VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacuccuggaacaauggaacc"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
5043
.
Total Genes with multiple seed matches:
1069
.
Genes with at least one seed match:
NM_000023 NM_000031 NM_000038 NM_000043 NM_000046 NM_000071 NM_000078 NM_000079 NM_000091 NM_000092 NM_000097 NM_000107 NM_000109 NM_000111 NM_000112 NM_000118 NM_000121 NM_000127 NM_000132 NM_000133 NM_000135 NM_000148 NM_000149 NM_000151 NM_000153 NM_000176 NM_000177 NM_000187 NM_000188 NM_000208 NM_000210 NM_000214 NM_000216 NM_000221 NM_000222 NM_000230 NM_000237 NM_000240 NM_000242 NM_000250 NM_000254 NM_000264 NM_000266 NM_000272 NM_000275 NM_000276 NM_000292 NM_000303 NM_000319 NM_000324 NM_000332 NM_000335 NM_000345 NM_000348 NM_000350 NM_000355 NM_000356 NM_000362 NM_000365 NM_000367 NM_000382 NM_000386 NM_000387 NM_000391 NM_000410 NM_000417 NM_000418 NM_000428 NM_000429 NM_000437 NM_000438 NM_000442 NM_000453 NM_000457 NM_000462 NM_000466 NM_000478 NM_000486 NM_000492 NM_000497 NM_000498 NM_000506 NM_000510 NM_000537 NM_000545 NM_000555 NM_000567 NM_000575 NM_000585 NM_000587 NM_000599 NM_000602 NM_000605 NM_000607 NM_000608 NM_000611 NM_000618 NM_000620 NM_000621 NM_000625 NM_000627 NM_000629 NM_000632 NM_000633 NM_000634 NM_000635 NM_000661 NM_000664 NM_000666 NM_000670 NM_000671 NM_000682 NM_000687 NM_000692 NM_000695 NM_000701 NM_000709 NM_000714 NM_000721 NM_000723 NM_000726 NM_000727 NM_000749 NM_000750 NM_000778 NM_000787 NM_000790 NM_000791 NM_000793 NM_000795 NM_000806 NM_000807 NM_000809 NM_000827 NM_000828 NM_000835 NM_000836 NM_000838 NM_000844 NM_000858 NM_000859 NM_000861 NM_000870 NM_000873 NM_000891 NM_000898 NM_000899 NM_000901 NM_000909 NM_000914 NM_000916 NM_000922 NM_000929 NM_000934 NM_000950 NM_000956 NM_000959 NM_000960 NM_000961 NM_000962 NM_000991 NM_000997 NM_000999 NM_001001331 NM_001001346 NM_001001411 NM_001001417 NM_001001418 NM_001001419 NM_001001420 NM_001001484 NM_001001485 NM_001001486 NM_001001487 NM_001001522 NM_001001557 NM_001001586 NM_001001664 NM_001001669 NM_001001671 NM_001001686 NM_001001692 NM_001001695 NM_001001703 NM_001001704 NM_001001707 NM_001001709 NM_001001723 NM_001001791 NM_001001794 NM_001001870 NM_001001871 NM_001001873 NM_001001878 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001938 NM_001002026 NM_001002032 NM_001002033 NM_001002231 NM_001002232 NM_001002257 NM_001002260 NM_001002758 NM_001002760 NM_001002761 NM_001002836 NM_001002843 NM_001002861 NM_001002881 NM_001002909 NM_001002914 NM_001003406 NM_001003407 NM_001003408 NM_001003665 NM_001003674 NM_001003675 NM_001003689 NM_001003725 NM_001003786 NM_001003787 NM_001003788 NM_001003796 NM_001003805 NM_001003819 NM_001003827 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001003954 NM_001004053 NM_001004128 NM_001004285 NM_001004286 NM_001004298 NM_001004299 NM_001004300 NM_001004302 NM_001004306 NM_001004308 NM_001004313 NM_001004315 NM_001004322 NM_001004339 NM_001004348 NM_001004349 NM_001004419 NM_001004420 NM_001004433 NM_001004439 NM_001004720 NM_001004722 NM_001005340 NM_001005354 NM_001005355 NM_001005356 NM_001005357 NM_001005375 NM_001005387 NM_001005388 NM_001005404 NM_001005415 NM_001005416 NM_001005463 NM_001005474 NM_001005498 NM_001005505 NM_001005609 NM_001005735 NM_001005737 NM_001005746 NM_001005747 NM_001005751 NM_001005766 NM_001005785 NM_001005786 NM_001006113 NM_001006114 NM_001006115 NM_001006600 NM_001006604 NM_001006615 NM_001006623 NM_001006624 NM_001006625 NM_001006641 NM_001006642 NM_001006643 NM_001006656 NM_001006657 NM_001006665 NM_001006943 NM_001007023 NM_001007024 NM_001007025 NM_001007033 NM_001007075 NM_001007094 NM_001007156 NM_001007169 NM_001007224 NM_001007231 NM_001007237 NM_001007246 NM_001007254 NM_001007258 NM_001007262 NM_001007267 NM_001007277 NM_001007529 NM_001007534 NM_001007536 NM_001007543 NM_001007559 NM_001007565 NM_001007794 NM_001008215 NM_001008390 NM_001008392 NM_001008406 NM_001008408 NM_001008493 NM_001008529 NM_001008540 NM_001008563 NM_001008656 NM_001008693 NM_001008701 NM_001008710 NM_001008711 NM_001008736 NM_001008738 NM_001008742 NM_001008756 NM_001008781 NM_001008860 NM_001008892 NM_001008894 NM_001008910 NM_001009553 NM_001009555 NM_001009883 NM_001009913 NM_001009921 NM_001009923 NM_001009924 NM_001009925 NM_001009932 NM_001009933 NM_001009934 NM_001009956 NM_001009959 NM_001009992 NM_001009996 NM_001009997 NM_001010000 NM_001010846 NM_001010850 NM_001010851 NM_001010853 NM_001010862 NM_001010866 NM_001010882 NM_001010888 NM_001010891 NM_001010898 NM_001010913 NM_001010923 NM_001010924 NM_001010934 NM_001010974 NM_001010977 NM_001010978 NM_001010982 NM_001011513 NM_001011514 NM_001011539 NM_001011545 NM_001011656 NM_001011663 NM_001011664 NM_001011666 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011713 NM_001011718 NM_001011880 NM_001012274 NM_001012329 NM_001012339 NM_001012361 NM_001012393 NM_001012398 NM_001012414 NM_001012418 NM_001012420 NM_001012423 NM_001012426 NM_001012427 NM_001012509 NM_001012514 NM_001012516 NM_001012614 NM_001012642 NM_001012659 NM_001012707 NM_001012711 NM_001012714 NM_001012715 NM_001012729 NM_001012733 NM_001012734 NM_001012755 NM_001012756 NM_001012761 NM_001012957 NM_001012958 NM_001012960 NM_001012968 NM_001012969 NM_001012980 NM_001012985 NM_001012986 NM_001012987 NM_001012993 NM_001013031 NM_001013399 NM_001013415 NM_001013437 NM_001013622 NM_001013625 NM_001013627 NM_001013629 NM_001013633 NM_001013634 NM_001013637 NM_001013645 NM_001013652 NM_001013656 NM_001013666 NM_001013669 NM_001013674 NM_001013675 NM_001013677 NM_001013681 NM_001013682 NM_001013685 NM_001013687 NM_001013690 NM_001013693 NM_001013697 NM_001013710 NM_001013717 NM_001013721 NM_001013724 NM_001013727 NM_001013839 NM_001013840 NM_001013842 NM_001014374 NM_001014431 NM_001014432 NM_001014765 NM_001014797 NM_001014812 NM_001014975 NM_001014987 NM_001014988 NM_001014989 NM_001015047 NM_001015048 NM_001015049 NM_001015051 NM_001015055 NM_001015056 NM_001015877 NM_001015883 NM_001015886 NM_001017371 NM_001017395 NM_001017396 NM_001017420 NM_001017423 NM_001017440 NM_001017524 NM_001017916 NM_001017917 NM_001017918 NM_001017922 NM_001017926 NM_001017956 NM_001017957 NM_001017958 NM_001017965 NM_001017972 NM_001017980 NM_001017989 NM_001017995 NM_001018009 NM_001018029 NM_001018038 NM_001018055 NM_001018058 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018078 NM_001018080 NM_001018082 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018100 NM_001018101 NM_001018104 NM_001018111 NM_001023565 NM_001024094 NM_001024226 NM_001024227 NM_001024228 NM_001024401 NM_001024457 NM_001024460 NM_001024463 NM_001024592 NM_001024593 NM_001024630 NM_001024631 NM_001024646 NM_001024654 NM_001024657 NM_001024660 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024680 NM_001024688 NM_001024732 NM_001024733 NM_001024736 NM_001024808 NM_001024843 NM_001024847 NM_001024855 NM_001024921 NM_001025076 NM_001025077 NM_001025091 NM_001025096 NM_001025097 NM_001025100 NM_001025193 NM_001025242 NM_001025243 NM_001025252 NM_001025253 NM_001043 NM_001049 NM_001058 NM_001068 NM_001069 NM_001090 NM_001092 NM_001093 NM_001094 NM_001095 NM_001099 NM_001101 NM_001103 NM_001117 NM_001123 NM_001128 NM_001146 NM_001147 NM_001160 NM_001164 NM_001178 NM_001186 NM_001197 NM_001205 NM_001211 NM_001215 NM_001218 NM_001222 NM_001227 NM_001230 NM_001234 NM_001249 NM_001256 NM_001257 NM_001268 NM_001271 NM_001275 NM_001286 NM_001295 NM_001296 NM_001298 NM_001302 NM_001303 NM_001304 NM_001310 NM_001319 NM_001328 NM_001331 NM_001337 NM_001343 NM_001351 NM_001361 NM_001363 NM_001386 NM_001387 NM_001390 NM_001393 NM_001396 NM_001399 NM_001406 NM_001417 NM_001421 NM_001423 NM_001429 NM_001430 NM_001432 NM_001447 NM_001449 NM_001454 NM_001455 NM_001457 NM_001460 NM_001480 NM_001481 NM_001490 NM_001491 NM_001497 NM_001518 NM_001519 NM_001520 NM_001530 NM_001534 NM_001537 NM_001538 NM_001542 NM_001547 NM_001557 NM_001561 NM_001569 NM_001584 NM_001585 NM_001587 NM_001605 NM_001608 NM_001609 NM_001617 NM_001620 NM_001622 NM_001624 NM_001628 NM_001630 NM_001632 NM_001634 NM_001648 NM_001655 NM_001658 NM_001668 NM_001674 NM_001679 NM_001681 NM_001683 NM_001695 NM_001698 NM_001701 NM_001703 NM_001716 NM_001720 NM_001723 NM_001735 NM_001745 NM_001748 NM_001753 NM_001761 NM_001766 NM_001781 NM_001793 NM_001795 NM_001796 NM_001806 NM_001824 NM_001829 NM_001831 NM_001860 NM_001897 NM_001901 NM_001904 NM_001906 NM_001908 NM_001915 NM_001935 NM_001937 NM_001938 NM_001941 NM_001946 NM_001948 NM_001949 NM_001950 NM_001962 NM_001975 NM_001982 NM_001987 NM_001990 NM_002015 NM_002017 NM_002019 NM_002023 NM_002025 NM_002030 NM_002033 NM_002039 NM_002053 NM_002060 NM_002080 NM_002081 NM_002086 NM_002095 NM_002098 NM_002103 NM_002111 NM_002116 NM_002119 NM_002130 NM_002141 NM_002142 NM_002148 NM_002150 NM_002168 NM_002182 NM_002196 NM_002205 NM_002207 NM_002209 NM_002217 NM_002218 NM_002223 NM_002225 NM_002232 NM_002242 NM_002245 NM_002246 NM_002251 NM_002254 NM_002267 NM_002293 NM_002296 NM_002298 NM_002304 NM_002308 NM_002309 NM_002312 NM_002313 NM_002317 NM_002335 NM_002340 NM_002345 NM_002349 NM_002355 NM_002357 NM_002377 NM_002380 NM_002382 NM_002384 NM_002387 NM_002396 NM_002401 NM_002404 NM_002408 NM_002416 NM_002417 NM_002419 NM_002427 NM_002429 NM_002435 NM_002437 NM_002442 NM_002444 NM_002451 NM_002460 NM_002468 NM_002469 NM_002480 NM_002481 NM_002483 NM_002485 NM_002489 NM_002499 NM_002507 NM_002510 NM_002520 NM_002526 NM_002545 NM_002547 NM_002556 NM_002562 NM_002576 NM_002577 NM_002579 NM_002581 NM_002596 NM_002610 NM_002613 NM_002622 NM_002631 NM_002637 NM_002640 NM_002648 NM_002655 NM_002657 NM_002665 NM_002677 NM_002702 NM_002714 NM_002716 NM_002718 NM_002719 NM_002723 NM_002725 NM_002736 NM_002737 NM_002742 NM_002745 NM_002747 NM_002752 NM_002753 NM_002760 NM_002783 NM_002787 NM_002793 NM_002801 NM_002825 NM_002826 NM_002829 NM_002834 NM_002835 NM_002856 NM_002859 NM_002860 NM_002862 NM_002868 NM_002869 NM_002872 NM_002877 NM_002880 NM_002886 NM_002890 NM_002898 NM_002904 NM_002909 NM_002913 NM_002918 NM_002928 NM_002940 NM_002953 NM_002959 NM_002973 NM_002998 NM_003003 NM_003004 NM_003010 NM_003011 NM_003012 NM_003016 NM_003023 NM_003029 NM_003030 NM_003032 NM_003033 NM_003036 NM_003037 NM_003038 NM_003043 NM_003044 NM_003045 NM_003047 NM_003048 NM_003071 NM_003074 NM_003076 NM_003083 NM_003090 NM_003101 NM_003107 NM_003108 NM_003111 NM_003119 NM_003121 NM_003124 NM_003129 NM_003130 NM_003139 NM_003144 NM_003147 NM_003164 NM_003165 NM_003168 NM_003173 NM_003174 NM_003177 NM_003179 NM_003184 NM_003185 NM_003186 NM_003188 NM_003193 NM_003196 NM_003200 NM_003216 NM_003222 NM_003236 NM_003239 NM_003240 NM_003242 NM_003244 NM_003246 NM_003247 NM_003252 NM_003254 NM_003255 NM_003257 NM_003262 NM_003270 NM_003274 NM_003281 NM_003298 NM_003319 NM_003324 NM_003330 NM_003339 NM_003342 NM_003343 NM_003344 NM_003348 NM_003349 NM_003363 NM_003370 NM_003391 NM_003392 NM_003393 NM_003404 NM_003407 NM_003413 NM_003421 NM_003423 NM_003429 NM_003436 NM_003439 NM_003443 NM_003454 NM_003456 NM_003458 NM_003462 NM_003463 NM_003467 NM_003472 NM_003474 NM_003478 NM_003479 NM_003483 NM_003486 NM_003488 NM_003494 NM_003498 NM_003507 NM_003528 NM_003549 NM_003557 NM_003568 NM_003574 NM_003576 NM_003581 NM_003597 NM_003605 NM_003609 NM_003617 NM_003622 NM_003624 NM_003634 NM_003644 NM_003648 NM_003661 NM_003663 NM_003671 NM_003672 NM_003673 NM_003677 NM_003679 NM_003681 NM_003683 NM_003684 NM_003685 NM_003691 NM_003692 NM_003696 NM_003701 NM_003704 NM_003708 NM_003710 NM_003724 NM_003732 NM_003745 NM_003749 NM_003751 NM_003758 NM_003759 NM_003762 NM_003774 NM_003786 NM_003798 NM_003799 NM_003800 NM_003803 NM_003808 NM_003812 NM_003822 NM_003824 NM_003831 NM_003842 NM_003847 NM_003855 NM_003856 NM_003861 NM_003882 NM_003885 NM_003891 NM_003893 NM_003895 NM_003897 NM_003901 NM_003904 NM_003907 NM_003909 NM_003913 NM_003921 NM_003929 NM_003930 NM_003939 NM_003941 NM_003943 NM_003949 NM_003950 NM_003953 NM_003955 NM_003958 NM_003966 NM_003976 NM_003981 NM_003985 NM_003994 NM_003996 NM_003999 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004024 NM_004030 NM_004036 NM_004037 NM_004043 NM_004050 NM_004059 NM_004072 NM_004080 NM_004081 NM_004090 NM_004091 NM_004093 NM_004094 NM_004105 NM_004107 NM_004112 NM_004114 NM_004117 NM_004129 NM_004145 NM_004147 NM_004155 NM_004162 NM_004171 NM_004172 NM_004197 NM_004210 NM_004213 NM_004227 NM_004232 NM_004238 NM_004245 NM_004252 NM_004253 NM_004258 NM_004263 NM_004274 NM_004278 NM_004283 NM_004293 NM_004297 NM_004302 NM_004306 NM_004311 NM_004319 NM_004321 NM_004326 NM_004338 NM_004348 NM_004361 NM_004364 NM_004367 NM_004370 NM_004375 NM_004376 NM_004380 NM_004385 NM_004387 NM_004392 NM_004393 NM_004394 NM_004397 NM_004401 NM_004411 NM_004426 NM_004433 NM_004437 NM_004438 NM_004440 NM_004444 NM_004450 NM_004454 NM_004455 NM_004457 NM_004464 NM_004483 NM_004487 NM_004488 NM_004501 NM_004504 NM_004505 NM_004513 NM_004514 NM_004527 NM_004531 NM_004535 NM_004537 NM_004544 NM_004549 NM_004553 NM_004554 NM_004557 NM_004560 NM_004566 NM_004575 NM_004578 NM_004586 NM_004588 NM_004589 NM_004598 NM_004612 NM_004621 NM_004622 NM_004624 NM_004627 NM_004637 NM_004650 NM_004657 NM_004661 NM_004665 NM_004667 NM_004673 NM_004676 NM_004678 NM_004681 NM_004687 NM_004710 NM_004711 NM_004715 NM_004723 NM_004724 NM_004728 NM_004729 NM_004730 NM_004734 NM_004736 NM_004742 NM_004744 NM_004745 NM_004747 NM_004748 NM_004759 NM_004763 NM_004764 NM_004767 NM_004773 NM_004776 NM_004779 NM_004781 NM_004788 NM_004796 NM_004797 NM_004801 NM_004808 NM_004815 NM_004827 NM_004834 NM_004843 NM_004844 NM_004845 NM_004848 NM_004850 NM_004855 NM_004862 NM_004864 NM_004866 NM_004871 NM_004873 NM_004877 NM_004879 NM_004884 NM_004892 NM_004896 NM_004898 NM_004904 NM_004921 NM_004925 NM_004934 NM_004936 NM_004946 NM_004948 NM_004956 NM_004957 NM_004960 NM_004961 NM_004963 NM_004972 NM_004973 NM_004974 NM_004975 NM_004978 NM_004982 NM_004985 NM_004993 NM_004996 NM_004997 NM_005008 NM_005018 NM_005036 NM_005042 NM_005044 NM_005046 NM_005047 NM_005054 NM_005065 NM_005066 NM_005070 NM_005076 NM_005079 NM_005082 NM_005093 NM_005094 NM_005098 NM_005100 NM_005105 NM_005108 NM_005109 NM_005116 NM_005121 NM_005122 NM_005124 NM_005127 NM_005137 NM_005151 NM_005157 NM_005161 NM_005163 NM_005177 NM_005188 NM_005190 NM_005197 NM_005202 NM_005206 NM_005207 NM_005226 NM_005233 NM_005238 NM_005242 NM_005249 NM_005253 NM_005262 NM_005264 NM_005266 NM_005277 NM_005296 NM_005301 NM_005308 NM_005313 NM_005324 NM_005333 NM_005334 NM_005338 NM_005339 NM_005349 NM_005368 NM_005374 NM_005386 NM_005387 NM_005388 NM_005397 NM_005399 NM_005402 NM_005407 NM_005417 NM_005419 NM_005431 NM_005433 NM_005436 NM_005442 NM_005446 NM_005452 NM_005458 NM_005472 NM_005479 NM_005486 NM_005491 NM_005493 NM_005495 NM_005502 NM_005505 NM_005506 NM_005536 NM_005545 NM_005546 NM_005551 NM_005569 NM_005572 NM_005582 NM_005600 NM_005602 NM_005611 NM_005626 NM_005629 NM_005630 NM_005637 NM_005639 NM_005647 NM_005658 NM_005662 NM_005668 NM_005678 NM_005687 NM_005693 NM_005697 NM_005698 NM_005715 NM_005721 NM_005729 NM_005730 NM_005731 NM_005737 NM_005738 NM_005739 NM_005742 NM_005763 NM_005765 NM_005768 NM_005779 NM_005807 NM_005808 NM_005813 NM_005816 NM_005819 NM_005824 NM_005828 NM_005832 NM_005835 NM_005836 NM_005839 NM_005840 NM_005859 NM_005862 NM_005870 NM_005871 NM_005883 NM_005885 NM_005896 NM_005902 NM_005903 NM_005908 NM_005910 NM_005915 NM_005920 NM_005923 NM_005926 NM_005930 NM_005933 NM_005935 NM_005957 NM_005959 NM_005969 NM_005971 NM_005973 NM_005990 NM_005994 NM_005995 NM_005999 NM_006005 NM_006018 NM_006020 NM_006030 NM_006033 NM_006043 NM_006045 NM_006047 NM_006055 NM_006061 NM_006065 NM_006070 NM_006074 NM_006076 NM_006089 NM_006090 NM_006096 NM_006106 NM_006108 NM_006114 NM_006116 NM_006117 NM_006122 NM_006133 NM_006138 NM_006141 NM_006145 NM_006147 NM_006148 NM_006160 NM_006162 NM_006163 NM_006166 NM_006167 NM_006178 NM_006180 NM_006184 NM_006187 NM_006190 NM_006201 NM_006203 NM_006206 NM_006210 NM_006212 NM_006213 NM_006216 NM_006224 NM_006235 NM_006242 NM_006251 NM_006252 NM_006253 NM_006255 NM_006258 NM_006259 NM_006265 NM_006266 NM_006275 NM_006281 NM_006282 NM_006283 NM_006291 NM_006293 NM_006298 NM_006306 NM_006312 NM_006315 NM_006321 NM_006325 NM_006335 NM_006359 NM_006361 NM_006371 NM_006377 NM_006378 NM_006380 NM_006382 NM_006386 NM_006397 NM_006403 NM_006407 NM_006411 NM_006418 NM_006419 NM_006421 NM_006454 NM_006457 NM_006459 NM_006462 NM_006466 NM_006469 NM_006474 NM_006480 NM_006481 NM_006488 NM_006493 NM_006517 NM_006520 NM_006521 NM_006526 NM_006538 NM_006544 NM_006546 NM_006547 NM_006549 NM_006557 NM_006558 NM_006561 NM_006578 NM_006591 NM_006593 NM_006597 NM_006599 NM_006601 NM_006602 NM_006615 NM_006620 NM_006621 NM_006622 NM_006631 NM_006635 NM_006670 NM_006675 NM_006676 NM_006690 NM_006695 NM_006699 NM_006706 NM_006717 NM_006720 NM_006721 NM_006730 NM_006734 NM_006738 NM_006742 NM_006747 NM_006748 NM_006753 NM_006763 NM_006767 NM_006774 NM_006777 NM_006783 NM_006785 NM_006803 NM_006809 NM_006811 NM_006812 NM_006820 NM_006834 NM_006836 NM_006852 NM_006855 NM_006858 NM_006867 NM_006869 NM_006874 NM_006884 NM_006898 NM_006908 NM_006909 NM_006915 NM_006916 NM_006952 NM_006961 NM_006965 NM_006981 NM_006984 NM_006987 NM_006990 NM_006995 NM_007006 NM_007010 NM_007011 NM_007017 NM_007028 NM_007049 NM_007050 NM_007051 NM_007064 NM_007106 NM_007115 NM_007145 NM_007146 NM_007147 NM_007148 NM_007150 NM_007156 NM_007157 NM_007167 NM_007169 NM_007170 NM_007171 NM_007173 NM_007174 NM_007175 NM_007178 NM_007190 NM_007194 NM_007200 NM_007203 NM_007208 NM_007216 NM_007222 NM_007231 NM_007236 NM_007249 NM_007257 NM_007271 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007308 NM_007311 NM_007313 NM_007319 NM_007325 NM_007331 NM_007335 NM_007336 NM_007338 NM_007342 NM_007353 NM_007368 NM_007370 NM_007375 NM_009587 NM_012062 NM_012072 NM_012073 NM_012076 NM_012080 NM_012091 NM_012092 NM_012096 NM_012098 NM_012105 NM_012106 NM_012119 NM_012121 NM_012134 NM_012146 NM_012158 NM_012184 NM_012192 NM_012200 NM_012204 NM_012211 NM_012215 NM_012218 NM_012226 NM_012229 NM_012239 NM_012240 NM_012242 NM_012245 NM_012249 NM_012252 NM_012255 NM_012258 NM_012279 NM_012282 NM_012285 NM_012288 NM_012295 NM_012308 NM_012309 NM_012315 NM_012316 NM_012320 NM_012322 NM_012325 NM_012327 NM_012329 NM_012333 NM_012334 NM_012345 NM_012347 NM_012393 NM_012399 NM_012400 NM_012406 NM_012409 NM_012420 NM_012421 NM_012428 NM_012430 NM_012447 NM_012455 NM_012458 NM_012461 NM_012464 NM_012465 NM_012471 NM_012474 NM_012478 NM_012479 NM_013229 NM_013232 NM_013233 NM_013238 NM_013240 NM_013254 NM_013263 NM_013269 NM_013277 NM_013283 NM_013286 NM_013290 NM_013293 NM_013302 NM_013305 NM_013306 NM_013308 NM_013313 NM_013315 NM_013323 NM_013332 NM_013337 NM_013339 NM_013348 NM_013358 NM_013375 NM_013380 NM_013382 NM_013400 NM_013402 NM_013411 NM_013436 NM_013438 NM_013447 NM_013448 NM_013943 NM_013978 NM_013979 NM_013980 NM_013989 NM_013999 NM_014001 NM_014007 NM_014011 NM_014021 NM_014028 NM_014035 NM_014037 NM_014048 NM_014049 NM_014058 NM_014077 NM_014096 NM_014109 NM_014143 NM_014145 NM_014147 NM_014154 NM_014157 NM_014183 NM_014184 NM_014186 NM_014220 NM_014231 NM_014233 NM_014235 NM_014243 NM_014246 NM_014248 NM_014268 NM_014271 NM_014279 NM_014282 NM_014283 NM_014294 NM_014305 NM_014311 NM_014325 NM_014333 NM_014345 NM_014354 NM_014357 NM_014360 NM_014362 NM_014368 NM_014374 NM_014382 NM_014384 NM_014386 NM_014387 NM_014388 NM_014396 NM_014399 NM_014405 NM_014409 NM_014411 NM_014417 NM_014421 NM_014424 NM_014435 NM_014437 NM_014442 NM_014445 NM_014450 NM_014452 NM_014455 NM_014456 NM_014504 NM_014505 NM_014509 NM_014517 NM_014518 NM_014552 NM_014556 NM_014570 NM_014571 NM_014574 NM_014575 NM_014584 NM_014586 NM_014592 NM_014601 NM_014613 NM_014631 NM_014634 NM_014635 NM_014636 NM_014637 NM_014641 NM_014642 NM_014646 NM_014647 NM_014648 NM_014653 NM_014657 NM_014659 NM_014661 NM_014663 NM_014667 NM_014668 NM_014674 NM_014686 NM_014690 NM_014704 NM_014707 NM_014712 NM_014717 NM_014723 NM_014724 NM_014729 NM_014732 NM_014739 NM_014741 NM_014746 NM_014747 NM_014754 NM_014755 NM_014759 NM_014760 NM_014761 NM_014762 NM_014763 NM_014764 NM_014766 NM_014767 NM_014771 NM_014772 NM_014776 NM_014786 NM_014789 NM_014790 NM_014791 NM_014795 NM_014797 NM_014800 NM_014802 NM_014803 NM_014805 NM_014807 NM_014809 NM_014810 NM_014812 NM_014821 NM_014824 NM_014829 NM_014830 NM_014832 NM_014837 NM_014839 NM_014844 NM_014850 NM_014851 NM_014853 NM_014854 NM_014867 NM_014869 NM_014871 NM_014872 NM_014873 NM_014882 NM_014888 NM_014897 NM_014898 NM_014900 NM_014909 NM_014910 NM_014921 NM_014922 NM_014924 NM_014925 NM_014927 NM_014932 NM_014934 NM_014935 NM_014936 NM_014940 NM_014943 NM_014946 NM_014949 NM_014953 NM_014956 NM_014957 NM_014967 NM_014992 NM_014994 NM_014997 NM_015002 NM_015008 NM_015009 NM_015011 NM_015020 NM_015025 NM_015032 NM_015035 NM_015039 NM_015040 NM_015043 NM_015044 NM_015045 NM_015051 NM_015052 NM_015053 NM_015056 NM_015062 NM_015064 NM_015065 NM_015072 NM_015076 NM_015077 NM_015079 NM_015082 NM_015084 NM_015087 NM_015088 NM_015090 NM_015091 NM_015092 NM_015094 NM_015097 NM_015100 NM_015111 NM_015113 NM_015115 NM_015116 NM_015120 NM_015129 NM_015137 NM_015141 NM_015144 NM_015149 NM_015157 NM_015158 NM_015160 NM_015166 NM_015171 NM_015179 NM_015191 NM_015192 NM_015194 NM_015198 NM_015205 NM_015206 NM_015215 NM_015216 NM_015219 NM_015226 NM_015227 NM_015236 NM_015247 NM_015254 NM_015259 NM_015260 NM_015261 NM_015262 NM_015266 NM_015267 NM_015278 NM_015289 NM_015299 NM_015303 NM_015313 NM_015315 NM_015328 NM_015329 NM_015331 NM_015332 NM_015336 NM_015338 NM_015339 NM_015340 NM_015344 NM_015345 NM_015359 NM_015367 NM_015368 NM_015369 NM_015371 NM_015374 NM_015375 NM_015378 NM_015385 NM_015388 NM_015401 NM_015411 NM_015416 NM_015419 NM_015428 NM_015433 NM_015438 NM_015443 NM_015455 NM_015458 NM_015460 NM_015470 NM_015471 NM_015474 NM_015475 NM_015476 NM_015477 NM_015488 NM_015493 NM_015508 NM_015526 NM_015527 NM_015534 NM_015537 NM_015545 NM_015557 NM_015560 NM_015565 NM_015568 NM_015569 NM_015570 NM_015578 NM_015602 NM_015621 NM_015627 NM_015631 NM_015640 NM_015651 NM_015652 NM_015654 NM_015657 NM_015666 NM_015678 NM_015831 NM_015833 NM_015834 NM_015836 NM_015844 NM_015846 NM_015847 NM_015855 NM_015859 NM_015874 NM_015892 NM_015902 NM_015904 NM_015910 NM_015922 NM_015958 NM_015971 NM_015976 NM_015980 NM_015990 NM_015995 NM_016011 NM_016022 NM_016023 NM_016025 NM_016028 NM_016038 NM_016045 NM_016046 NM_016057 NM_016060 NM_016061 NM_016073 NM_016075 NM_016076 NM_016087 NM_016093 NM_016094 NM_016101 NM_016103 NM_016114 NM_016121 NM_016122 NM_016123 NM_016124 NM_016132 NM_016133 NM_016143 NM_016156 NM_016169 NM_016170 NM_016185 NM_016194 NM_016195 NM_016199 NM_016201 NM_016206 NM_016212 NM_016225 NM_016226 NM_016227 NM_016231 NM_016233 NM_016240 NM_016248 NM_016249 NM_016255 NM_016260 NM_016261 NM_016263 NM_016264 NM_016272 NM_016274 NM_016275 NM_016282 NM_016284 NM_016298 NM_016304 NM_016308 NM_016318 NM_016320 NM_016322 NM_016332 NM_016334 NM_016338 NM_016339 NM_016351 NM_016369 NM_016371 NM_016374 NM_016376 NM_016388 NM_016389 NM_016390 NM_016422 NM_016424 NM_016436 NM_016445 NM_016452 NM_016453 NM_016456 NM_016467 NM_016484 NM_016496 NM_016510 NM_016511 NM_016522 NM_016526 NM_016533 NM_016548 NM_016556 NM_016557 NM_016574 NM_016575 NM_016577 NM_016579 NM_016590 NM_016591 NM_016592 NM_016593 NM_016596 NM_016598 NM_016603 NM_016605 NM_016611 NM_016613 NM_016617 NM_016620 NM_016643 NM_016645 NM_016652 NM_016733 NM_016734 NM_016735 NM_016823 NM_016827 NM_016828 NM_016829 NM_016834 NM_016835 NM_016841 NM_016848 NM_016946 NM_017412 NM_017420 NM_017423 NM_017437 NM_017438 NM_017444 NM_017455 NM_017482 NM_017483 NM_017484 NM_017485 NM_017486 NM_017487 NM_017488 NM_017509 NM_017510 NM_017516 NM_017523 NM_017540 NM_017542 NM_017544 NM_017548 NM_017551 NM_017563 NM_017564 NM_017565 NM_017573 NM_017575 NM_017577 NM_017582 NM_017583 NM_017586 NM_017594 NM_017599 NM_017611 NM_017614 NM_017619 NM_017623 NM_017645 NM_017656 NM_017661 NM_017662 NM_017668 NM_017671 NM_017672 NM_017679 NM_017681 NM_017693 NM_017706 NM_017709 NM_017713 NM_017719 NM_017725 NM_017728 NM_017732 NM_017736 NM_017738 NM_017740 NM_017745 NM_017754 NM_017758 NM_017760 NM_017769 NM_017774 NM_017776 NM_017779 NM_017781 NM_017787 NM_017797 NM_017807 NM_017811 NM_017812 NM_017817 NM_017824 NM_017825 NM_017826 NM_017829 NM_017832 NM_017837 NM_017841 NM_017843 NM_017846 NM_017847 NM_017849 NM_017851 NM_017855 NM_017857 NM_017860 NM_017872 NM_017881 NM_017893 NM_017904 NM_017919 NM_017921 NM_017923 NM_017924 NM_017927 NM_017928 NM_017936 NM_017948 NM_017953 NM_017957 NM_017968 NM_017979 NM_017982 NM_017991 NM_018013 NM_018014 NM_018019 NM_018024 NM_018028 NM_018030 NM_018036 NM_018038 NM_018045 NM_018046 NM_018048 NM_018050 NM_018053 NM_018059 NM_018069 NM_018084 NM_018099 NM_018100 NM_018114 NM_018130 NM_018132 NM_018141 NM_018156 NM_018157 NM_018170 NM_018171 NM_018172 NM_018184 NM_018185 NM_018191 NM_018195 NM_018200 NM_018201 NM_018202 NM_018205 NM_018209 NM_018212 NM_018214 NM_018222 NM_018224 NM_018239 NM_018241 NM_018246 NM_018247 NM_018252 NM_018257 NM_018265 NM_018267 NM_018270 NM_018276 NM_018279 NM_018281 NM_018283 NM_018284 NM_018295 NM_018296 NM_018298 NM_018303 NM_018314 NM_018315 NM_018320 NM_018322 NM_018325 NM_018327 NM_018332 NM_018340 NM_018347 NM_018361 NM_018362 NM_018370 NM_018374 NM_018383 NM_018385 NM_018399 NM_018400 NM_018403 NM_018404 NM_018407 NM_018420 NM_018421 NM_018423 NM_018425 NM_018427 NM_018433 NM_018437 NM_018439 NM_018444 NM_018457 NM_018471 NM_018478 NM_018479 NM_018482 NM_018484 NM_018498 NM_018538 NM_018553 NM_018602 NM_018607 NM_018641 NM_018646 NM_018652 NM_018658 NM_018662 NM_018666 NM_018668 NM_018672 NM_018687 NM_018688 NM_018689 NM_018695 NM_018698 NM_018712 NM_018713 NM_018715 NM_018717 NM_018833 NM_018839 NM_018840 NM_018847 NM_018890 NM_018894 NM_018938 NM_018941 NM_018945 NM_018962 NM_018975 NM_018976 NM_018977 NM_018996 NM_018999 NM_019008 NM_019009 NM_019020 NM_019021 NM_019034 NM_019044 NM_019046 NM_019058 NM_019061 NM_019067 NM_019081 NM_019086 NM_019087 NM_019089 NM_019092 NM_019094 NM_019098 NM_019116 NM_019117 NM_019118 NM_019555 NM_019604 NM_019644 NM_019843 NM_019857 NM_019862 NM_019863 NM_019885 NM_019891 NM_019892 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020037 NM_020038 NM_020039 NM_020119 NM_020123 NM_020131 NM_020133 NM_020141 NM_020143 NM_020144 NM_020151 NM_020170 NM_020179 NM_020181 NM_020184 NM_020186 NM_020205 NM_020208 NM_020210 NM_020211 NM_020233 NM_020239 NM_020248 NM_020311 NM_020314 NM_020326 NM_020338 NM_020340 NM_020342 NM_020348 NM_020350 NM_020359 NM_020360 NM_020363 NM_020364 NM_020367 NM_020373 NM_020375 NM_020381 NM_020384 NM_020400 NM_020405 NM_020420 NM_020425 NM_020429 NM_020431 NM_020432 NM_020444 NM_020451 NM_020452 NM_020456 NM_020474 NM_020531 NM_020639 NM_020640 NM_020644 NM_020648 NM_020653 NM_020654 NM_020657 NM_020676 NM_020682 NM_020690 NM_020699 NM_020702 NM_020711 NM_020713 NM_020714 NM_020727 NM_020728 NM_020739 NM_020746 NM_020749 NM_020751 NM_020755 NM_020761 NM_020766 NM_020768 NM_020773 NM_020777 NM_020778 NM_020779 NM_020781 NM_020783 NM_020787 NM_020789 NM_020796 NM_020807 NM_020810 NM_020813 NM_020814 NM_020819 NM_020820 NM_020824 NM_020830 NM_020832 NM_020834 NM_020836 NM_020844 NM_020856 NM_020860 NM_020861 NM_020871 NM_020888 NM_020889 NM_020896 NM_020899 NM_020909 NM_020918 NM_020921 NM_020925 NM_020935 NM_020946 NM_020961 NM_020967 NM_020970 NM_020972 NM_020989 NM_020993 NM_021003 NM_021007 NM_021014 NM_021020 NM_021033 NM_021035 NM_021038 NM_021045 NM_021047 NM_021061 NM_021079 NM_021080 NM_021088 NM_021090 NM_021096 NM_021116 NM_021128 NM_021132 NM_021137 NM_021141 NM_021146 NM_021149 NM_021155 NM_021163 NM_021168 NM_021180 NM_021182 NM_021187 NM_021190 NM_021192 NM_021195 NM_021198 NM_021199 NM_021202 NM_021203 NM_021220 NM_021222 NM_021225 NM_021229 NM_021242 NM_021245 NM_021253 NM_021267 NM_021571 NM_021615 NM_021616 NM_021619 NM_021624 NM_021625 NM_021627 NM_021629 NM_021635 NM_021638 NM_021642 NM_021646 NM_021648 NM_021649 NM_021722 NM_021723 NM_021735 NM_021736 NM_021737 NM_021738 NM_021783 NM_021798 NM_021806 NM_021809 NM_021812 NM_021813 NM_021814 NM_021815 NM_021818 NM_021820 NM_021823 NM_021905 NM_021910 NM_021914 NM_021934 NM_021935 NM_021938 NM_021943 NM_021960 NM_021961 NM_021962 NM_021977 NM_021984 NM_021987 NM_021988 NM_021990 NM_021996 NM_022003 NM_022041 NM_022047 NM_022059 NM_022062 NM_022063 NM_022064 NM_022070 NM_022071 NM_022081 NM_022089 NM_022093 NM_022100 NM_022107 NM_022127 NM_022145 NM_022152 NM_022153 NM_022169 NM_022308 NM_022333 NM_022334 NM_022351 NM_022354 NM_022369 NM_022371 NM_022405 NM_022437 NM_022442 NM_022445 NM_022451 NM_022452 NM_022461 NM_022465 NM_022468 NM_022469 NM_022471 NM_022473 NM_022476 NM_022497 NM_022568 NM_022570 NM_022572 NM_022575 NM_022650 NM_022652 NM_022718 NM_022730 NM_022736 NM_022737 NM_022748 NM_022751 NM_022754 NM_022755 NM_022759 NM_022767 NM_022769 NM_022776 NM_022777 NM_022779 NM_022781 NM_022791 NM_022792 NM_022817 NM_022819 NM_022831 NM_022832 NM_022836 NM_022842 NM_022843 NM_022844 NM_022893 NM_022897 NM_022898 NM_022900 NM_022905 NM_022918 NM_023005 NM_023006 NM_023007 NM_023032 NM_023067 NM_023074 NM_023075 NM_023077 NM_023112 NM_023914 NM_023923 NM_023934 NM_023938 NM_023940 NM_023947 NM_024007 NM_024021 NM_024026 NM_024029 NM_024033 NM_024034 NM_024035 NM_024045 NM_024047 NM_024048 NM_024052 NM_024056 NM_024065 NM_024069 NM_024071 NM_024076 NM_024080 NM_024090 NM_024091 NM_024095 NM_024103 NM_024105 NM_024111 NM_024297 NM_024299 NM_024300 NM_024309 NM_024320 NM_024322 NM_024325 NM_024332 NM_024342 NM_024408 NM_024423 NM_024490 NM_024511 NM_024513 NM_024523 NM_024529 NM_024541 NM_024545 NM_024551 NM_024565 NM_024569 NM_024591 NM_024599 NM_024600 NM_024607 NM_024612 NM_024614 NM_024618 NM_024645 NM_024646 NM_024647 NM_024653 NM_024666 NM_024685 NM_024688 NM_024692 NM_024701 NM_024705 NM_024711 NM_024721 NM_024738 NM_024742 NM_024754 NM_024756 NM_024759 NM_024761 NM_024768 NM_024772 NM_024779 NM_024782 NM_024784 NM_024793 NM_024807 NM_024808 NM_024818 NM_024828 NM_024833 NM_024834 NM_024836 NM_024843 NM_024850 NM_024869 NM_024871 NM_024874 NM_024875 NM_024897 NM_024907 NM_024909 NM_024920 NM_024921 NM_024923 NM_024929 NM_024930 NM_024939 NM_024940 NM_024944 NM_024946 NM_024949 NM_024953 NM_024959 NM_024963 NM_024989 NM_024997 NM_025000 NM_025010 NM_025040 NM_025054 NM_025058 NM_025061 NM_025063 NM_025090 NM_025126 NM_025136 NM_025146 NM_025152 NM_025154 NM_025155 NM_025160 NM_025164 NM_025170 NM_025181 NM_025187 NM_025191 NM_025193 NM_025195 NM_025197 NM_025205 NM_025209 NM_025214 NM_025218 NM_025219 NM_025222 NM_025230 NM_025233 NM_025235 NM_025240 NM_025243 NM_030568 NM_030571 NM_030574 NM_030576 NM_030582 NM_030583 NM_030594 NM_030621 NM_030625 NM_030627 NM_030629 NM_030630 NM_030637 NM_030643 NM_030650 NM_030660 NM_030664 NM_030665 NM_030674 NM_030755 NM_030762 NM_030764 NM_030772 NM_030777 NM_030780 NM_030781 NM_030783 NM_030784 NM_030805 NM_030809 NM_030811 NM_030817 NM_030821 NM_030881 NM_030882 NM_030891 NM_030895 NM_030914 NM_030918 NM_030919 NM_030922 NM_030926 NM_030928 NM_030937 NM_030945 NM_030949 NM_030961 NM_030972 NM_030981 NM_031215 NM_031216 NM_031227 NM_031228 NM_031229 NM_031244 NM_031265 NM_031268 NM_031281 NM_031295 NM_031313 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031409 NM_031410 NM_031417 NM_031419 NM_031426 NM_031437 NM_031439 NM_031444 NM_031445 NM_031448 NM_031449 NM_031450 NM_031453 NM_031455 NM_031461 NM_031464 NM_031468 NM_031483 NM_031484 NM_031488 NM_031492 NM_031844 NM_031866 NM_031887 NM_031888 NM_031910 NM_031911 NM_031912 NM_031913 NM_031935 NM_031952 NM_031954 NM_031965 NM_032012 NM_032017 NM_032037 NM_032039 NM_032041 NM_032045 NM_032047 NM_032051 NM_032105 NM_032112 NM_032121 NM_032131 NM_032136 NM_032141 NM_032145 NM_032151 NM_032153 NM_032154 NM_032174 NM_032186 NM_032189 NM_032193 NM_032194 NM_032207 NM_032208 NM_032211 NM_032219 NM_032222 NM_032228 NM_032229 NM_032239 NM_032256 NM_032258 NM_032268 NM_032285 NM_032287 NM_032289 NM_032291 NM_032294 NM_032302 NM_032303 NM_032304 NM_032314 NM_032317 NM_032323 NM_032324 NM_032329 NM_032349 NM_032357 NM_032360 NM_032377 NM_032389 NM_032408 NM_032431 NM_032434 NM_032436 NM_032439 NM_032445 NM_032446 NM_032447 NM_032454 NM_032458 NM_032471 NM_032472 NM_032486 NM_032491 NM_032493 NM_032508 NM_032510 NM_032512 NM_032515 NM_032517 NM_032521 NM_032525 NM_032532 NM_032551 NM_032552 NM_032560 NM_032582 NM_032584 NM_032589 NM_032590 NM_032603 NM_032622 NM_032634 NM_032664 NM_032682 NM_032701 NM_032704 NM_032706 NM_032714 NM_032717 NM_032718 NM_032728 NM_032741 NM_032770 NM_032777 NM_032782 NM_032784 NM_032785 NM_032788 NM_032795 NM_032802 NM_032806 NM_032811 NM_032814 NM_032818 NM_032822 NM_032824 NM_032826 NM_032853 NM_032862 NM_032864 NM_032865 NM_032866 NM_032867 NM_032869 NM_032871 NM_032873 NM_032878 NM_032881 NM_032886 NM_032895 NM_032899 NM_032900 NM_032916 NM_032918 NM_032928 NM_032932 NM_032946 NM_032960 NM_032966 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032980 NM_032999 NM_033000 NM_033001 NM_033004 NM_033006 NM_033007 NM_033012 NM_033017 NM_033018 NM_033035 NM_033046 NM_033049 NM_033055 NM_033064 NM_033067 NM_033069 NM_033070 NM_033083 NM_033091 NM_033100 NM_033106 NM_033107 NM_033109 NM_033121 NM_033143 NM_033152 NM_033153 NM_033154 NM_033155 NM_033182 NM_033185 NM_033207 NM_033211 NM_033215 NM_033222 NM_033224 NM_033238 NM_033267 NM_033274 NM_033282 NM_033291 NM_033296 NM_033309 NM_033315 NM_033331 NM_033337 NM_033338 NM_033339 NM_033340 NM_033342 NM_033358 NM_033360 NM_033394 NM_033401 NM_033405 NM_033407 NM_033416 NM_033419 NM_033425 NM_033439 NM_033449 NM_033450 NM_033480 NM_033481 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033505 NM_033513 NM_033516 NM_033540 NM_033542 NM_033551 NM_033624 NM_033632 NM_033637 NM_033642 NM_033646 NM_033655 NM_048368 NM_052813 NM_052815 NM_052816 NM_052822 NM_052832 NM_052837 NM_052840 NM_052846 NM_052849 NM_052859 NM_052876 NM_052878 NM_052879 NM_052880 NM_052886 NM_052887 NM_052889 NM_052896 NM_052898 NM_052901 NM_052904 NM_052909 NM_052916 NM_052918 NM_052928 NM_052934 NM_052937 NM_052954 NM_052966 NM_052978 NM_052995 NM_053023 NM_053041 NM_053067 NM_054016 NM_054027 NM_054030 NM_057090 NM_057091 NM_057160 NM_057168 NM_057169 NM_057170 NM_057175 NM_057176 NM_057180 NM_058163 NM_058169 NM_058180 NM_058182 NM_058192 NM_058238 NM_058244 NM_078470 NM_078476 NM_078487 NM_078488 NM_078625 NM_078628 NM_079834 NM_080283 NM_080387 NM_080391 NM_080392 NM_080413 NM_080414 NM_080473 NM_080546 NM_080552 NM_080591 NM_080597 NM_080612 NM_080626 NM_080645 NM_080650 NM_080655 NM_080657 NM_080661 NM_080662 NM_080676 NM_080678 NM_080723 NM_080725 NM_080737 NM_080738 NM_080744 NM_080759 NM_080760 NM_080792 NM_080818 NM_080820 NM_080821 NM_080836 NM_080861 NM_080865 NM_101395 NM_130386 NM_130389 NM_130436 NM_130437 NM_130438 NM_130442 NM_130444 NM_130445 NM_130466 NM_130469 NM_130773 NM_130781 NM_130784 NM_130807 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130898 NM_130906 NM_131916 NM_131917 NM_133170 NM_133171 NM_133265 NM_133266 NM_133268 NM_133329 NM_133334 NM_133370 NM_133371 NM_133372 NM_133378 NM_133432 NM_133433 NM_133437 NM_133443 NM_133445 NM_133448 NM_133451 NM_133464 NM_133493 NM_133509 NM_133637 NM_134324 NM_134325 NM_134433 NM_138280 NM_138284 NM_138298 NM_138299 NM_138300 NM_138333 NM_138341 NM_138357 NM_138372 NM_138376 NM_138384 NM_138390 NM_138402 NM_138447 NM_138450 NM_138457 NM_138468 NM_138492 NM_138551 NM_138553 NM_138559 NM_138563 NM_138564 NM_138566 NM_138572 NM_138576 NM_138608 NM_138619 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138635 NM_138638 NM_138640 NM_138691 NM_138693 NM_138704 NM_138713 NM_138714 NM_138731 NM_138735 NM_138768 NM_138771 NM_138775 NM_138783 NM_138793 NM_138799 NM_138805 NM_138967 NM_138969 NM_138970 NM_138980 NM_138981 NM_138982 NM_138991 NM_138992 NM_138995 NM_139004 NM_139016 NM_139021 NM_139068 NM_139069 NM_139070 NM_139071 NM_139076 NM_139125 NM_139131 NM_139132 NM_139136 NM_139156 NM_139164 NM_139177 NM_139179 NM_139207 NM_139245 NM_139264 NM_139265 NM_139267 NM_139275 NM_139277 NM_139319 NM_139323 NM_144497 NM_144501 NM_144502 NM_144503 NM_144504 NM_144567 NM_144573 NM_144580 NM_144595 NM_144597 NM_144607 NM_144615 NM_144617 NM_144626 NM_144627 NM_144629 NM_144632 NM_144640 NM_144657 NM_144662 NM_144664 NM_144684 NM_144693 NM_144701 NM_144712 NM_144724 NM_144726 NM_144727 NM_144734 NM_144767 NM_144772 NM_144781 NM_144949 NM_144962 NM_144966 NM_144970 NM_144973 NM_144990 NM_144992 NM_144994 NM_144997 NM_145005 NM_145012 NM_145034 NM_145037 NM_145039 NM_145043 NM_145050 NM_145052 NM_145053 NM_145061 NM_145071 NM_145112 NM_145113 NM_145176 NM_145204 NM_145212 NM_145241 NM_145244 NM_145246 NM_145261 NM_145268 NM_145279 NM_145292 NM_145305 NM_145316 NM_145323 NM_145324 NM_145331 NM_145332 NM_145333 NM_145341 NM_145342 NM_145343 NM_145637 NM_145638 NM_145646 NM_145649 NM_145654 NM_145655 NM_145660 NM_145685 NM_145686 NM_145687 NM_145689 NM_145693 NM_145698 NM_145735 NM_145753 NM_145793 NM_145794 NM_145799 NM_145804 NM_145818 NM_145861 NM_145862 NM_145891 NM_145892 NM_145893 NM_145894 NM_145895 NM_145896 NM_145906 NM_147129 NM_147131 NM_147132 NM_147134 NM_147162 NM_147180 NM_147187 NM_147188 NM_147195 NM_147196 NM_147204 NM_147777 NM_147780 NM_147781 NM_147782 NM_147783 NM_148169 NM_148170 NM_148172 NM_148173 NM_148894 NM_148915 NM_148957 NM_148975 NM_152222 NM_152238 NM_152244 NM_152253 NM_152267 NM_152268 NM_152282 NM_152291 NM_152292 NM_152300 NM_152301 NM_152302 NM_152305 NM_152306 NM_152308 NM_152309 NM_152317 NM_152321 NM_152330 NM_152333 NM_152344 NM_152363 NM_152367 NM_152371 NM_152374 NM_152378 NM_152389 NM_152400 NM_152407 NM_152409 NM_152422 NM_152429 NM_152433 NM_152439 NM_152451 NM_152458 NM_152463 NM_152475 NM_152486 NM_152488 NM_152498 NM_152506 NM_152509 NM_152519 NM_152520 NM_152529 NM_152540 NM_152557 NM_152563 NM_152573 NM_152577 NM_152600 NM_152611 NM_152615 NM_152624 NM_152638 NM_152641 NM_152649 NM_152653 NM_152655 NM_152667 NM_152670 NM_152675 NM_152677 NM_152680 NM_152686 NM_152695 NM_152701 NM_152702 NM_152705 NM_152717 NM_152737 NM_152753 NM_152756 NM_152763 NM_152765 NM_152774 NM_152785 NM_152831 NM_152834 NM_152835 NM_152838 NM_152840 NM_152841 NM_152842 NM_152843 NM_152850 NM_152862 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152879 NM_152903 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152934 NM_152939 NM_152991 NM_152999 NM_153008 NM_153020 NM_153022 NM_153029 NM_153031 NM_153032 NM_153035 NM_153040 NM_153041 NM_153044 NM_153050 NM_153051 NM_153186 NM_153201 NM_153208 NM_153220 NM_153231 NM_153239 NM_153240 NM_153247 NM_153253 NM_153254 NM_153262 NM_153263 NM_153273 NM_153292 NM_153320 NM_153325 NM_153335 NM_153337 NM_153344 NM_153346 NM_153355 NM_153371 NM_153381 NM_153442 NM_153453 NM_153456 NM_153462 NM_153463 NM_153480 NM_153481 NM_153482 NM_153483 NM_153486 NM_153487 NM_153497 NM_153499 NM_153500 NM_153613 NM_153635 NM_153646 NM_153647 NM_153648 NM_153686 NM_153688 NM_153702 NM_153703 NM_153705 NM_153710 NM_153712 NM_153748 NM_153757 NM_153809 NM_153812 NM_153823 NM_170589 NM_170601 NM_170682 NM_170683 NM_170686 NM_170694 NM_170695 NM_170706 NM_170720 NM_170721 NM_170724 NM_170741 NM_170742 NM_170743 NM_170746 NM_170753 NM_170771 NM_172000 NM_172016 NM_172070 NM_172087 NM_172088 NM_172089 NM_172101 NM_172102 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172174 NM_172175 NM_172193 NM_172206 NM_172213 NM_172216 NM_172217 NM_172226 NM_172230 NM_172232 NM_172234 NM_172239 NM_172241 NM_172344 NM_172346 NM_172364 NM_172367 NM_172375 NM_172386 NM_172387 NM_172388 NM_172389 NM_173060 NM_173064 NM_173065 NM_173076 NM_173078 NM_173080 NM_173156 NM_173198 NM_173199 NM_173200 NM_173207 NM_173208 NM_173209 NM_173210 NM_173211 NM_173214 NM_173216 NM_173217 NM_173344 NM_173353 NM_173354 NM_173459 NM_173463 NM_173465 NM_173468 NM_173470 NM_173475 NM_173476 NM_173492 NM_173499 NM_173502 NM_173510 NM_173511 NM_173536 NM_173545 NM_173549 NM_173551 NM_173557 NM_173570 NM_173580 NM_173582 NM_173588 NM_173597 NM_173599 NM_173602 NM_173610 NM_173617 NM_173619 NM_173622 NM_173626 NM_173631 NM_173635 NM_173639 NM_173640 NM_173643 NM_173650 NM_173654 NM_173658 NM_173664 NM_173666 NM_173667 NM_173669 NM_173676 NM_173682 NM_173687 NM_173689 NM_173698 NM_173700 NM_173728 NM_173804 NM_173805 NM_173826 NM_173827 NM_173830 NM_173833 NM_173844 NM_173851 NM_173854 NM_173872 NM_174872 NM_174873 NM_174878 NM_174886 NM_174887 NM_174902 NM_174911 NM_174929 NM_174933 NM_174934 NM_174936 NM_174976 NM_174978 NM_175053 NM_175056 NM_175062 NM_175571 NM_175609 NM_175610 NM_175698 NM_175709 NM_175733 NM_175736 NM_175852 NM_175859 NM_175864 NM_175866 NM_175872 NM_175883 NM_175898 NM_175900 NM_175901 NM_175907 NM_175913 NM_176095 NM_176787 NM_176792 NM_176806 NM_176815 NM_176816 NM_176823 NM_176871 NM_176878 NM_176894 NM_177398 NM_177399 NM_177401 NM_177423 NM_177427 NM_177435 NM_177438 NM_177454 NM_177551 NM_177937 NM_177952 NM_177953 NM_177963 NM_177964 NM_177977 NM_177978 NM_177979 NM_177995 NM_178025 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178125 NM_178129 NM_178130 NM_178151 NM_178152 NM_178153 NM_178191 NM_178276 NM_178423 NM_178424 NM_178426 NM_178427 NM_178432 NM_178445 NM_178470 NM_178500 NM_178505 NM_178514 NM_178516 NM_178520 NM_178526 NM_178543 NM_178550 NM_178553 NM_178562 NM_178583 NM_178586 NM_178815 NM_178816 NM_178821 NM_178823 NM_178841 NM_178849 NM_178857 NM_178858 NM_178860 NM_181041 NM_181054 NM_181078 NM_181079 NM_181349 NM_181356 NM_181357 NM_181358 NM_181361 NM_181430 NM_181431 NM_181435 NM_181442 NM_181453 NM_181457 NM_181458 NM_181459 NM_181460 NM_181481 NM_181482 NM_181483 NM_181489 NM_181504 NM_181507 NM_181508 NM_181523 NM_181524 NM_181531 NM_181578 NM_181581 NM_181642 NM_181654 NM_181672 NM_181673 NM_181689 NM_181690 NM_181703 NM_181708 NM_181709 NM_181719 NM_181723 NM_181724 NM_181776 NM_181784 NM_181789 NM_181794 NM_181795 NM_181825 NM_181831 NM_181836 NM_181838 NM_181844 NM_181846 NM_181861 NM_181868 NM_181869 NM_181874 NM_181897 NM_181900 NM_182483 NM_182485 NM_182487 NM_182495 NM_182497 NM_182518 NM_182519 NM_182520 NM_182525 NM_182526 NM_182534 NM_182540 NM_182546 NM_182551 NM_182560 NM_182564 NM_182568 NM_182572 NM_182578 NM_182587 NM_182596 NM_182597 NM_182609 NM_182616 NM_182619 NM_182626 NM_182635 NM_182645 NM_182646 NM_182648 NM_182663 NM_182664 NM_182665 NM_182682 NM_182688 NM_182691 NM_182692 NM_182697 NM_182700 NM_182703 NM_182712 NM_182729 NM_182734 NM_182740 NM_182742 NM_182743 NM_182749 NM_182757 NM_182763 NM_182764 NM_182775 NM_182796 NM_182829 NM_182830 NM_182832 NM_182833 NM_182838 NM_182848 NM_182894 NM_182898 NM_182899 NM_182909 NM_182960 NM_182970 NM_183010 NM_183045 NM_183058 NM_183059 NM_183078 NM_183238 NM_183373 NM_183376 NM_183377 NM_183412 NM_183413 NM_183414 NM_183415 NM_183418 NM_184042 NM_184231 NM_194252 NM_194271 NM_194282 NM_194283 NM_194284 NM_194286 NM_194288 NM_194294 NM_194299 NM_194303 NM_194310 NM_194312 NM_194314 NM_194316 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194352 NM_194434 NM_194436 NM_194442 NM_194452 NM_194453 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197978 NM_198038 NM_198039 NM_198047 NM_198056 NM_198058 NM_198066 NM_198075 NM_198087 NM_198088 NM_198098 NM_198138 NM_198149 NM_198173 NM_198174 NM_198181 NM_198182 NM_198196 NM_198207 NM_198213 NM_198252 NM_198268 NM_198269 NM_198270 NM_198274 NM_198277 NM_198291 NM_198321 NM_198329 NM_198389 NM_198390 NM_198406 NM_198439 NM_198441 NM_198442 NM_198451 NM_198462 NM_198468 NM_198482 NM_198484 NM_198502 NM_198503 NM_198511 NM_198512 NM_198517 NM_198529 NM_198530 NM_198541 NM_198545 NM_198555 NM_198562 NM_198563 NM_198569 NM_198573 NM_198580 NM_198582 NM_198595 NM_198705 NM_198706 NM_198707 NM_198708 NM_198719 NM_198797 NM_198799 NM_198829 NM_198833 NM_198835 NM_198851 NM_198867 NM_198868 NM_198887 NM_198896 NM_198900 NM_198901 NM_198907 NM_198920 NM_198925 NM_198941 NM_198943 NM_198945 NM_198947 NM_198956 NM_198968 NM_198989 NM_198998 NM_199000 NM_199039 NM_199040 NM_199045 NM_199050 NM_199051 NM_199071 NM_199078 NM_199124 NM_199126 NM_199129 NM_199131 NM_199135 NM_199139 NM_199141 NM_199144 NM_199160 NM_199163 NM_199168 NM_199185 NM_199188 NM_199190 NM_199203 NM_199229 NM_199245 NM_199259 NM_199260 NM_199261 NM_199324 NM_199329 NM_199348 NM_199358 NM_199413 NM_199414 NM_199416 NM_199423 NM_199436 NM_199443 NM_199461 NM_199462 NM_199484 NM_199485 NM_201253 NM_201259 NM_201260 NM_201261 NM_201263 NM_201269 NM_201278 NM_201280 NM_201281 NM_201348 NM_201397 NM_201403 NM_201432 NM_201433 NM_201526 NM_201546 NM_201559 NM_201564 NM_201565 NM_201568 NM_201569 NM_201574 NM_201591 NM_201592 NM_201594 NM_201595 NM_201625 NM_201631 NM_201636 NM_201994 NM_201999 NM_203283 NM_203284 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203305 NM_203306 NM_203308 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203341 NM_203342 NM_203343 NM_203351 NM_203354 NM_203355 NM_203356 NM_203357 NM_203372 NM_203373 NM_203377 NM_203378 NM_203394 NM_203395 NM_203403 NM_203404 NM_203411 NM_203428 NM_203429 NM_203438 NM_203439 NM_203440 NM_203441 NM_203445 NM_203446 NM_203454 NM_203462 NM_203463 NM_203495 NM_203497 NM_203506 NM_205842 NM_205846 NM_205852 NM_205857 NM_205860 NM_206832 NM_206834 NM_206836 NM_206854 NM_206855 NM_206866 NM_206887 NM_206907 NM_206910 NM_206911 NM_206914 NM_206925 NM_206926 NM_206933 NM_206937 NM_206943 NM_207003 NM_207035 NM_207112 NM_207119 NM_207123 NM_207126 NM_207129 NM_207171 NM_207172 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207305 NM_207306 NM_207309 NM_207335 NM_207346 NM_207349 NM_207352 NM_207359 NM_207362 NM_207371 NM_207372 NM_207380 NM_207381 NM_207382 NM_207387 NM_207395 NM_207397 NM_207400 NM_207410 NM_207426 NM_207428 NM_207430 NM_207432 NM_207434 NM_207435 NM_207437 NM_207438 NM_207439 NM_207442 NM_207443 NM_207446 NM_207447 NM_207448 NM_207451 NM_207454 NM_207461 NM_207468 NM_207469 NM_207478 NM_207481 NM_207485 NM_207486 NM_207488 NM_207489 NM_207491 NM_207495 NM_207497 NM_207500 NM_207504 NM_207505 NM_207510 NM_207513 NM_207514 NM_207582 NM_207646 NM_207647 NM_212460 NM_212464 NM_212467 NM_212502 NM_212503 NM_212558 NM_212559 NM_213566 NM_213594 NM_213596 NM_213604 NM_213605 NM_213654 NM_213723 NM_214677 NM_214678 NM_214679 XM_027236 XM_028810 XM_029353 XM_031104 XM_032945 XM_034872 XM_038150 XM_038436 XM_039515 XM_039676 XM_039877 XM_040592 XM_042301 XM_042698 XM_042833 XM_042936 XM_044434 XM_046581 XM_047355 XM_048128 XM_051017 XM_051200 XM_051862 XM_057107 XM_058628 XM_059578 XM_059929 XM_084529 XM_084852 XM_085967 XM_086937 XM_087137 XM_087386 XM_087490 XM_087761 XM_088459 XM_088636 XM_089384 XM_096688 XM_113947 XM_114303 XM_117030 XM_167147 XM_171165 XM_171855 XM_208058 XM_208261 XM_208524 XM_208835 XM_208847 XM_208990 XM_209196 XM_209227 XM_209429 XM_209569 XM_210062 XM_210908 XM_211028 XM_211305 XM_290482 XM_290546 XM_290579 XM_290615 XM_290629 XM_290670 XM_291019 XM_291075 XM_291128 XM_291729 XM_292357 XM_293225 XM_293918 XM_294765 XM_294775 XM_294993 XM_295178 XM_298151 XM_351948 XM_370557 XM_370603 XM_370607 XM_370756 XM_370837 XM_370839 XM_370843 XM_370876 XM_370878 XM_370879 XM_370899 XM_370917 XM_370928 XM_370932 XM_371074 XM_371116 XM_371132 XM_371204 XM_371248 XM_371254 XM_371261 XM_371302 XM_371304 XM_371374 XM_371399 XM_371461 XM_371470 XM_371474 XM_371486 XM_371488 XM_371592 XM_371614 XM_371663 XM_371664 XM_371668 XM_371680 XM_371691 XM_371769 XM_371777 XM_371783 XM_371820 XM_371891 XM_371956 XM_372038 XM_372039 XM_372042 XM_372097 XM_372108 XM_372193 XM_372198 XM_372227 XM_372267 XM_372579 XM_372716 XM_373453 XM_373498 XM_373506 XM_373616 XM_373647 XM_373650 XM_373666 XM_373686 XM_373691 XM_373713 XM_373740 XM_373742 XM_373748 XM_373765 XM_373822 XM_373847 XM_373850 XM_373873 XM_373883 XM_373884 XM_373886 XM_373893 XM_373922 XM_373931 XM_374003 XM_374020 XM_374046 XM_374047 XM_374069 XM_374113 XM_374115 XM_374117 XM_374185 XM_374190 XM_374249 XM_374257 XM_374270 XM_374295 XM_374343 XM_374422 XM_374769 XM_374803 XM_374912 XM_374945 XM_374973 XM_375029 XM_375065 XM_375081 XM_375099 XM_375152 XM_375174 XM_375183 XM_375272 XM_375357 XM_375378 XM_375456 XM_375491 XM_375602 XM_375606 XM_375608 XM_375619 XM_375747 XM_375816 XM_375821 XM_375853 XM_376018 XM_376043 XM_376049 XM_376062 XM_376111 XM_376165 XM_376241 XM_376350 XM_376412 XM_376423 XM_376444 XM_376560 XM_376586 XM_376784 XM_376795 XM_376822 XM_376869 XM_376902 XM_376981 XM_377002 XM_377053 XM_377476 XM_378203 XM_378208 XM_378219 XM_378238 XM_378247 XM_378259 XM_378321 XM_378327 XM_378329 XM_378340 XM_378360 XM_378379 XM_378389 XM_378437 XM_378452 XM_378453 XM_378456 XM_378511 XM_378523 XM_378535 XM_378544 XM_378550 XM_378562 XM_378564 XM_378589 XM_378642 XM_378643 XM_378661 XM_378667 XM_378678 XM_378687 XM_378698 XM_378700 XM_378703 XM_378705 XM_378708 XM_378735 XM_378738 XM_378746 XM_378747 XM_378750 XM_378756 XM_378758 XM_378760 XM_378783 XM_378786 XM_378793 XM_378795 XM_378832 XM_378852 XM_378855 XM_378859 XM_378860 XM_378866 XM_378879 XM_378886 XM_378914 XM_378964 XM_378970 XM_378976 XM_378985 XM_379030 XM_379041 XM_379044 XM_379060 XM_379068 XM_379075 XM_379078 XM_379094 XM_379097 XM_379100 XM_379102 XM_379111 XM_379121 XM_379154 XM_379156 XM_379173 XM_379184 XM_379189 XM_379204 XM_379215 XM_379234 XM_379243 XM_379258 XM_379267 XM_379270 XM_379280 XM_379299 XM_379309 XM_379363 XM_379371 XM_379381 XM_379386 XM_379391 XM_379403 XM_379406 XM_379409 XM_379417 XM_379437 XM_379452 XM_379459 XM_379484 XM_379510 XM_379520 XM_379534 XM_379535 XM_379547 XM_379562 XM_379594 XM_379595 XM_379597 XM_379622 XM_379623 XM_379629 XM_379637 XM_379651 XM_379657 XM_379664 XM_379665 XM_379668 XM_379722 XM_379798 XM_379932 XM_380100 XM_380131 XM_380146 XM_380159 XM_380160 XM_380173 XM_380174 XM_495844 XM_495846 XM_495860 XM_495868 XM_495881 XM_495886 XM_495926 XM_495939 XM_495950 XM_495961 XM_495984 XM_496041 XM_496044 XM_496075 XM_496076 XM_496081 XM_496086 XM_496088 XM_496103 XM_496129 XM_496134 XM_496158 XM_496165 XM_496266 XM_496271 XM_496299 XM_496349 XM_496355 XM_496373 XM_496539 XM_496549 XM_496575 XM_496579 XM_496581 XM_496597 XM_496603 XM_496637 XM_496650 XM_496654 XM_496659 XM_496690 XM_496692 XM_496766 XM_496836 XM_496854 XM_496877 XM_496879 XM_496895 XM_496943 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497021 XM_497036 XM_497089 XM_497120 XM_497121 XM_497209 XM_498437 XM_498441 XM_498446 XM_498448 XM_498452 XM_498454 XM_498460 XM_498465 XM_498467 XM_498469 XM_498473 XM_498540 XM_498557 XM_498559 XM_498564 XM_498569 XM_498572 XM_498575 XM_498596 XM_498618 XM_498620 XM_498628 XM_498629 XM_498649 XM_498651 XM_498662 XM_498667 XM_498681 XM_498689 XM_498693 XM_498717 XM_498724 XM_498829 XM_498841 XM_498850 XM_498852 XM_498853 XM_498872 XM_498878 XM_498889 XM_498894 XM_498901 XM_498932 XM_498945 XM_498956 XM_498972 XM_498988 XM_498994 XM_498998 XM_499006 XM_499008 XM_499047 XM_499056 XM_499072 XM_499084 XM_499085 XM_499092 XM_499123 XM_499130 XM_499139 XM_499142 XM_499146 XM_499147 XM_499152 XM_499158 XM_499182 XM_499263 XM_499298 XM_499309 XM_499323 XM_499503 XM_499525 XM_499539 XM_499556 XM_499571 XM_499573 XM_499583 XM_499590 XM_499595 XM_499597 XR_000190 XR_000192 XR_000194 XR_000195 XR_000217 XR_000227 XR_000254 XR_000261 XR_000265 XR_000268 XR_000273 XR_000292
Genes with multiple seed matches:
NM_000046 NM_000091 NM_000097 NM_000107 NM_000132 NM_000133 NM_000210 NM_000214 NM_000221 NM_000276 NM_000382 NM_000386 NM_000418 NM_000442 NM_000478 NM_000555 NM_000599 NM_000618 NM_000629 NM_000633 NM_000635 NM_000806 NM_000809 NM_000997 NM_001001331 NM_001001418 NM_001001419 NM_001001420 NM_001001703 NM_001001704 NM_001001707 NM_001001938 NM_001002026 NM_001002257 NM_001002914 NM_001003940 NM_001003942 NM_001003943 NM_001004299 NM_001004300 NM_001004302 NM_001004308 NM_001004339 NM_001004348 NM_001004349 NM_001004439 NM_001004720 NM_001004722 NM_001005404 NM_001005737 NM_001005766 NM_001006600 NM_001006657 NM_001007094 NM_001007156 NM_001007224 NM_001007237 NM_001007254 NM_001007529 NM_001007565 NM_001008406 NM_001008408 NM_001008493 NM_001008756 NM_001009553 NM_001009883 NM_001009923 NM_001009924 NM_001009925 NM_001009992 NM_001010851 NM_001010882 NM_001010888 NM_001010898 NM_001010913 NM_001011514 NM_001011666 NM_001012418 NM_001012514 NM_001012516 NM_001012642 NM_001012707 NM_001012957 NM_001012958 NM_001012960 NM_001012968 NM_001012993 NM_001013399 NM_001013687 NM_001013693 NM_001013697 NM_001013710 NM_001013717 NM_001013724 NM_001014765 NM_001015051 NM_001015883 NM_001017440 NM_001017965 NM_001017980 NM_001018009 NM_001018055 NM_001018104 NM_001024457 NM_001024630 NM_001024631 NM_001024680 NM_001024688 NM_001024733 NM_001024843 NM_001024847 NM_001024855 NM_001043 NM_001092 NM_001099 NM_001128 NM_001186 NM_001215 NM_001227 NM_001230 NM_001310 NM_001351 NM_001386 NM_001396 NM_001406 NM_001417 NM_001455 NM_001457 NM_001542 NM_001587 NM_001624 NM_001668 NM_001679 NM_001683 NM_001695 NM_001703 NM_001766 NM_001806 NM_001860 NM_001901 NM_001904 NM_001908 NM_001975 NM_002015 NM_002033 NM_002086 NM_002111 NM_002141 NM_002205 NM_002254 NM_002293 NM_002296 NM_002298 NM_002349 NM_002357 NM_002384 NM_002401 NM_002408 NM_002451 NM_002460 NM_002480 NM_002485 NM_002556 NM_002577 NM_002581 NM_002610 NM_002613 NM_002655 NM_002714 NM_002716 NM_002725 NM_002737 NM_002760 NM_002856 NM_002959 NM_003016 NM_003023 NM_003029 NM_003032 NM_003036 NM_003045 NM_003048 NM_003076 NM_003101 NM_003165 NM_003188 NM_003200 NM_003216 NM_003236 NM_003242 NM_003246 NM_003247 NM_003255 NM_003274 NM_003343 NM_003348 NM_003349 NM_003363 NM_003404 NM_003421 NM_003439 NM_003472 NM_003498 NM_003581 NM_003597 NM_003605 NM_003644 NM_003684 NM_003882 NM_003907 NM_003913 NM_003939 NM_003941 NM_003949 NM_004050 NM_004072 NM_004112 NM_004117 NM_004171 NM_004232 NM_004263 NM_004302 NM_004311 NM_004321 NM_004348 NM_004392 NM_004397 NM_004437 NM_004504 NM_004505 NM_004527 NM_004549 NM_004566 NM_004586 NM_004588 NM_004598 NM_004710 NM_004723 NM_004730 NM_004744 NM_004776 NM_004788 NM_004796 NM_004797 NM_004801 NM_004808 NM_004827 NM_004844 NM_004845 NM_004904 NM_004936 NM_004963 NM_004975 NM_004993 NM_004996 NM_005044 NM_005076 NM_005093 NM_005105 NM_005109 NM_005137 NM_005188 NM_005190 NM_005197 NM_005324 NM_005334 NM_005374 NM_005431 NM_005436 NM_005446 NM_005458 NM_005472 NM_005546 NM_005647 NM_005658 NM_005668 NM_005698 NM_005715 NM_005779 NM_005813 NM_005828 NM_005840 NM_005862 NM_005902 NM_005903 NM_005930 NM_005957 NM_005971 NM_006020 NM_006033 NM_006047 NM_006055 NM_006070 NM_006096 NM_006108 NM_006116 NM_006141 NM_006145 NM_006160 NM_006162 NM_006166 NM_006184 NM_006190 NM_006212 NM_006242 NM_006251 NM_006275 NM_006282 NM_006291 NM_006371 NM_006403 NM_006418 NM_006466 NM_006488 NM_006493 NM_006517 NM_006526 NM_006546 NM_006557 NM_006578 NM_006620 NM_006622 NM_006675 NM_006742 NM_006748 NM_006774 NM_006809 NM_007010 NM_007017 NM_007050 NM_007145 NM_007146 NM_007249 NM_007257 NM_007271 NM_007306 NM_007338 NM_007368 NM_007375 NM_012072 NM_012076 NM_012091 NM_012184 NM_012211 NM_012218 NM_012249 NM_012288 NM_012309 NM_012325 NM_012347 NM_012400 NM_012421 NM_012458 NM_012465 NM_013411 NM_013943 NM_013999 NM_014001 NM_014011 NM_014028 NM_014077 NM_014143 NM_014145 NM_014154 NM_014243 NM_014246 NM_014268 NM_014333 NM_014405 NM_014424 NM_014504 NM_014518 NM_014571 NM_014584 NM_014634 NM_014636 NM_014653 NM_014663 NM_014674 NM_014686 NM_014707 NM_014724 NM_014732 NM_014746 NM_014754 NM_014760 NM_014767 NM_014771 NM_014789 NM_014790 NM_014800 NM_014802 NM_014809 NM_014821 NM_014850 NM_014851 NM_014867 NM_014871 NM_014900 NM_014910 NM_014922 NM_014924 NM_014932 NM_014934 NM_014943 NM_014946 NM_014994 NM_015002 NM_015020 NM_015025 NM_015035 NM_015039 NM_015064 NM_015077 NM_015079 NM_015082 NM_015088 NM_015092 NM_015094 NM_015097 NM_015111 NM_015113 NM_015116 NM_015137 NM_015141 NM_015191 NM_015194 NM_015205 NM_015206 NM_015215 NM_015216 NM_015227 NM_015236 NM_015260 NM_015266 NM_015289 NM_015313 NM_015315 NM_015328 NM_015329 NM_015331 NM_015338 NM_015340 NM_015345 NM_015359 NM_015378 NM_015401 NM_015443 NM_015455 NM_015471 NM_015477 NM_015493 NM_015568 NM_015570 NM_015654 NM_015833 NM_015834 NM_015844 NM_015846 NM_015847 NM_015910 NM_016022 NM_016073 NM_016076 NM_016114 NM_016143 NM_016194 NM_016201 NM_016334 NM_016338 NM_016369 NM_016374 NM_016422 NM_016436 NM_016575 NM_016590 NM_016596 NM_016605 NM_016617 NM_016735 NM_016946 NM_017412 NM_017420 NM_017423 NM_017542 NM_017548 NM_017551 NM_017582 NM_017599 NM_017645 NM_017656 NM_017662 NM_017709 NM_017740 NM_017779 NM_017811 NM_017832 NM_017849 NM_017851 NM_017893 NM_017921 NM_017924 NM_017927 NM_017936 NM_017957 NM_017968 NM_018036 NM_018038 NM_018059 NM_018132 NM_018156 NM_018185 NM_018191 NM_018195 NM_018200 NM_018205 NM_018209 NM_018212 NM_018239 NM_018246 NM_018247 NM_018295 NM_018374 NM_018479 NM_018482 NM_018662 NM_018695 NM_018698 NM_018717 NM_018839 NM_018938 NM_018941 NM_018945 NM_018975 NM_018976 NM_018977 NM_019034 NM_019061 NM_019094 NM_019098 NM_019604 NM_019862 NM_019863 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020119 NM_020123 NM_020170 NM_020184 NM_020210 NM_020239 NM_020342 NM_020348 NM_020405 NM_020429 NM_020452 NM_020531 NM_020654 NM_020657 NM_020714 NM_020727 NM_020746 NM_020777 NM_020779 NM_020783 NM_020810 NM_020814 NM_020871 NM_020935 NM_020970 NM_021038 NM_021045 NM_021079 NM_021116 NM_021202 NM_021253 NM_021615 NM_021619 NM_021813 NM_021814 NM_021910 NM_021960 NM_021961 NM_021962 NM_021977 NM_021988 NM_022041 NM_022062 NM_022081 NM_022442 NM_022468 NM_022469 NM_022718 NM_022779 NM_022831 NM_022832 NM_022836 NM_022898 NM_023074 NM_023112 NM_023940 NM_024048 NM_024090 NM_024332 NM_024423 NM_024523 NM_024600 NM_024647 NM_024711 NM_024721 NM_024742 NM_024828 NM_024833 NM_024921 NM_024923 NM_024989 NM_025010 NM_025040 NM_025136 NM_025195 NM_025197 NM_025235 NM_030576 NM_030621 NM_030643 NM_030650 NM_030660 NM_030762 NM_030781 NM_030805 NM_030809 NM_030891 NM_030895 NM_030918 NM_030926 NM_031268 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031444 NM_031468 NM_031484 NM_031887 NM_031888 NM_031912 NM_031952 NM_031954 NM_032012 NM_032041 NM_032112 NM_032121 NM_032174 NM_032228 NM_032287 NM_032289 NM_032294 NM_032329 NM_032357 NM_032436 NM_032445 NM_032446 NM_032510 NM_032682 NM_032714 NM_032770 NM_032784 NM_032785 NM_032795 NM_032824 NM_032866 NM_032976 NM_032977 NM_033004 NM_033006 NM_033007 NM_033182 NM_033207 NM_033211 NM_033222 NM_033224 NM_033267 NM_033274 NM_033296 NM_033309 NM_033331 NM_033338 NM_033339 NM_033340 NM_033342 NM_033394 NM_033416 NM_033425 NM_033480 NM_033481 NM_033503 NM_033505 NM_033540 NM_033551 NM_033624 NM_033637 NM_052837 NM_052880 NM_052886 NM_052909 NM_052928 NM_052995 NM_057175 NM_058169 NM_058182 NM_078487 NM_080650 NM_080657 NM_080725 NM_080738 NM_080759 NM_080760 NM_080818 NM_080820 NM_080836 NM_101395 NM_130436 NM_130437 NM_130438 NM_130442 NM_130807 NM_133170 NM_133371 NM_134324 NM_134433 NM_138298 NM_138357 NM_138384 NM_138390 NM_138492 NM_138576 NM_138608 NM_138619 NM_138731 NM_138735 NM_138771 NM_138967 NM_138970 NM_139071 NM_139125 NM_139136 NM_139323 NM_144502 NM_144503 NM_144504 NM_144567 NM_144626 NM_144693 NM_144949 NM_144997 NM_145268 NM_145305 NM_145323 NM_145324 NM_145331 NM_145332 NM_145333 NM_145660 NM_145735 NM_145861 NM_147129 NM_147134 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_152267 NM_152300 NM_152301 NM_152306 NM_152309 NM_152330 NM_152371 NM_152475 NM_152615 NM_152624 NM_152638 NM_152641 NM_152756 NM_152765 NM_152785 NM_152831 NM_152834 NM_152838 NM_152840 NM_152841 NM_152842 NM_152999 NM_153020 NM_153035 NM_153044 NM_153381 NM_153462 NM_153486 NM_153688 NM_153712 NM_153748 NM_153812 NM_170706 NM_170746 NM_170753 NM_172016 NM_172206 NM_172217 NM_172346 NM_172364 NM_172387 NM_172388 NM_172389 NM_173216 NM_173217 NM_173459 NM_173463 NM_173476 NM_173510 NM_173511 NM_173602 NM_173610 NM_173622 NM_173639 NM_173805 NM_173826 NM_173827 NM_174878 NM_174936 NM_175609 NM_175736 NM_175864 NM_175907 NM_176095 NM_176815 NM_177438 NM_177963 NM_177977 NM_177978 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178129 NM_178151 NM_178152 NM_178153 NM_178191 NM_178276 NM_178426 NM_178427 NM_178514 NM_178520 NM_178526 NM_178860 NM_181349 NM_181356 NM_181457 NM_181458 NM_181459 NM_181460 NM_181489 NM_181724 NM_181844 NM_182483 NM_182518 NM_182551 NM_182568 NM_182578 NM_182587 NM_182688 NM_182763 NM_182775 NM_182829 NM_182832 NM_182894 NM_182898 NM_182899 NM_182909 NM_182960 NM_182970 NM_183045 NM_183059 NM_183238 NM_183412 NM_183413 NM_194284 NM_194286 NM_194294 NM_194303 NM_194310 NM_194352 NM_194436 NM_194442 NM_198406 NM_198441 NM_198442 NM_198502 NM_198573 NM_198580 NM_198887 NM_198900 NM_198925 NM_198945 NM_198968 NM_199040 NM_199050 NM_199131 NM_199144 NM_199203 NM_199324 NM_199423 NM_199436 NM_199443 NM_199461 NM_201348 NM_201432 NM_201433 NM_201559 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203305 NM_203341 NM_203342 NM_203343 NM_203351 NM_203354 NM_203355 NM_203356 NM_203357 NM_203462 NM_203497 NM_203506 NM_205846 NM_205857 NM_206866 NM_206907 NM_206914 NM_207119 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207305 NM_207352 NM_207438 NM_207442 NM_207451 NM_207454 NM_207461 NM_207478 NM_207486 NM_207497 NM_207500 NM_207514 NM_212467 NM_213596 NM_213654 NM_214677 NM_214678 NM_214679 XM_029353 XM_034872 XM_038436 XM_039515 XM_044434 XM_051200 XM_113947 XM_167147 XM_208990 XM_209429 XM_290615 XM_290670 XM_370878 XM_370932 XM_371074 XM_371204 XM_371486 XM_371488 XM_371680 XM_371783 XM_372039 XM_372097 XM_372193 XM_373666 XM_373742 XM_373850 XM_373883 XM_373886 XM_374249 XM_374803 XM_374912 XM_375065 XM_375608 XM_375821 XM_375853 XM_376018 XM_376049 XM_376062 XM_376412 XM_376423 XM_376795 XM_377002 XM_378327 XM_378379 XM_378389 XM_378453 XM_378544 XM_378589 XM_378642 XM_378661 XM_378703 XM_378708 XM_378750 XM_378783 XM_378866 XM_378886 XM_378914 XM_378976 XM_379030 XM_379060 XM_379075 XM_379156 XM_379243 XM_379258 XM_379267 XM_379280 XM_379363 XM_379371 XM_379391 XM_379510 XM_379520 XM_379547 XM_379595 XM_379597 XM_379629 XM_380131 XM_380146 XM_380173 XM_495844 XM_495886 XM_496575 XM_496690 XM_496692 XM_498441 XM_498540 XM_498649 XM_498651 XM_498724 XM_498829 XM_498850 XM_498956 XM_499008 XM_499084 XM_499539 XM_499571
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)