007050 NM_007063 NM_007068 NM_007073 NM_007084 NM_007085 NM_007086 NM_007117 NM_007118 NM_007130 NM_007139 NM_007150 NM_007159 NM_007169 NM_007172 NM_007174 NM_007175 NM_007176 NM_007182 NM_007191 NM_007200 NM_007208 NM_007213 NM_007219 NM_007225 NM_007236 NM_007237 NM_007241 NM_007250 NM_007257 NM_007271 NM_007275 NM_007283 NM_007306 NM_007315 NM_007318 NM_007331 NM_007334 NM_007335 NM_007336 NM_007338 NM_007347 NM_007359 NM_007364 NM_007370 NM_007373 NM_009585 NM_012071 NM_012072 NM_012074 NM_012090 NM_012095 NM_012098 NM_012099 NM_012104 NM_012108 NM_012110 NM_012120 NM_012137 NM_012140 NM_012153 NM_012154 NM_012161 NM_012172 NM_012174 NM_012184 NM_012188 NM_012189 NM_012192 NM_012193 NM_012197 NM_012200 NM_012211 NM_012215 NM_012218 NM_012219 NM_012224 NM_012229 NM_012232 NM_012234 NM_012236 NM_012244 NM_012252 NM_012256 NM_012257 NM_012261 NM_012271 NM_012280 NM_012288 NM_012290 NM_012300 NM_012306 NM_012307 NM_012308 NM_012309 NM_012320 NM_012324 NM_012334 NM_012338 NM_012345 NM_012346 NM_012347 NM_012384 NM_012388 NM_012395 NM_012409 NM_012414 NM_012417 NM_012431 NM_012432 NM_012443 NM_012446 NM_012450 NM_012455 NM_012458 NM_012464 NM_012467 NM_012479 NM_013229 NM_013230 NM_013231 NM_013233 NM_013243 NM_013245 NM_013253 NM_013255 NM_013276 NM_013280 NM_013281 NM_013286 NM_013290 NM_013302 NM_013309 NM_013313 NM_013322 NM_013336 NM_013341 NM_013348 NM_013356 NM_013359 NM_013371 NM_013372 NM_013375 NM_013382 NM_013384 NM_013385 NM_013386 NM_013389 NM_013397 NM_013402 NM_013411 NM_013422 NM_013437 NM_013447 NM_013448 NM_013449 NM_013450 NM_013452 NM_013989 NM_013999 NM_014000 NM_014026 NM_014028 NM_014030 NM_014035 NM_014048 NM_014065 NM_014066 NM_014106 NM_014110 NM_014112 NM_014147 NM_014155 NM_014157 NM_014162 NM_014169 NM_014210 NM_014211 NM_014213 NM_014232 NM_014234 NM_014235 NM_014240 NM_014241 NM_014250 NM_014257 NM_014263 NM_014267 NM_014268 NM_014270 NM_014276 NM_014284 NM_014289 NM_014292 NM_014293 NM_014299 NM_014305 NM_014325 NM_014328 NM_014333 NM_014336 NM_014342 NM_014347 NM_014352 NM_014356 NM_014358 NM_014360 NM_014367 NM_014368 NM_014372 NM_014379 NM_014386 NM_014388 NM_014391 NM_014396 NM_014398 NM_014405 NM_014411 NM_014418 NM_014430 NM_014442 NM_014444 NM_014445 NM_014449 NM_014450 NM_014456 NM_014488 NM_014495 NM_014503 NM_014504 NM_014517 NM_014522 NM_014552 NM_014553 NM_014556 NM_014563 NM_014571 NM_014573 NM_014577 NM_014584 NM_014586 NM_014587 NM_014590 NM_014591 NM_014592 NM_014600 NM_014616 NM_014625 NM_014633 NM_014634 NM_014636 NM_014637 NM_014642 NM_014644 NM_014646 NM_014653 NM_014655 NM_014656 NM_014659 NM_014665 NM_014668 NM_014689 NM_014702 NM_014707 NM_014711 NM_014720 NM_014723 NM_014728 NM_014729 NM_014730 NM_014731 NM_014732 NM_014734 NM_014737 NM_014742 NM_014744 NM_014746 NM_014747 NM_014751 NM_014755 NM_014757 NM_014758 NM_014760 NM_014764 NM_014765 NM_014766 NM_014772 NM_014774 NM_014783 NM_014788 NM_014792 NM_014799 NM_014800 NM_014801 NM_014804 NM_014805 NM_014808 NM_014809 NM_014810 NM_014812 NM_014821 NM_014828 NM_014829 NM_014835 NM_014836 NM_014838 NM_014839 NM_014840 NM_014844 NM_014848 NM_014850 NM_014851 NM_014854 NM_014858 NM_014859 NM_014860 NM_014864 NM_014867 NM_014870 NM_014871 NM_014872 NM_014874 NM_014876 NM_014883 NM_014888 NM_014891 NM_014897 NM_014901 NM_014902 NM_014904 NM_014906 NM_014909 NM_014910 NM_014912 NM_014914 NM_014920 NM_014923 NM_014924 NM_014925 NM_014930 NM_014931 NM_014934 NM_014935 NM_014943 NM_014946 NM_014947 NM_014951 NM_014953 NM_014954 NM_014956 NM_014957 NM_014961 NM_014965 NM_014969 NM_014978 NM_014988 NM_014990 NM_014992 NM_014994 NM_014996 NM_014997 NM_014999 NM_015003 NM_015008 NM_015017 NM_015022 NM_015024 NM_015029 NM_015032 NM_015033 NM_015035 NM_015040 NM_015043 NM_015047 NM_015055 NM_015056 NM_015071 NM_015076 NM_015077 NM_015078 NM_015079 NM_015087 NM_015088 NM_015090 NM_015094 NM_015097 NM_015100 NM_015104 NM_015107 NM_015112 NM_015113 NM_015116 NM_015134 NM_015137 NM_015138 NM_015141 NM_015143 NM_015144 NM_015149 NM_015151 NM_015161 NM_015162 NM_015163 NM_015170 NM_015176 NM_015178 NM_015185 NM_015193 NM_015194 NM_015199 NM_015200 NM_015203 NM_015205 NM_015206 NM_015208 NM_015215 NM_015219 NM_015224 NM_015225 NM_015226 NM_015229 NM_015234 NM_015245 NM_015251 NM_015253 NM_015256 NM_015259 NM_015260 NM_015264 NM_015265 NM_015266 NM_015267 NM_015270 NM_015271 NM_015277 NM_015278 NM_015285 NM_015289 NM_015292 NM_015299 NM_015305 NM_015310 NM_015313 NM_015315 NM_015316 NM_015317 NM_015318 NM_015320 NM_015326 NM_015328 NM_015329 NM_015332 NM_015336 NM_015338 NM_015343 NM_015344 NM_015347 NM_015349 NM_015352 NM_015353 NM_015356 NM_015358 NM_015361 NM_015368 NM_015375 NM_015378 NM_015384 NM_015394 NM_015396 NM_015411 NM_015416 NM_015425 NM_015428 NM_015433 NM_015435 NM_015436 NM_015441 NM_015444 NM_015446 NM_015447 NM_015449 NM_015463 NM_015470 NM_015474 NM_015477 NM_015481 NM_015493 NM_015497 NM_015506 NM_015509 NM_015511 NM_015516 NM_015517 NM_015525 NM_015526 NM_015545 NM_015550 NM_015553 NM_015557 NM_015560 NM_015564 NM_015565 NM_015568 NM_015569 NM_015584 NM_015595 NM_015602 NM_015605 NM_015609 NM_015621 NM_015635 NM_015640 NM_015651 NM_015658 NM_015666 NM_015669 NM_015678 NM_015683 NM_015686 NM_015713 NM_015833 NM_015836 NM_015840 NM_015841 NM_015844 NM_015846 NM_015847 NM_015853 NM_015881 NM_015896 NM_015929 NM_015936 NM_015958 NM_015964 NM_015975 NM_015981 NM_015982 NM_015983 NM_015986 NM_015987 NM_015999 NM_016000 NM_016010 NM_016016 NM_016018 NM_016021 NM_016023 NM_016032 NM_016040 NM_016045 NM_016059 NM_016060 NM_016076 NM_016078 NM_016079 NM_016081 NM_016083 NM_016084 NM_016105 NM_016107 NM_016108 NM_016114 NM_016118 NM_016123 NM_016125 NM_016132 NM_016138 NM_016140 NM_016156 NM_016169 NM_016173 NM_016196 NM_016201 NM_016202 NM_016206 NM_016210 NM_016216 NM_016217 NM_016218 NM_016219 NM_016225 NM_016226 NM_016248 NM_016255 NM_016256 NM_016257 NM_016269 NM_016272 NM_016289 NM_016297 NM_016337 NM_016348 NM_016353 NM_016359 NM_016363 NM_016369 NM_016376 NM_016377 NM_016382 NM_016399 NM_016401 NM_016407 NM_016417 NM_016418 NM_016431 NM_016436 NM_016441 NM_016453 NM_016467 NM_016479 NM_016485 NM_016486 NM_016510 NM_016513 NM_016526 NM_016530 NM_016532 NM_016533 NM_016536 NM_016540 NM_016542 NM_016543 NM_016544 NM_016546 NM_016548 NM_016553 NM_016556 NM_016561 NM_016565 NM_016574 NM_016575 NM_016576 NM_016577 NM_016588 NM_016591 NM_016592 NM_016598 NM_016599 NM_016605 NM_016613 NM_016621 NM_016622 NM_016643 NM_016654 NM_016734 NM_016735 NM_016816 NM_016824 NM_016836 NM_016839 NM_016936 NM_016946 NM_017413 NM_017424 NM_017426 NM_017437 NM_017444 NM_017456 NM_017488 NM_017491 NM_017509 NM_017510 NM_017522 NM_017527 NM_017540 NM_017548 NM_017553 NM_017555 NM_017575 NM_017580 NM_017582 NM_017584 NM_017585 NM_017586 NM_017592 NM_017617 NM_017628 NM_017629 NM_017644 NM_017645 NM_017649 NM_017656 NM_017662 NM_017665 NM_017666 NM_017693 NM_017699 NM_017704 NM_017706 NM_017707 NM_017709 NM_017712 NM_017715 NM_017719 NM_017723 NM_017725 NM_017726 NM_017728 NM_017732 NM_017737 NM_017740 NM_017744 NM_017752 NM_017754 NM_017758 NM_017761 NM_017765 NM_017772 NM_017773 NM_017778 NM_017779 NM_017785 NM_017787 NM_017791 NM_017801 NM_017802 NM_017811 NM_017822 NM_017832 NM_017837 NM_017841 NM_017846 NM_017849 NM_017853 NM_017856 NM_017866 NM_017870 NM_017873 NM_017877 NM_017879 NM_017884 NM_017913 NM_017921 NM_017926 NM_017927 NM_017928 NM_017933 NM_017936 NM_017946 NM_017957 NM_017970 NM_017972 NM_017991 NM_017999 NM_018003 NM_018019 NM_018023 NM_018026 NM_018027 NM_018036 NM_018039 NM_018043 NM_018045 NM_018049 NM_018059 NM_018062 NM_018069 NM_018084 NM_018091 NM_018092 NM_018098 NM_018101 NM_018108 NM_018121 NM_018128 NM_018129 NM_018130 NM_018133 NM_018156 NM_018170 NM_018172 NM_018191 NM_018194 NM_018195 NM_018196 NM_018199 NM_018200 NM_018201 NM_018202 NM_018205 NM_018206 NM_018209 NM_018212 NM_018214 NM_018215 NM_018222 NM_018223 NM_018227 NM_018233 NM_018235 NM_018239 NM_018241 NM_018243 NM_018246 NM_018249 NM_018254 NM_018257 NM_018263 NM_018265 NM_018266 NM_018269 NM_018271 NM_018273 NM_018284 NM_018294 NM_018299 NM_018316 NM_018323 NM_018339 NM_018340 NM_018353 NM_018356 NM_018358 NM_018361 NM_018362 NM_018366 NM_018367 NM_018370 NM_018372 NM_018374 NM_018375 NM_018382 NM_018390 NM_018399 NM_018400 NM_018402 NM_018403 NM_018404 NM_018407 NM_018416 NM_018431 NM_018439 NM_018440 NM_018443 NM_018446 NM_018449 NM_018454 NM_018461 NM_018462 NM_018463 NM_018471 NM_018479 NM_018482 NM_018518 NM_018557 NM_018566 NM_018571 NM_018579 NM_018602 NM_018639 NM_018644 NM_018658 NM_018660 NM_018662 NM_018667 NM_018668 NM_018677 NM_018695 NM_018698 NM_018700 NM_018702 NM_018704 NM_018706 NM_018708 NM_018711 NM_018713 NM_018718 NM_018719 NM_018727 NM_018728 NM_018834 NM_018837 NM_018840 NM_018841 NM_018847 NM_018896 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018931 NM_018938 NM_018945 NM_018947 NM_018962 NM_018963 NM_018988 NM_018990 NM_018992 NM_018993 NM_018999 NM_019007 NM_019008 NM_019014 NM_019022 NM_019024 NM_019036 NM_019046 NM_019058 NM_019059 NM_019061 NM_019063 NM_019064 NM_019069 NM_019094 NM_019098 NM_019099 NM_019103 NM_019106 NM_019111 NM_019555 NM_019556 NM_019600 NM_019604 NM_019610 NM_019616 NM_019846 NM_019854 NM_019858 NM_019886 NM_019903 NM_020037 NM_020038 NM_020039 NM_020056 NM_020064 NM_020116 NM_020123 NM_020130 NM_020131 NM_020132 NM_020133 NM_020134 NM_020139 NM_020141 NM_020145 NM_020148 NM_020149 NM_020154 NM_020161 NM_020162 NM_020168 NM_020180 NM_020182 NM_020184 NM_020185 NM_020193 NM_020198 NM_020207 NM_020227 NM_020228 NM_020235 NM_020237 NM_020243 NM_020245 NM_020248 NM_020251 NM_020310 NM_020315 NM_020318 NM_020335 NM_020338 NM_020340 NM_020342 NM_020344 NM_020350 NM_020354 NM_020357 NM_020362 NM_020374 NM_020375 NM_020377 NM_020384 NM_020390 NM_020395 NM_020400 NM_020402 NM_020405 NM_020407 NM_020408 NM_020422 NM_020425 NM_020428 NM_020431 NM_020432 NM_020433 NM_020438 NM_020439 NM_020443 NM_020452 NM_020456 NM_020474 NM_020475 NM_020476 NM_020477 NM_020524 NM_020526 NM_020530 NM_020531 NM_020546 NM_020550 NM_020638 NM_020642 NM_020645 NM_020654 NM_020655 NM_020666 NM_020673 NM_020674 NM_020675 NM_020676 NM_020686 NM_020697 NM_020699 NM_020708 NM_020710 NM_020714 NM_020715 NM_020724 NM_020728 NM_020734 NM_020738 NM_020739 NM_020746 NM_020749 NM_020753 NM_020754 NM_020755 NM_020760 NM_020762 NM_020766 NM_020776 NM_020779 NM_020782 NM_020784 NM_020786 NM_020792 NM_020796 NM_020800 NM_020801 NM_020802 NM_020810 NM_020813 NM_020825 NM_020826 NM_020828 NM_020839 NM_020844 NM_020845 NM_020850 NM_020853 NM_020854 NM_020856 NM_020858 NM_020861 NM_020867 NM_020868 NM_020882 NM_020888 NM_020897 NM_020899 NM_020917 NM_020918 NM_020921 NM_020927 NM_020935 NM_020946 NM_020951 NM_020954 NM_020956 NM_020957 NM_020962 NM_020967 NM_020970 NM_020975 NM_020977 NM_020982 NM_020983 NM_020993 NM_021014 NM_021015 NM_021020 NM_021033 NM_021035 NM_021038 NM_021047 NM_021063 NM_021064 NM_021075 NM_021076 NM_021079 NM_021083 NM_021101 NM_021106 NM_021111 NM_021116 NM_021117 NM_021126 NM_021131 NM_021133 NM_021136 NM_021138 NM_021140 NM_021155 NM_021165 NM_021177 NM_021181 NM_021183 NM_021187 NM_021194 NM_021197 NM_021201 NM_021202 NM_021205 NM_021212 NM_021225 NM_021238 NM_021245 NM_021249 NM_021255 NM_021572 NM_021574 NM_021615 NM_021622 NM_021624 NM_021625 NM_021629 NM_021632 NM_021633 NM_021635 NM_021637 NM_021705 NM_021735 NM_021736 NM_021737 NM_021783 NM_021794 NM_021798 NM_021803 NM_021809 NM_021812 NM_021813 NM_021822 NM_021823 NM_021832 NM_021913 NM_021922 NM_021926 NM_021935 NM_021942 NM_021945 NM_021949 NM_021950 NM_021951 NM_021953 NM_021956 NM_021957 NM_021960 NM_021961 NM_021964 NM_021965 NM_021976 NM_021977 NM_021979 NM_022002 NM_022042 NM_022047 NM_022060 NM_022075 NM_022080 NM_022081 NM_022094 NM_022097 NM_022099 NM_022104 NM_022112 NM_022114 NM_022117 NM_022118 NM_022124 NM_022126 NM_022129 NM_022131 NM_022133 NM_022135 NM_022147 NM_022151 NM_022154 NM_022169 NM_022170 NM_022307 NM_022308 NM_022333 NM_022338 NM_022346 NM_022351 NM_022369 NM_022452 NM_022454 NM_022461 NM_022463 NM_022473 NM_022482 NM_022484 NM_022489 NM_022491 NM_022492 NM_022493 NM_022494 NM_022570 NM_022652 NM_022658 NM_022716 NM_022725 NM_022751 NM_022754 NM_022755 NM_022758 NM_022762 NM_022764 NM_022766 NM_022771 NM_022772 NM_022773 NM_022786 NM_022818 NM_022824 NM_022828 NM_022829 NM_022832 NM_022833 NM_022834 NM_022840 NM_022842 NM_022844 NM_022872 NM_022873 NM_022894 NM_022895 NM_022898 NM_022899 NM_022900 NM_022909 NM_022911 NM_022915 NM_023002 NM_023006 NM_023009 NM_023016 NM_023032 NM_023036 NM_023037 NM_023072 NM_023073 NM_023078 NM_023087 NM_023112 NM_023923 NM_023927 NM_023928 NM_023929 NM_023930 NM_023931 NM_023937 NM_023938 NM_023939 NM_023948 NM_024003 NM_024007 NM_024017 NM_024025 NM_024034 NM_024039 NM_024048 NM_024052 NM_024068 NM_024076 NM_024077 NM_024097 NM_024098 NM_024103 NM_024117 NM_024122 NM_024293 NM_024294 NM_024297 NM_024306 NM_024319 NM_024323 NM_024325 NM_024329 NM_024335 NM_024336 NM_024342 NM_024345 NM_024423 NM_024490 NM_024496 NM_024505 NM_024511 NM_024512 NM_024513 NM_024517 NM_024536 NM_024541 NM_024545 NM_024546 NM_024560 NM_024563 NM_024565 NM_024583 NM_024585 NM_024586 NM_024600 NM_024607 NM_024610 NM_024611 NM_024616 NM_024617 NM_024618 NM_024626 NM_024627 NM_024631 NM_024640 NM_024643 NM_024645 NM_024650 NM_024656 NM_024665 NM_024667 NM_024674 NM_024677 NM_024685 NM_024686 NM_024687 NM_024689 NM_024698 NM_024707 NM_024726 NM_024735 NM_024749 NM_024751 NM_024773 NM_024779 NM_024807 NM_024811 NM_024813 NM_024817 NM_024818 NM_024831 NM_024833 NM_024834 NM_024836 NM_024843 NM_024852 NM_024855 NM_024859 NM_024861 NM_024866 NM_024875 NM_024881 NM_024889 NM_024896 NM_024900 NM_024910 NM_024911 NM_024915 NM_024918 NM_024921 NM_024930 NM_024935 NM_024938 NM_024939 NM_024943 NM_024949 NM_024952 NM_024974 NM_024989 NM_024997 NM_025000 NM_025019 NM_025026 NM_025030 NM_025042 NM_025047 NM_025048 NM_025057 NM_025058 NM_025061 NM_025074 NM_025082 NM_025083 NM_025106 NM_025107 NM_025112 NM_025125 NM_025141 NM_025152 NM_025160 NM_025164 NM_025165 NM_025179 NM_025182 NM_025193 NM_025197 NM_025202 NM_025205 NM_025208 NM_025214 NM_025224 NM_025240 NM_025250 NM_025259 NM_025264 NM_030379 NM_030380 NM_030381 NM_030568 NM_030569 NM_030571 NM_030576 NM_030579 NM_030621 NM_030622 NM_030625 NM_030626 NM_030643 NM_030651 NM_030653 NM_030655 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030755 NM_030758 NM_030760 NM_030762 NM_030766 NM_030767 NM_030774 NM_030781 NM_030782 NM_030786 NM_030798 NM_030802 NM_030805 NM_030806 NM_030814 NM_030817 NM_030821 NM_030884 NM_030885 NM_030899 NM_030918 NM_030919 NM_030923 NM_030925 NM_030934 NM_030939 NM_030952 NM_030959 NM_030971 NM_030978 NM_031208 NM_031215 NM_031216 NM_031217 NM_031231 NM_031232 NM_031244 NM_031268 NM_031279 NM_031281 NM_031282 NM_031283 NM_031295 NM_031296 NM_031306 NM_031313 NM_031372 NM_031411 NM_031422 NM_031426 NM_031435 NM_031437 NM_031444 NM_031445 NM_031449 NM_031453 NM_031459 NM_031462 NM_031468 NM_031469 NM_031474 NM_031476 NM_031482 NM_031490 NM_031498 NM_031849 NM_031850 NM_031857 NM_031860 NM_031866 NM_031889 NM_031890 NM_031892 NM_031900 NM_031904 NM_031905 NM_031910 NM_031911 NM_031912 NM_031917 NM_031924 NM_031939 NM_031940 NM_031946 NM_031954 NM_031957 NM_031958 NM_031966 NM_031988 NM_031992 NM_032010 NM_032012 NM_032018 NM_032021 NM_032040 NM_032041 NM_032045 NM_032046 NM_032047 NM_032049 NM_032051 NM_032088 NM_032092 NM_032103 NM_032104 NM_032105 NM_032116 NM_032121 NM_032124 NM_032125 NM_032126 NM_032136 NM_032137 NM_032139 NM_032144 NM_032153 NM_032160 NM_032175 NM_032192 NM_032195 NM_032196 NM_032204 NM_032207 NM_032208 NM_032211 NM_032213 NM_032217 NM_032221 NM_032222 NM_032263 NM_032264 NM_032279 NM_032280 NM_032283 NM_032287 NM_032294 NM_032296 NM_032310 NM_032312 NM_032314 NM_032316 NM_032317 NM_032325 NM_032326 NM_032345 NM_032372 NM_032373 NM_032385 NM_032403 NM_032410 NM_032420 NM_032421 NM_032423 NM_032424 NM_032427 NM_032431 NM_032432 NM_032433 NM_032434 NM_032441 NM_032445 NM_032446 NM_032452 NM_032458 NM_032485 NM_032486 NM_032487 NM_032491 NM_032499 NM_032509 NM_032510 NM_032512 NM_032513 NM_032521 NM_032525 NM_032529 NM_032550 NM_032554 NM_032558 NM_032569 NM_032579 NM_032590 NM_032600 NM_032606 NM_032622 NM_032632 NM_032638 NM_032639 NM_032643 NM_032644 NM_032646 NM_032649 NM_032680 NM_032682 NM_032706 NM_032709 NM_032711 NM_032728 NM_032735 NM_032740 NM_032752 NM_032753 NM_032770 NM_032777 NM_032778 NM_032780 NM_032782 NM_032783 NM_032797 NM_032800 NM_032804 NM_032811 NM_032817 NM_032818 NM_032826 NM_032828 NM_032831 NM_032834 NM_032837 NM_032842 NM_032845 NM_032848 NM_032853 NM_032859 NM_032867 NM_032869 NM_032876 NM_032886 NM_032892 NM_032899 NM_032905 NM_032916 NM_032920 NM_032932 NM_032933 NM_032947 NM_032949 NM_032958 NM_032959 NM_032975 NM_032976 NM_032977 NM_032980 NM_032982 NM_032983 NM_032984 NM_032991 NM_032995 NM_033013 NM_033016 NM_033025 NM_033033 NM_033034 NM_033035 NM_033036 NM_033044 NM_033048 NM_033058 NM_033071 NM_033083 NM_033100 NM_033114 NM_033130 NM_033133 NM_033135 NM_033138 NM_033139 NM_033140 NM_033141 NM_033143 NM_033150 NM_033153 NM_033157 NM_033161 NM_033170 NM_033171 NM_033172 NM_033173 NM_033181 NM_033207 NM_033210 NM_033221 NM_033224 NM_033240 NM_033244 NM_033245 NM_033261 NM_033267 NM_033285 NM_033300 NM_033305 NM_033312 NM_033313 NM_033315 NM_033332 NM_033346 NM_033360 NM_033364 NM_033377 NM_033389 NM_033393 NM_033394 NM_033410 NM_033412 NM_033414 NM_033421 NM_033425 NM_033426 NM_033439 NM_033446 NM_033448 NM_033480 NM_033481 NM_033495 NM_033503 NM_033504 NM_033505 NM_033510 NM_033512 NM_033515 NM_033516 NM_033535 NM_033542 NM_033548 NM_033550 NM_033551 NM_033631 NM_033637 NM_033644 NM_033645 NM_033655 NM_033656 NM_052822 NM_052827 NM_052832 NM_052834 NM_052842 NM_052847 NM_052848 NM_052851 NM_052861 NM_052869 NM_052874 NM_052876 NM_052880 NM_052884 NM_052890 NM_052896 NM_052899 NM_052900 NM_052905 NM_052906 NM_052917 NM_052918 NM_052919 NM_052928 NM_052932 NM_052934 NM_052937 NM_052938 NM_052939 NM_052941 NM_052949 NM_052954 NM_052958 NM_052965 NM_052966 NM_052968 NM_052971 NM_052972 NM_052996 NM_053024 NM_053029 NM_053044 NM_053046 NM_053064 NM_053279 NM_053286 NM_054012 NM_054022 NM_054025 NM_054033 NM_054035 NM_054110 NM_054111 NM_057157 NM_057159 NM_057180 NM_057182 NM_058166 NM_058170 NM_058172 NM_058174 NM_058175 NM_058178 NM_058190 NM_058219 NM_078470 NM_078471 NM_078473 NM_078474 NM_078483 NM_078488 NM_078625 NM_078626 NM_080385 NM_080386 NM_080391 NM_080417 NM_080551 NM_080552 NM_080588 NM_080589 NM_080607 NM_080612 NM_080617 NM_080621 NM_080645 NM_080654 NM_080664 NM_080666 NM_080670 NM_080704 NM_080705 NM_080706 NM_080717 NM_080723 NM_080725 NM_080732 NM_080737 NM_080738 NM_080744 NM_080747 NM_080764 NM_080792 NM_080829 NM_080831 NM_080836 NM_080862 NM_080867 NM_080872 NM_080876 NM_080911 NM_130385 NM_130386 NM_130387 NM_130442 NM_130446 NM_130459 NM_130463 NM_130470 NM_130471 NM_130472 NM_130473 NM_130474 NM_130475 NM_130476 NM_130766 NM_130786 NM_130795 NM_130807 NM_130809 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130847 NM_130848 NM_133170 NM_133171 NM_133265 NM_133269 NM_133271 NM_133272 NM_133273 NM_133274 NM_133277 NM_133278 NM_133279 NM_133328 NM_133334 NM_133367 NM_133371 NM_133372 NM_133445 NM_133446 NM_133448 NM_133451 NM_133459 NM_133463 NM_133468 NM_133473 NM_133476 NM_133482 NM_133496 NM_133627 NM_133628 NM_133629 NM_133630 NM_133632 NM_133633 NM_133646 NM_134263 NM_134269 NM_134325 NM_134421 NM_134422 NM_134423 NM_134424 NM_134426 NM_134427 NM_134433 NM_134434 NM_134447 NM_138280 NM_138282 NM_138284 NM_138287 NM_138298 NM_138299 NM_138300 NM_138333 NM_138338 NM_138340 NM_138342 NM_138348 NM_138350 NM_138357 NM_138368 NM_138369 NM_138373 NM_138399 NM_138402 NM_138413 NM_138415 NM_138423 NM_138424 NM_138436 NM_138444 NM_138447 NM_138450 NM_138456 NM_138457 NM_138458 NM_138459 NM_138467 NM_138468 NM_138473 NM_138477 NM_138492 NM_138494 NM_138499 NM_138551 NM_138558 NM_138563 NM_138564 NM_138566 NM_138572 NM_138574 NM_138576 NM_138608 NM_138617 NM_138618 NM_138633 NM_138639 NM_138691 NM_138694 NM_138713 NM_138714 NM_138715 NM_138716 NM_138717 NM_138726 NM_138727 NM_138728 NM_138730 NM_138737 NM_138739 NM_138740 NM_138768 NM_138769 NM_138775 NM_138782 NM_138793 NM_138810 NM_138813 NM_138819 NM_138928 NM_138958 NM_138959 NM_138960 NM_138966 NM_138969 NM_138970 NM_138971 NM_138972 NM_138973 NM_139018 NM_139022 NM_139024 NM_139028 NM_139073 NM_139075 NM_139124 NM_139125 NM_139156 NM_139162 NM_139164 NM_139168 NM_139169 NM_139170 NM_139201 NM_139214 NM_139245 NM_139274 NM_139275 NM_139277 NM_139279 NM_139280 NM_139281 NM_139312 NM_139321 NM_139323 NM_139353 NM_144488 NM_144489 NM_144498 NM_144502 NM_144503 NM_144504 NM_144567 NM_144574 NM_144582 NM_144583 NM_144598 NM_144599 NM_144600 NM_144606 NM_144607 NM_144617 NM_144618 NM_144629 NM_144635 NM_144639 NM_144642 NM_144649 NM_144651 NM_144652 NM_144661 NM_144667 NM_144692 NM_144713 NM_144720 NM_144721 NM_144724 NM_144767 NM_144769 NM_144781 NM_144782 NM_144956 NM_144957 NM_144965 NM_144966 NM_144967 NM_144978 NM_144982 NM_144991 NM_144997 NM_145012 NM_145035 NM_145049 NM_145052 NM_145055 NM_145059 NM_145065 NM_145109 NM_145110 NM_145115 NM_145165 NM_145166 NM_145174 NM_145177 NM_145178 NM_145179 NM_145187 NM_145188 NM_145189 NM_145190 NM_145196 NM_145197 NM_145198 NM_145199 NM_145206 NM_145234 NM_145250 NM_145251 NM_145254 NM_145256 NM_145257 NM_145258 NM_145265 NM_145276 NM_145282 NM_145288 NM_145293 NM_145296 NM_145304 NM_145307 NM_145309 NM_145310 NM_145311 NM_145316 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145331 NM_145332 NM_145333 NM_145341 NM_145343 NM_145344 NM_145349 NM_145350 NM_145351 NM_145646 NM_145660 NM_145685 NM_145686 NM_145687 NM_145690 NM_145699 NM_145719 NM_145733 NM_145734 NM_145735 NM_145754 NM_145759 NM_145793 NM_145800 NM_145802 NM_145808 NM_145818 NM_145858 NM_145861 NM_145864 NM_145865 NM_145888 NM_145909 NM_145910 NM_145912 NM_146388 NM_147129 NM_147131 NM_147132 NM_147147 NM_147187 NM_147190 NM_147194 NM_147202 NM_147204 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148171 NM_148172 NM_148173 NM_148178 NM_148179 NM_148842 NM_148886 NM_148894 NM_148904 NM_148905 NM_148906 NM_148907 NM_148908 NM_148909 NM_148957 NM_148960 NM_152225 NM_152233 NM_152235 NM_152247 NM_152253 NM_152255 NM_152261 NM_152262 NM_152267 NM_152271 NM_152272 NM_152280 NM_152282 NM_152284 NM_152286 NM_152289 NM_152306 NM_152307 NM_152309 NM_152313 NM_152321 NM_152322 NM_152330 NM_152340 NM_152345 NM_152350 NM_152357 NM_152361 NM_152380 NM_152391 NM_152407 NM_152414 NM_152422 NM_152429 NM_152435 NM_152436 NM_152437 NM_152439 NM_152449 NM_152451 NM_152456 NM_152475 NM_152484 NM_152485 NM_152487 NM_152490 NM_152495 NM_152500 NM_152515 NM_152519 NM_152520 NM_152527 NM_152531 NM_152542 NM_152547 NM_152551 NM_152557 NM_152563 NM_152565 NM_152571 NM_152588 NM_152595 NM_152598 NM_152605 NM_152618 NM_152622 NM_152624 NM_152626 NM_152628 NM_152636 NM_152638 NM_152641 NM_152653 NM_152658 NM_152666 NM_152677 NM_152687 NM_152688 NM_152690 NM_152692 NM_152694 NM_152695 NM_152698 NM_152699 NM_152701 NM_152702 NM_152705 NM_152716 NM_152718 NM_152723 NM_152731 NM_152734 NM_152745 NM_152748 NM_152753 NM_152757 NM_152758 NM_152760 NM_152764 NM_152769 NM_152774 NM_152776 NM_152793 NM_152830 NM_152831 NM_152834 NM_152835 NM_152836 NM_152837 NM_152838 NM_152840 NM_152841 NM_152842 NM_152857 NM_152858 NM_152860 NM_152866 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152879 NM_152883 NM_152888 NM_152896 NM_152897 NM_152902 NM_152903 NM_152906 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152932 NM_152939 NM_152945 NM_152989 NM_152995 NM_152996 NM_153007 NM_153010 NM_153018 NM_153026 NM_153029 NM_153031 NM_153032 NM_153033 NM_153035 NM_153040 NM_153042 NM_153044 NM_153045 NM_153181 NM_153191 NM_153201 NM_153215 NM_153220 NM_153239 NM_153255 NM_153256 NM_153262 NM_153263 NM_153273 NM_153276 NM_153277 NM_153278 NM_153279 NM_153280 NM_153330 NM_153331 NM_153339 NM_153344 NM_153348 NM_153355 NM_153362 NM_153364 NM_153365 NM_153380 NM_153451 NM_153453 NM_153456 NM_153463 NM_153487 NM_153488 NM_153498 NM_153499 NM_153500 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153620 NM_153634 NM_153645 NM_153646 NM_153647 NM_153648 NM_153683 NM_153684 NM_153685 NM_153686 NM_153687 NM_153689 NM_153691 NM_153693 NM_153704 NM_153705 NM_153706 NM_153708 NM_153710 NM_153712 NM_153718 NM_153719 NM_153754 NM_153756 NM_153757 NM_153758 NM_153768 NM_153809 NM_153812 NM_153824 NM_153834 NM_153836 NM_153837 NM_170601 NM_170607 NM_170674 NM_170677 NM_170679 NM_170694 NM_170696 NM_170697 NM_170707 NM_170708 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170720 NM_170724 NM_170725 NM_170726 NM_170740 NM_170741 NM_170742 NM_170743 NM_170768 NM_170773 NM_170774 NM_171825 NM_171998 NM_172000 NM_172024 NM_172037 NM_172070 NM_172101 NM_172102 NM_172110 NM_172111 NM_172112 NM_172113 NM_172127 NM_172128 NM_172130 NM_172165 NM_172166 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172206 NM_172207 NM_172213 NM_172216 NM_172217 NM_172219 NM_172220 NM_172226 NM_172230 NM_172234 NM_172239 NM_172242 NM_172244 NM_172315 NM_172316 NM_172367 NM_172375 NM_173064 NM_173065 NM_173079 NM_173164 NM_173191 NM_173192 NM_173193 NM_173194 NM_173195 NM_173198 NM_173200 NM_173214 NM_173216 NM_173217 NM_173342 NM_173357 NM_173358 NM_173459 NM_173462 NM_173463 NM_173465 NM_173468 NM_173469 NM_173473 NM_173477 NM_173478 NM_173510 NM_173511 NM_173515 NM_173519 NM_173529 NM_173531 NM_173536 NM_173551 NM_173554 NM_173558 NM_173564 NM_173570 NM_173576 NM_173580 NM_173581 NM_173582 NM_173588 NM_173602 NM_173610 NM_173622 NM_173625 NM_173627 NM_173632 NM_173652 NM_173654 NM_173657 NM_173662 NM_173664 NM_173669 NM_173675 NM_173677 NM_173681 NM_173683 NM_173694 NM_173701 NM_173793 NM_173795 NM_173799 NM_173802 NM_173803 NM_173804 NM_173805 NM_173806 NM_173807 NM_173808 NM_173812 NM_173823 NM_173826 NM_173827 NM_173829 NM_173830 NM_173832 NM_173833 NM_173841 NM_173842 NM_173843 NM_173844 NM_173851 NM_173854 NM_173855 NM_173859 NM_174871 NM_174900 NM_174902 NM_174911 NM_174929 NM_174934 NM_174940 NM_174961 NM_174962 NM_174976 NM_174977 NM_174978 NM_175053 NM_175056 NM_175061 NM_175078 NM_175080 NM_175085 NM_175567 NM_175568 NM_175607 NM_175609 NM_175612 NM_175617 NM_175622 NM_175698 NM_175723 NM_175724 NM_175727 NM_175729 NM_175733 NM_175736 NM_175742 NM_175743 NM_175747 NM_175767 NM_175768 NM_175862 NM_175864 NM_175876 NM_175883 NM_175884 NM_175888 NM_175892 NM_175895 NM_175900 NM_175901 NM_175908 NM_175911 NM_175920 NM_175921 NM_175922 NM_176071 NM_176072 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176095 NM_176789 NM_176816 NM_176823 NM_176824 NM_176825 NM_176826 NM_176866 NM_176867 NM_176869 NM_176871 NM_176878 NM_177403 NM_177405 NM_177414 NM_177422 NM_177424 NM_177427 NM_177434 NM_177436 NM_177438 NM_177439 NM_177442 NM_177453 NM_177532 NM_177549 NM_177550 NM_177937 NM_177951 NM_177954 NM_177959 NM_177965 NM_177968 NM_177969 NM_177972 NM_177974 NM_177978 NM_177979 NM_177995 NM_177999 NM_178000 NM_178001 NM_178002 NM_178003 NM_178006 NM_178007 NM_178010 NM_178011 NM_178031 NM_178034 NM_178123 NM_178140 NM_178145 NM_178151 NM_178152 NM_178153 NM_178172 NM_178173 NM_178175 NM_178191 NM_178234 NM_178423 NM_178448 NM_178470 NM_178502 NM_178505 NM_178509 NM_178514 NM_178516 NM_178539 NM_178542 NM_178568 NM_178571 NM_178580 NM_178583 NM_178586 NM_178818 NM_178823 NM_178830 NM_178832 NM_178838 NM_178839 NM_178861 NM_178863 NM_180976 NM_180977 NM_180981 NM_180989 NM_181050 NM_181076 NM_181077 NM_181078 NM_181079 NM_181302 NM_181307 NM_181308 NM_181342 NM_181356 NM_181358 NM_181359 NM_181425 NM_181466 NM_181467 NM_181468 NM_181469 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181504 NM_181505 NM_181510 NM_181523 NM_181524 NM_181572 NM_181576 NM_181578 NM_181644 NM_181654 NM_181655 NM_181656 NM_181659 NM_181671 NM_181688 NM_181701 NM_181703 NM_181704 NM_181709 NM_181724 NM_181726 NM_181733 NM_181744 NM_181746 NM_181762 NM_181773 NM_181776 NM_181777 NM_181789 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181844 NM_181846 NM_181861 NM_181868 NM_181869 NM_181873 NM_181897 NM_182314 NM_182484 NM_182485 NM_182486 NM_182487 NM_182500 NM_182503 NM_182510 NM_182511 NM_182520 NM_182522 NM_182533 NM_182534 NM_182540 NM_182546 NM_182548 NM_182551 NM_182556 NM_182558 NM_182562 NM_182568 NM_182578 NM_182579 NM_182584 NM_182587 NM_182605 NM_182613 NM_182615 NM_182616 NM_182635 NM_182637 NM_182638 NM_182645 NM_182646 NM_182648 NM_182665 NM_182691 NM_182692 NM_182697 NM_182700 NM_182704 NM_182706 NM_182728 NM_182729 NM_182742 NM_182743 NM_182744 NM_182751 NM_182752 NM_182757 NM_182763 NM_182764 NM_182767 NM_182775 NM_182802 NM_182830 NM_182848 NM_182854 NM_182898 NM_182899 NM_182907 NM_182916 NM_182920 NM_182935 NM_182960 NM_182966 NM_183006 NM_183010 NM_183078 NM_183337 NM_183387 NM_183398 NM_183399 NM_183400 NM_183401 NM_183404 NM_183419 NM_184085 NM_184086 NM_184087 NM_184231 NM_194071 NM_194248 NM_194252 NM_194272 NM_194281 NM_194285 NM_194286 NM_194292 NM_194293 NM_194294 NM_194298 NM_194301 NM_194303 NM_194309 NM_194310 NM_194313 NM_194317 NM_194322 NM_194323 NM_194324 NM_194326 NM_194327 NM_194352 NM_194358 NM_194359 NM_194434 NM_194439 NM_194449 NM_194454 NM_194455 NM_194456 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197956 NM_197966 NM_197967 NM_197977 NM_198056 NM_198057 NM_198085 NM_198086 NM_198123 NM_198124 NM_198141 NM_198147 NM_198148 NM_198150 NM_198182 NM_198196 NM_198204 NM_198205 NM_198212 NM_198213 NM_198225 NM_198243 NM_198268 NM_198269 NM_198271 NM_198277 NM_198279 NM_198291 NM_198321 NM_198324 NM_198327 NM_198328 NM_198329 NM_198336 NM_198337 NM_198376 NM_198377 NM_198378 NM_198379 NM_198380 NM_198382 NM_198383 NM_198384 NM_198385 NM_198386 NM_198387 NM_198388 NM_198389 NM_198391 NM_198396 NM_198399 NM_198402 NM_198442 NM_198447 NM_198451 NM_198452 NM_198458 NM_198460 NM_198465 NM_198471 NM_198476 NM_198478 NM_198480 NM_198484 NM_198490 NM_198494 NM_198496 NM_198499 NM_198501 NM_198508 NM_198511 NM_198512 NM_198527 NM_198529 NM_198539 NM_198549 NM_198562 NM_198563 NM_198565 NM_198581 NM_198582 NM_198586 NM_198589 NM_198590 NM_198591 NM_198596 NM_198719 NM_198720 NM_198793 NM_198835 NM_198843 NM_198850 NM_198859 NM_198868 NM_198889 NM_198896 NM_198900 NM_198901 NM_198902 NM_198926 NM_198939 NM_198947 NM_198956 NM_198964 NM_198968 NM_198971 NM_198977 NM_198989 NM_198990 NM_198991 NM_199000 NM_199002 NM_199040 NM_199043 NM_199045 NM_199050 NM_199053 NM_199072 NM_199076 NM_199121 NM_199132 NM_199136 NM_199160 NM_199162 NM_199163 NM_199169 NM_199170 NM_199171 NM_199176 NM_199180 NM_199189 NM_199280 NM_199282 NM_199297 NM_199327 NM_199337 NM_199343 NM_199420 NM_199421 NM_199423 NM_199436 NM_199437 NM_199438 NM_199439 NM_199443 NM_199451 NM_199452 NM_199454 NM_199459 NM_199461 NM_199462 NM_199483 NM_199484 NM_199485 NM_201263 NM_201266 NM_201274 NM_201277 NM_201278 NM_201279 NM_201281 NM_201348 NM_201378 NM_201379 NM_201380 NM_201381 NM_201382 NM_201383 NM_201384 NM_201431 NM_201432 NM_201433 NM_201437 NM_201543 NM_201544 NM_201545 NM_201559 NM_201570 NM_201571 NM_201572 NM_201590 NM_201593 NM_201596 NM_201597 NM_201624 NM_201629 NM_201632 NM_201633 NM_201634 NM_201994 NM_201997 NM_202002 NM_202003 NM_203281 NM_203302 NM_203305 NM_203306 NM_203307 NM_203318 NM_203329 NM_203330 NM_203331 NM_203339 NM_203342 NM_203343 NM_203351 NM_203353 NM_203374 NM_203375 NM_203381 NM_203390 NM_203391 NM_203394 NM_203395 NM_203404 NM_203407 NM_203413 NM_203417 NM_203418 NM_203446 NM_203447 NM_203452 NM_203454 NM_203477 NM_203506 NM_203510 NM_205548 NM_205846 NM_205857 NM_205860 NM_206809 NM_206812 NM_206814 NM_206819 NM_206820 NM_206821 NM_206835 NM_206852 NM_206853 NM_206854 NM_206855 NM_206857 NM_206866 NM_206883 NM_206884 NM_206885 NM_206887 NM_206889 NM_206893 NM_206909 NM_206914 NM_206933 NM_206938 NM_206939 NM_206940 NM_206962 NM_207012 NM_207035 NM_207115 NM_207119 NM_207122 NM_207123 NM_207126 NM_207129 NM_207171 NM_207285 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207323 NM_207325 NM_207327 NM_207330 NM_207331 NM_207334 NM_207335 NM_207337 NM_207348 NM_207352 NM_207372 NM_207378 NM_207387 NM_207394 NM_207395 NM_207396 NM_207404 NM_207413 NM_207417 NM_207419 NM_207422 NM_207430 NM_207434 NM_207445 NM_207447 NM_207451 NM_207454 NM_207458 NM_207463 NM_207467 NM_207471 NM_207473 NM_207474 NM_207482 NM_207483 NM_207489 NM_207502 NM_207503 NM_207504 NM_207506 NM_207510 NM_207511 NM_207518 NM_207577 NM_207582 NM_207644 NM_207646 NM_212461 NM_212464 NM_212467 NM_212471 NM_212472 NM_212554 NM_212555 NM_212558 NM_212559 NM_213566 NM_213589 NM_213593 NM_213594 NM_213596 NM_213600 NM_213613 NM_213645 NM_213646 NM_213648 NM_213651 NM_213723 NM_213726 NM_214462 NM_214676 NM_214677 NM_214678 NM_214679 NM_214711 XM_027236 XM_027307 XM_028810 XM_031104 XM_032901 XM_032945 XM_036708 XM_036936 XM_036942 XM_037557 XM_038150 XM_038436 XM_039515 XM_039570 XM_040592 XM_042066 XM_042301 XM_042698 XM_042833 XM_042936 XM_042978 XM_043493 XM_044062 XM_046581 XM_046600 XM_047355 XM_047357 XM_047550 XM_047554 XM_047995 XM_048592 XM_048898 XM_049078 XM_049237 XM_051200 XM_051862 XM_055636 XM_056455 XM_057107 XM_059061 XM_059318 XM_059689 XM_059929 XM_059954 XM_067605 XM_084529 XM_085261 XM_085367 XM_085634 XM_085833 XM_086308 XM_087137 XM_089384 XM_096733 XM_097278 XM_097351 XM_097977 XM_113947 XM_113967 XM_114303 XM_114415 XM_166140 XM_167044 XM_168530 XM_170842 XM_171054 XM_173015 XM_173160 XM_208204 XM_208990 XM_209227 XM_209554 XM_209569 XM_209700 XM_209753 XM_210048 XM_210826 XM_210860 XM_211028 XM_211174 XM_211896 XM_212170 XM_290527 XM_290540 XM_290546 XM_290597 XM_290615 XM_290734 XM_290809 XM_290835 XM_290925 XM_291028 XM_291063 XM_291128 XM_291262 XM_291344 XM_291729 XM_292717 XM_292785 XM_293828 XM_294521 XM_294723 XM_294743 XM_294765 XM_294802 XM_295155 XM_295178 XM_295213 XM_296817 XM_350880 XM_370654 XM_370696 XM_370756 XM_370837 XM_370839 XM_370840 XM_370843 XM_370848 XM_370878 XM_370917 XM_370928 XM_370932 XM_371074 XM_371082 XM_371116 XM_371151 XM_371181 XM_371184 XM_371204 XM_371206 XM_371214 XM_371254 XM_371286 XM_371299 XM_371302 XM_371304 XM_371369 XM_371388 XM_371429 XM_371461 XM_371488 XM_371501 XM_371542 XM_371617 XM_371638 XM_371655 XM_371663 XM_371759 XM_371760 XM_371761 XM_371777 XM_371783 XM_371801 XM_371885 XM_371904 XM_371956 XM_372019 XM_372028 XM_372030 XM_372035 XM_372039 XM_372040 XM_372097 XM_372118 XM_372198 XM_372205 XM_372273 XM_372302 XM_372420 XM_372579 XM_372584 XM_372716 XM_373030 XM_373500 XM_373547 XM_373562 XM_373583 XM_373587 XM_373594 XM_373602 XM_373660 XM_373686 XM_373704 XM_373742 XM_373822 XM_373826 XM_373827 XM_373838 XM_373854 XM_373883 XM_373885 XM_373896 XM_373950 XM_373981 XM_374002 XM_374020 XM_374078 XM_374082 XM_374113 XM_374150 XM_374192 XM_374249 XM_374277 XM_374317 XM_374343 XM_374414 XM_374484 XM_374529 XM_374766 XM_374801 XM_374880 XM_374912 XM_374915 XM_374983 XM_375152 XM_375292 XM_375307 XM_375357 XM_375373 XM_375443 XM_375456 XM_375568 XM_375590 XM_375602 XM_375606 XM_375629 XM_375669 XM_375697 XM_375713 XM_375747 XM_375821 XM_375838 XM_375845 XM_375912 XM_376018 XM_376049 XM_376241 XM_376269 XM_376278 XM_376320 XM_376350 XM_376372 XM_376463 XM_376474 XM_376550 XM_376558 XM_376560 XM_376567 XM_376586 XM_376587 XM_376602 XM_376658 XM_376677 XM_376680 XM_376720 XM_376784 XM_376795 XM_376869 XM_377053 XM_377076 XM_377476 XM_378203 XM_378208 XM_378223 XM_378228 XM_378236 XM_378250 XM_378273 XM_378301 XM_378312 XM_378316 XM_378321 XM_378327 XM_378329 XM_378331 XM_378349 XM_378350 XM_378355 XM_378356 XM_378379 XM_378389 XM_378390 XM_378394 XM_378411 XM_378453 XM_378456 XM_378507 XM_378512 XM_378544 XM_378550 XM_378558 XM_378567 XM_378582 XM_378589 XM_378608 XM_378620 XM_378625 XM_378642 XM_378678 XM_378692 XM_378703 XM_378708 XM_378747 XM_378776 XM_378786 XM_378795 XM_378810 XM_378825 XM_378832 XM_378842 XM_378843 XM_378852 XM_378855 XM_378858 XM_378886 XM_378914 XM_378970 XM_378971 XM_378980 XM_378983 XM_379006 XM_379060 XM_379068 XM_379075 XM_379079 XM_379094 XM_379102 XM_379106 XM_379135 XM_379136 XM_379141 XM_379145 XM_379154 XM_379156 XM_379177 XM_379189 XM_379194 XM_379235 XM_379243 XM_379247 XM_379254 XM_379267 XM_379273 XM_379276 XM_379280 XM_379318 XM_379324 XM_379327 XM_379355 XM_379381 XM_379391 XM_379398 XM_379402 XM_379409 XM_379432 XM_379437 XM_379456 XM_379458 XM_379459 XM_379477 XM_379506 XM_379512 XM_379515 XM_379518 XM_379535 XM_379547 XM_379573 XM_379584 XM_379594 XM_379595 XM_379597 XM_379622 XM_379629 XM_379634 XM_379643 XM_379656 XM_379664 XM_379665 XM_379720 XM_379722 XM_379774 XM_379798 XM_379820 XM_379897 XM_379920 XM_379931 XM_379932 XM_379934 XM_379967 XM_380092 XM_380103 XM_380127 XM_380135 XM_380139 XM_380143 XM_380160 XM_495807 XM_495830 XM_495877 XM_495879 XM_495886 XM_495888 XM_495908 XM_495909 XM_495937 XM_495950 XM_495961 XM_496028 XM_496048 XM_496088 XM_496096 XM_496115 XM_496134 XM_496156 XM_496191 XM_496231 XM_496239 XM_496255 XM_496264 XM_496280 XM_496328 XM_496330 XM_496351 XM_496352 XM_496358 XM_496400 XM_496408 XM_496436 XM_496449 XM_496467 XM_496504 XM_496519 XM_496537 XM_496539 XM_496547 XM_496549 XM_496635 XM_496637 XM_496644 XM_496664 XM_496689 XM_496690 XM_496692 XM_496780 XM_496791 XM_496840 XM_496849 XM_496854 XM_496877 XM_496879 XM_496882 XM_496907 XM_496942 XM_496943 XM_496981 XM_496983 XM_496984 XM_496985 XM_497002 XM_497012 XM_497080 XM_497089 XM_497120 XM_497181 XM_497185 XM_498427 XM_498434 XM_498436 XM_498445 XM_498446 XM_498449 XM_498451 XM_498452 XM_498453 XM_498455 XM_498457 XM_498459 XM_498460 XM_498464 XM_498467 XM_498487 XM_498490 XM_498500 XM_498516 XM_498525 XM_498528 XM_498529 XM_498530 XM_498534 XM_498540 XM_498545 XM_498552 XM_498555 XM_498557 XM_498563 XM_498570 XM_498581 XM_498587 XM_498593 XM_498594 XM_498611 XM_498614 XM_498617 XM_498624 XM_498628 XM_498641 XM_498649 XM_498661 XM_498662 XM_498671 XM_498681 XM_498683 XM_498690 XM_498736 XM_498737 XM_498739 XM_498753 XM_498764 XM_498810 XM_498814 XM_498816 XM_498818 XM_498825 XM_498829 XM_498831 XM_498835 XM_498841 XM_498844 XM_498852 XM_498865 XM_498869 XM_498872 XM_498883 XM_498890 XM_498894 XM_498910 XM_498912 XM_498933 XM_498938 XM_498958 XM_498972 XM_498974 XM_498992 XM_498998 XM_499005 XM_499023 XM_499047 XM_499048 XM_499051 XM_499056 XM_499057 XM_499061 XM_499074 XM_499085 XM_499103 XM_499105 XM_499107 XM_499123 XM_499125 XM_499136 XM_499137 XM_499158 XM_499173 XM_499246 XM_499257 XM_499263 XM_499269 XM_499290 XM_499295 XM_499298 XM_499309 XM_499343 XM_499362 XM_499366 XM_499496 XM_499503 XM_499505 XM_499510 XM_499514 XM_499528 XM_499541 XM_499556 XM_499563 XM_499564 XM_499566 XM_499575 XM_499576 XM_499579 XM_499581 XM_499584 XM_499586 XM_499589 XM_499590 XM_499594 XM_499597 XM_499602 XR_000167 XR_000182 XR_000184 XR_000190 XR_000192 XR_000195 XR_000227 XR_000261 XR_000266 XR_000272 XR_000292 XR_000294
Genes with multiple seed matches:
NM_000046 NM_000104 NM_000112 NM_000138 NM_000148 NM_000153 NM_000196 NM_000216 NM_000254 NM_000276 NM_000332 NM_000353 NM_000358 NM_000362 NM_000391 NM_000411 NM_000437 NM_000480 NM_000486 NM_000529 NM_000555 NM_000565 NM_000569 NM_000570 NM_000611 NM_000616 NM_000633 NM_000635 NM_000663 NM_000664 NM_000671 NM_000721 NM_000748 NM_000761 NM_000788 NM_000793 NM_001001396 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001669 NM_001001685 NM_001001690 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001002026 NM_001002231 NM_001002232 NM_001002260 NM_001002844 NM_001002860 NM_001003674 NM_001003675 NM_001004304 NM_001004348 NM_001005271 NM_001005273 NM_001005303 NM_001005387 NM_001005388 NM_001005404 NM_001005473 NM_001005609 NM_001005753 NM_001006113 NM_001006115 NM_001006624 NM_001006625 NM_001007023 NM_001007156 NM_001007188 NM_001007237 NM_001007254 NM_001007466 NM_001007542 NM_001008215 NM_001008220 NM_001008408 NM_001008493 NM_001008707 NM_001008738 NM_001009553 NM_001009610 NM_001009880 NM_001009899 NM_001009909 NM_001009913 NM_001009956 NM_001010846 NM_001010867 NM_001010888 NM_001010891 NM_001010898 NM_001010915 NM_001010924 NM_001010980 NM_001010984 NM_001011514 NM_001011554 NM_001011720 NM_001012239 NM_001012418 NM_001012420 NM_001012423 NM_001012426 NM_001012427 NM_001012454 NM_001012626 NM_001012651 NM_001012659 NM_001012753 NM_001012755 NM_001012957 NM_001012960 NM_001012981 NM_001012982 NM_001013681 NM_001013683 NM_001013685 NM_001013707 NM_001013708 NM_001013726 NM_001014380 NM_001014797 NM_001015051 NM_001015881 NM_001015886 NM_001017392 NM_001017395 NM_001017523 NM_001017915 NM_001017980 NM_001017995 NM_001018003 NM_001018037 NM_001018051 NM_001018065 NM_001018066 NM_001018072 NM_001018111 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001023563 NM_001024380 NM_001024381 NM_001024630 NM_001024688 NM_001024736 NM_001024843 NM_001025107 NM_001025108 NM_001025233 NM_001025252 NM_001025253 NM_001056 NM_001066 NM_001067 NM_001089 NM_001093 NM_001095 NM_001099 NM_001111 NM_001128 NM_001167 NM_001204 NM_001224 NM_001247 NM_001259 NM_001260 NM_001286 NM_001296 NM_001304 NM_001337 NM_001362 NM_001386 NM_001387 NM_001390 NM_001399 NM_001407 NM_001417 NM_001421 NM_001424 NM_001428 NM_001433 NM_001478 NM_001542 NM_001543 NM_001585 NM_001587 NM_001609 NM_001649 NM_001650 NM_001652 NM_001695 NM_001806 NM_001821 NM_001858 NM_001879 NM_001908 NM_001964 NM_001987 NM_002015 NM_002022 NM_002025 NM_002033 NM_002045 NM_002070 NM_002076 NM_002086 NM_002103 NM_002111 NM_002158 NM_002190 NM_002198 NM_002239 NM_002285 NM_002309 NM_002346 NM_002351 NM_002357 NM_002359 NM_002375 NM_002381 NM_002428 NM_002460 NM_002479 NM_002481 NM_002485 NM_002501 NM_002507 NM_002523 NM_002547 NM_002563 NM_002566 NM_002569 NM_002581 NM_002644 NM_002655 NM_002677 NM_002703 NM_002719 NM_002725 NM_002730 NM_002734 NM_002738 NM_002756 NM_002827 NM_002832 NM_002879 NM_002886 NM_002940 NM_002959 NM_002998 NM_003004 NM_003011 NM_003022 NM_003023 NM_003026 NM_003042 NM_003068 NM_003153 NM_003212 NM_003262 NM_003320 NM_003330 NM_003336 NM_003359 NM_003373 NM_003388 NM_003417 NM_003449 NM_003452 NM_003476 NM_003483 NM_003502 NM_003574 NM_003605 NM_003629 NM_003636 NM_003661 NM_003681 NM_003741 NM_003763 NM_003822 NM_003834 NM_003839 NM_003841 NM_003861 NM_003882 NM_003888 NM_003950 NM_003983 NM_004028 NM_004089 NM_004091 NM_004096 NM_004101 NM_004155 NM_004170 NM_004171 NM_004202 NM_004229 NM_004272 NM_004338 NM_004342 NM_004346 NM_004348 NM_004360 NM_004368 NM_004370 NM_004386 NM_004393 NM_004414 NM_004434 NM_004464 NM_004469 NM_004482 NM_004485 NM_004513 NM_004535 NM_004586 NM_004598 NM_004612 NM_004618 NM_004619 NM_004711 NM_004713 NM_004734 NM_004745 NM_004762 NM_004788 NM_004804 NM_004827 NM_004845 NM_004866 NM_004914 NM_004947 NM_004992 NM_005036 NM_005038 NM_005076 NM_005079 NM_005094 NM_005105 NM_005140 NM_005148 NM_005197 NM_005202 NM_005233 NM_005253 NM_005263 NM_005318 NM_005324 NM_005329 NM_005338 NM_005397 NM_005399 NM_005417 NM_005420 NM_005475 NM_005476 NM_005491 NM_005500 NM_005504 NM_005541 NM_005551 NM_005578 NM_005610 NM_005656 NM_005665 NM_005668 NM_005692 NM_005729 NM_005730 NM_005768 NM_005772 NM_005775 NM_005779 NM_005829 NM_005831 NM_005840 NM_005852 NM_005859 NM_005876 NM_005909 NM_005933 NM_005935 NM_005981 NM_006047 NM_006069 NM_006139 NM_006187 NM_006203 NM_006212 NM_006224 NM_006235 NM_006242 NM_006283 NM_006288 NM_006289 NM_006293 NM_006306 NM_006328 NM_006393 NM_006452 NM_006459 NM_006474 NM_006481 NM_006493 NM_006505 NM_006555 NM_006572 NM_006599 NM_006620 NM_006624 NM_006640 NM_006650 NM_006699 NM_006729 NM_006738 NM_006742 NM_006809 NM_006827 NM_006875 NM_006888 NM_006940 NM_006990 NM_006996 NM_007006 NM_007011 NM_007050 NM_007150 NM_007175 NM_007176 NM_007200 NM_007225 NM_007236 NM_007306 NM_012095 NM_012120 NM_012215 NM_012232 NM_012288 NM_012300 NM_012306 NM_012455 NM_013243 NM_013255 NM_013276 NM_013286 NM_013309 NM_013372 NM_013375 NM_013402 NM_013447 NM_013449 NM_013989 NM_014000 NM_014035 NM_014048 NM_014106 NM_014112 NM_014155 NM_014213 NM_014289 NM_014293 NM_014342 NM_014388 NM_014396 NM_014444 NM_014450 NM_014456 NM_014553 NM_014586 NM_014616 NM_014636 NM_014668 NM_014702 NM_014729 NM_014730 NM_014732 NM_014742 NM_014746 NM_014755 NM_014766 NM_014772 NM_014774 NM_014788 NM_014799 NM_014801 NM_014835 NM_014840 NM_014850 NM_014858 NM_014860 NM_014867 NM_014870 NM_014888 NM_014901 NM_014909 NM_014924 NM_014934 NM_014953 NM_014965 NM_014969 NM_015008 NM_015032 NM_015033 NM_015035 NM_015056 NM_015079 NM_015088 NM_015090 NM_015094 NM_015107 NM_015143 NM_015144 NM_015149 NM_015161 NM_015185 NM_015206 NM_015215 NM_015226 NM_015245 NM_015253 NM_015260 NM_015264 NM_015266 NM_015267 NM_015278 NM_015292 NM_015313 NM_015336 NM_015338 NM_015344 NM_015353 NM_015526 NM_015557 NM_015564 NM_015568 NM_015595 NM_015602 NM_015609 NM_015683 NM_015686 NM_015713 NM_015836 NM_015840 NM_015841 NM_015896 NM_015964 NM_015981 NM_015986 NM_016000 NM_016016 NM_016076 NM_016079 NM_016081 NM_016083 NM_016114 NM_016132 NM_016138 NM_016140 NM_016173 NM_016206 NM_016210 NM_016272 NM_016369 NM_016418 NM_016479 NM_016532 NM_016575 NM_016577 NM_016592 NM_016598 NM_016605 NM_017413 NM_017456 NM_017488 NM_017555 NM_017582 NM_017584 NM_017592 NM_017628 NM_017644 NM_017645 NM_017656 NM_017666 NM_017709 NM_017761 NM_017765 NM_017772 NM_017849 NM_017873 NM_017991 NM_018045 NM_018108 NM_018129 NM_018170 NM_018194 NM_018201 NM_018212 NM_018214 NM_018215 NM_018241 NM_018257 NM_018265 NM_018299 NM_018316 NM_018340 NM_018362 NM_018367 NM_018370 NM_018374 NM_018440 NM_018462 NM_018482 NM_018644 NM_018662 NM_018708 NM_018727 NM_018728 NM_018840 NM_018841 NM_018931 NM_018947 NM_018990 NM_018992 NM_018999 NM_019008 NM_019036 NM_019063 NM_019094 NM_019098 NM_020039 NM_020161 NM_020184 NM_020227 NM_020228 NM_020243 NM_020245 NM_020335 NM_020390 NM_020405 NM_020422 NM_020425 NM_020438 NM_020452 NM_020666 NM_020673 NM_020686 NM_020699 NM_020708 NM_020714 NM_020724 NM_020739 NM_020746 NM_020776 NM_020810 NM_020813 NM_020826 NM_020844 NM_020850 NM_020853 NM_020897 NM_020917 NM_020921 NM_020956 NM_020957 NM_021079 NM_021106 NM_021116 NM_021140 NM_021255 NM_021615 NM_021635 NM_021735 NM_021736 NM_021737 NM_021812 NM_021813 NM_021950 NM_021957 NM_021960 NM_021961 NM_022042 NM_022080 NM_022104 NM_022114 NM_022133 NM_022154 NM_022169 NM_022452 NM_022482 NM_022491 NM_022492 NM_022493 NM_022570 NM_022754 NM_022818 NM_022824 NM_022829 NM_022895 NM_022898 NM_022915 NM_023009 NM_023112 NM_023930 NM_023938 NM_024335 NM_024511 NM_024513 NM_024627 NM_024665 NM_024674 NM_024677 NM_024685 NM_024687 NM_024698 NM_024726 NM_024749 NM_024807 NM_024833 NM_024834 NM_024866 NM_024875 NM_024918 NM_024930 NM_025026 NM_025030 NM_025057 NM_025106 NM_025112 NM_025125 NM_025160 NM_025208 NM_025214 NM_025240 NM_030569 NM_030625 NM_030655 NM_030781 NM_030782 NM_030798 NM_030806 NM_030817 NM_030884 NM_030885 NM_030918 NM_030919 NM_030934 NM_031215 NM_031281 NM_031426 NM_031435 NM_031445 NM_031449 NM_031462 NM_031476 NM_031866 NM_031892 NM_031911 NM_031912 NM_031940 NM_032010 NM_032046 NM_032104 NM_032105 NM_032116 NM_032121 NM_032153 NM_032175 NM_032213 NM_032294 NM_032316 NM_032421 NM_032431 NM_032432 NM_032558 NM_032638 NM_032682 NM_032711 NM_032728 NM_032740 NM_032797 NM_032804 NM_032817 NM_032826 NM_032834 NM_032947 NM_032975 NM_032980 NM_032982 NM_032983 NM_032984 NM_032991 NM_033048 NM_033100 NM_033133 NM_033135 NM_033138 NM_033139 NM_033140 NM_033141 NM_033143 NM_033157 NM_033161 NM_033181 NM_033207 NM_033221 NM_033224 NM_033285 NM_033305 NM_033332 NM_033346 NM_033364 NM_033393 NM_033394 NM_033410 NM_033421 NM_033426 NM_033446 NM_033512 NM_033631 NM_033644 NM_033645 NM_033656 NM_052822 NM_052832 NM_052847 NM_052851 NM_052884 NM_052919 NM_052934 NM_052966 NM_052996 NM_053279 NM_053286 NM_054025 NM_054035 NM_058175 NM_058178 NM_078470 NM_078473 NM_078483 NM_080588 NM_080589 NM_080645 NM_080654 NM_080664 NM_080704 NM_080705 NM_080706 NM_080738 NM_080836 NM_080862 NM_080867 NM_080876 NM_130385 NM_130446 NM_130766 NM_130786 NM_130795 NM_133170 NM_133274 NM_133371 NM_133372 NM_133445 NM_133463 NM_133496 NM_133632 NM_133633 NM_133646 NM_134325 NM_134422 NM_134423 NM_134424 NM_134427 NM_134433 NM_138287 NM_138298 NM_138342 NM_138348 NM_138373 NM_138402 NM_138444 NM_138447 NM_138457 NM_138468 NM_138566 NM_138576 NM_138694 NM_138713 NM_138714 NM_138726 NM_138737 NM_138768 NM_138775 NM_138782 NM_139279 NM_144488 NM_144489 NM_144498 NM_144721 NM_144767 NM_145059 NM_145109 NM_145110 NM_145115 NM_145234 NM_145251 NM_145293 NM_145307 NM_145341 NM_145343 NM_145351 NM_145734 NM_145735 NM_145754 NM_145759 NM_145808 NM_145861 NM_147129 NM_147780 NM_147781 NM_147782 NM_147783 NM_148171 NM_148957 NM_152235 NM_152247 NM_152253 NM_152289 NM_152306 NM_152309 NM_152321 NM_152322 NM_152330 NM_152357 NM_152407 NM_152439 NM_152475 NM_152515 NM_152519 NM_152547 NM_152557 NM_152624 NM_152636 NM_152641 NM_152753 NM_152776 NM_152793 NM_152831 NM_152836 NM_152837 NM_152838 NM_152866 NM_152897 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152945 NM_152989 NM_152996 NM_153029 NM_153031 NM_153045 NM_153255 NM_153262 NM_153273 NM_153463 NM_153487 NM_153646 NM_153647 NM_153648 NM_153705 NM_153837 NM_170601 NM_170607 NM_170696 NM_170697 NM_170716 NM_170717 NM_171825 NM_171998 NM_172000 NM_172037 NM_172130 NM_172206 NM_172217 NM_172230 NM_172239 NM_172367 NM_173214 NM_173459 NM_173462 NM_173468 NM_173478 NM_173536 NM_173551 NM_173558 NM_173602 NM_173675 NM_173683 NM_173833 NM_173851 NM_173854 NM_174929 NM_174934 NM_175053 NM_175078 NM_175736 NM_175747 NM_175767 NM_175883 NM_175921 NM_176825 NM_177442 NM_177972 NM_177978 NM_177979 NM_177999 NM_178006 NM_178007 NM_178010 NM_178034 NM_178151 NM_178152 NM_178153 NM_178172 NM_178191 NM_178423 NM_178470 NM_178505 NM_178509 NM_178514 NM_178516 NM_178539 NM_178583 NM_178586 NM_181050 NM_181359 NM_181481 NM_181482 NM_181483 NM_181489 NM_181504 NM_181523 NM_181524 NM_181654 NM_181724 NM_181762 NM_181776 NM_181777 NM_181789 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181834 NM_181835 NM_181844 NM_182503 NM_182510 NM_182540 NM_182548 NM_182562 NM_182568 NM_182578 NM_182584 NM_182700 NM_182729 NM_182742 NM_182743 NM_182752 NM_182763 NM_182775 NM_182966 NM_183337 NM_194071 NM_194298 NM_194303 NM_194310 NM_194317 NM_194352 NM_194434 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197977 NM_198057 NM_198204 NM_198205 NM_198291 NM_198389 NM_198447 NM_198452 NM_198460 NM_198476 NM_198484 NM_198499 NM_198501 NM_198512 NM_198562 NM_198565 NM_198582 NM_198835 NM_198900 NM_198956 NM_198968 NM_199040 NM_199050 NM_199421 NM_199423 NM_199437 NM_199438 NM_199439 NM_199454 NM_199461 NM_199484 NM_199485 NM_201263 NM_201277 NM_201348 NM_203329 NM_203330 NM_203331 NM_203395 NM_203417 NM_203418 NM_203446 NM_203506 NM_205857 NM_205860 NM_206889 NM_206933 NM_207012 NM_207325 NM_207335 NM_207372 NM_207404 NM_207419 NM_207434 NM_207445 NM_207463 NM_207474 NM_207503 NM_207504 NM_207511 NM_207518 NM_207582 NM_207646 NM_212471 NM_212472 NM_213589 NM_213596 NM_213613 NM_213723 XM_027307 XM_031104 XM_032901 XM_032945 XM_037557 XM_038150 XM_038436 XM_039570 XM_040592 XM_042301 XM_042698 XM_042833 XM_042936 XM_043493 XM_044062 XM_047357 XM_047995 XM_048592 XM_048898 XM_057107 XM_059689 XM_059929 XM_113947 XM_114303 XM_167044 XM_171054 XM_208990 XM_210826 XM_290734 XM_291262 XM_291344 XM_294765 XM_296817 XM_350880 XM_370756 XM_370837 XM_370839 XM_370840 XM_370843 XM_370878 XM_370917 XM_370928 XM_370932 XM_371074 XM_371116 XM_371214 XM_371461 XM_371488 XM_371542 XM_371617 XM_371783 XM_372097 XM_374020 XM_374317 XM_374880 XM_374983 XM_375152 XM_375292 XM_375373 XM_375606 XM_375669 XM_376018 XM_376049 XM_376269 XM_376278 XM_376560 XM_376586 XM_376680 XM_376720 XM_376784 XM_378203 XM_378250 XM_378273 XM_378301 XM_378312 XM_378321 XM_378327 XM_378329 XM_378389 XM_378394 XM_378453 XM_378567 XM_378608 XM_378620 XM_378678 XM_378747 XM_378825 XM_378886 XM_378914 XM_379068 XM_379079 XM_379094 XM_379141 XM_379154 XM_379235 XM_379243 XM_379267 XM_379273 XM_379324 XM_379355 XM_379391 XM_379398 XM_379432 XM_379437 XM_379458 XM_379535 XM_379594 XM_379595 XM_379622 XM_379629 XM_379634 XM_379656 XM_379665 XM_379798 XM_379934 XM_379967 XM_380160 XM_495807 XM_495886 XM_495888 XM_495909 XM_496048 XM_496088 XM_496134 XM_496328 XM_496351 XM_496519 XM_496539 XM_496692 XM_496877 XM_496983 XM_496984 XM_496985 XM_497002 XM_497080 XM_498452 XM_498540 XM_498545 XM_498555 XM_498614 XM_498649 XM_498662 XM_498831 XM_498835 XM_499047 XM_499056 XM_499074 XM_499309 XM_499503 XM_499528 XR_000182 XR_000184 XR_000190 XR_000195 XR_000227 XR_000261 XR_000292 XR_000294
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)