VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacgguacuauuaccguugag"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
958
.
Total Genes with multiple seed matches:
45
.
Genes with at least one seed match:
NM_000021 NM_000026 NM_000081 NM_000090 NM_000097 NM_000140 NM_000281 NM_000322 NM_000332 NM_000368 NM_000387 NM_000389 NM_000417 NM_000430 NM_000527 NM_000591 NM_000609 NM_000634 NM_000671 NM_000721 NM_000732 NM_000734 NM_000810 NM_000814 NM_000878 NM_000925 NM_001001323 NM_001001344 NM_001001418 NM_001001434 NM_001001557 NM_001001700 NM_001001890 NM_001001894 NM_001001928 NM_001001929 NM_001001930 NM_001001974 NM_001002295 NM_001002860 NM_001003674 NM_001003675 NM_001003682 NM_001003790 NM_001003791 NM_001003794 NM_001003796 NM_001004285 NM_001004286 NM_001004342 NM_001004346 NM_001005372 NM_001005611 NM_001006657 NM_001007169 NM_001008390 NM_001008493 NM_001008529 NM_001008723 NM_001009566 NM_001009610 NM_001009992 NM_001009996 NM_001010883 NM_001010898 NM_001010924 NM_001011514 NM_001011658 NM_001011666 NM_001012503 NM_001012515 NM_001012642 NM_001012651 NM_001012960 NM_001013436 NM_001013440 NM_001013642 NM_001013670 NM_001013679 NM_001013693 NM_001013695 NM_001013727 NM_001014291 NM_001014842 NM_001017392 NM_001017915 NM_001017926 NM_001018029 NM_001018050 NM_001018051 NM_001018052 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001024649 NM_001024732 NM_001024808 NM_001025077 NM_001038 NM_001132 NM_001190 NM_001198 NM_001254 NM_001259 NM_001310 NM_001356 NM_001423 NM_001426 NM_001442 NM_001472 NM_001474 NM_001475 NM_001476 NM_001477 NM_001483 NM_001491 NM_001498 NM_001499 NM_001543 NM_001682 NM_001730 NM_001746 NM_001754 NM_001759 NM_001794 NM_001846 NM_001909 NM_001932 NM_002033 NM_002051 NM_002070 NM_002073 NM_002117 NM_002171 NM_002182 NM_002248 NM_002254 NM_002310 NM_002421 NM_002430 NM_002444 NM_002451 NM_002473 NM_002490 NM_002501 NM_002531 NM_002582 NM_002709 NM_002725 NM_002726 NM_002737 NM_002758 NM_002822 NM_002829 NM_002834 NM_002869 NM_002872 NM_002894 NM_003030 NM_003131 NM_003195 NM_003222 NM_003270 NM_003316 NM_003353 NM_003363 NM_003496 NM_003590 NM_003607 NM_003617 NM_003624 NM_003648 NM_003663 NM_003679 NM_003714 NM_003715 NM_003751 NM_003762 NM_003774 NM_003799 NM_003822 NM_003838 NM_003851 NM_003855 NM_003870 NM_003893 NM_003918 NM_003938 NM_003958 NM_004041 NM_004096 NM_004302 NM_004319 NM_004337 NM_004338 NM_004402 NM_004405 NM_004437 NM_004449 NM_004457 NM_004474 NM_004485 NM_004494 NM_004513 NM_004516 NM_004529 NM_004535 NM_004559 NM_004637 NM_004705 NM_004738 NM_004759 NM_004815 NM_004842 NM_004904 NM_004917 NM_004962 NM_005008 NM_005011 NM_005036 NM_005065 NM_005081 NM_005093 NM_005104 NM_005112 NM_005124 NM_005126 NM_005137 NM_005168 NM_005184 NM_005189 NM_005256 NM_005262 NM_005342 NM_005382 NM_005387 NM_005400 NM_005436 NM_005535 NM_005541 NM_005610 NM_005636 NM_005647 NM_005650 NM_005665 NM_005714 NM_005715 NM_005806 NM_005860 NM_005895 NM_005899 NM_006015 NM_006017 NM_006048 NM_006067 NM_006178 NM_006186 NM_006202 NM_006283 NM_006358 NM_006371 NM_006421 NM_006432 NM_006464 NM_006500 NM_006504 NM_006505 NM_006515 NM_006544 NM_006553 NM_006620 NM_006628 NM_006661 NM_006668 NM_006674 NM_006693 NM_006732 NM_006742 NM_006761 NM_006805 NM_006827 NM_006855 NM_006862 NM_006884 NM_006888 NM_006892 NM_006922 NM_006925 NM_006990 NM_006999 NM_007005 NM_007007 NM_007039 NM_007073 NM_007136 NM_007146 NM_007168 NM_007203 NM_007222 NM_007249 NM_007283 NM_007318 NM_007338 NM_007351 NM_007353 NM_012105 NM_012161 NM_012193 NM_012196 NM_012197 NM_012219 NM_012258 NM_012281 NM_012297 NM_012304 NM_012309 NM_012463 NM_013231 NM_013244 NM_013252 NM_013279 NM_013286 NM_013357 NM_013363 NM_014045 NM_014048 NM_014112 NM_014187 NM_014243 NM_014263 NM_014305 NM_014335 NM_014344 NM_014394 NM_014405 NM_014431 NM_014468 NM_014478 NM_014556 NM_014563 NM_014573 NM_014614 NM_014642 NM_014665 NM_014667 NM_014678 NM_014689 NM_014737 NM_014746 NM_014747 NM_014751 NM_014767 NM_014782 NM_014786 NM_014795 NM_014809 NM_014826 NM_014867 NM_014869 NM_014910 NM_014919 NM_014944 NM_014951 NM_014953 NM_014967 NM_015002 NM_015022 NM_015033 NM_015052 NM_015056 NM_015124 NM_015143 NM_015144 NM_015206 NM_015214 NM_015224 NM_015253 NM_015267 NM_015272 NM_015310 NM_015332 NM_015353 NM_015393 NM_015409 NM_015463 NM_015532 NM_015565 NM_015569 NM_015577 NM_015691 NM_015695 NM_015702 NM_015938 NM_015980 NM_016011 NM_016018 NM_016061 NM_016138 NM_016144 NM_016145 NM_016169 NM_016173 NM_016221 NM_016224 NM_016235 NM_016377 NM_016436 NM_016442 NM_016447 NM_016507 NM_016611 NM_016651 NM_016936 NM_017415 NM_017491 NM_017495 NM_017548 NM_017629 NM_017635 NM_017652 NM_017668 NM_017798 NM_017803 NM_017824 NM_018043 NM_018048 NM_018061 NM_018069 NM_018088 NM_018105 NM_018114 NM_018176 NM_018191 NM_018200 NM_018209 NM_018210 NM_018212 NM_018247 NM_018275 NM_018316 NM_018340 NM_018361 NM_018374 NM_018375 NM_018381 NM_018396 NM_018445 NM_018450 NM_018482 NM_018638 NM_018639 NM_018646 NM_018658 NM_018702 NM_018717 NM_018719 NM_018941 NM_019014 NM_019025 NM_019036 NM_019041 NM_019063 NM_019083 NM_019099 NM_019594 NM_020038 NM_020148 NM_020150 NM_020154 NM_020165 NM_020193 NM_020237 NM_020251 NM_020310 NM_020313 NM_020315 NM_020338 NM_020381 NM_020398 NM_020422 NM_020673 NM_020689 NM_020698 NM_020708 NM_020739 NM_020773 NM_020779 NM_020781 NM_020791 NM_020796 NM_020803 NM_020845 NM_020857 NM_020873 NM_020879 NM_020918 NM_020988 NM_020993 NM_021008 NM_021083 NM_021106 NM_021123 NM_021126 NM_021181 NM_021187 NM_021202 NM_021269 NM_021619 NM_021622 NM_021649 NM_021912 NM_021927 NM_021949 NM_021977 NM_022049 NM_022080 NM_022085 NM_022089 NM_022112 NM_022148 NM_022447 NM_022452 NM_022471 NM_022482 NM_022484 NM_022735 NM_022755 NM_022834 NM_022898 NM_022905 NM_023002 NM_023010 NM_023940 NM_024114 NM_024293 NM_024296 NM_024315 NM_024327 NM_024512 NM_024513 NM_024586 NM_024619 NM_024633 NM_024645 NM_024665 NM_024667 NM_024671 NM_024674 NM_024676 NM_024738 NM_024757 NM_024761 NM_024806 NM_024830 NM_024906 NM_024923 NM_024952 NM_025010 NM_025040 NM_025076 NM_025164 NM_025196 NM_025230 NM_025243 NM_030621 NM_030629 NM_030781 NM_030791 NM_030796 NM_030810 NM_030821 NM_031310 NM_031410 NM_031453 NM_031475 NM_031858 NM_031862 NM_031886 NM_031889 NM_031954 NM_031988 NM_032012 NM_032129 NM_032144 NM_032178 NM_032195 NM_032214 NM_032289 NM_032310 NM_032352 NM_032466 NM_032468 NM_032581 NM_032737 NM_032822 NM_032826 NM_032832 NM_032866 NM_032873 NM_032874 NM_032899 NM_032901 NM_032906 NM_032924 NM_032932 NM_032933 NM_033067 NM_033118 NM_033129 NM_033254 NM_033348 NM_033389 NM_033446 NM_033455 NM_033456 NM_033535 NM_033624 NM_052859 NM_052884 NM_053056 NM_054016 NM_057175 NM_078467 NM_078471 NM_080551 NM_080604 NM_080605 NM_080632 NM_080723 NM_080738 NM_130386 NM_130435 NM_130795 NM_133330 NM_133331 NM_133332 NM_133333 NM_133335 NM_133373 NM_133646 NM_134427 NM_138338 NM_138415 NM_138444 NM_138576 NM_138633 NM_138774 NM_138991 NM_138992 NM_138999 NM_139021 NM_139131 NM_139135 NM_139283 NM_139312 NM_139321 NM_144488 NM_144489 NM_144618 NM_144626 NM_144642 NM_144682 NM_144683 NM_144691 NM_144692 NM_144778 NM_144981 NM_145039 NM_145061 NM_145117 NM_145185 NM_145263 NM_145649 NM_145655 NM_145861 NM_147147 NM_147150 NM_148904 NM_148905 NM_148906 NM_148907 NM_148908 NM_148909 NM_148957 NM_152225 NM_152280 NM_152302 NM_152309 NM_152372 NM_152376 NM_152390 NM_152411 NM_152424 NM_152450 NM_152475 NM_152482 NM_152571 NM_152597 NM_152632 NM_152684 NM_152701 NM_152713 NM_152760 NM_152793 NM_152879 NM_152903 NM_153034 NM_153038 NM_153246 NM_153256 NM_153464 NM_170686 NM_170741 NM_170742 NM_170773 NM_170774 NM_172217 NM_172346 NM_173075 NM_173171 NM_173172 NM_173173 NM_173353 NM_173357 NM_173505 NM_173509 NM_173511 NM_173599 NM_173611 NM_173646 NM_173650 NM_173651 NM_173654 NM_173661 NM_173669 NM_173674 NM_173795 NM_173823 NM_174911 NM_175077 NM_175567 NM_175568 NM_175569 NM_175609 NM_175729 NM_175739 NM_175839 NM_175840 NM_175841 NM_175842 NM_175848 NM_175849 NM_175850 NM_175864 NM_175872 NM_176084 NM_176085 NM_176086 NM_177438 NM_177537 NM_177550 NM_177553 NM_177949 NM_178140 NM_178423 NM_178448 NM_178516 NM_178582 NM_180989 NM_181291 NM_181357 NM_181481 NM_181482 NM_181483 NM_181492 NM_181502 NM_181581 NM_181706 NM_181716 NM_181725 NM_181825 NM_181846 NM_182476 NM_182480 NM_182503 NM_182526 NM_182531 NM_182562 NM_182605 NM_182712 NM_182760 NM_182832 NM_182898 NM_182899 NM_182907 NM_182918 NM_182964 NM_183078 NM_183425 NM_194286 NM_194290 NM_198053 NM_198066 NM_198256 NM_198257 NM_198258 NM_198325 NM_198390 NM_198394 NM_198484 NM_198530 NM_198539 NM_198553 NM_198554 NM_198563 NM_198682 NM_198723 NM_198896 NM_198926 NM_198974 NM_199003 NM_199121 NM_199367 NM_199443 NM_201348 NM_203291 NM_203318 NM_203342 NM_203343 NM_203372 NM_203394 NM_203504 NM_203505 NM_205860 NM_206853 NM_206854 NM_206855 NM_206876 NM_206877 NM_206909 NM_207117 NM_207283 NM_207304 NM_207330 NM_207331 NM_207385 NM_207426 NM_207459 NM_207462 NM_207486 NM_207500 NM_212535 NM_214677 NM_214678 NM_214679 XM_028810 XM_031553 XM_032901 XM_032996 XM_037523 XM_039515 XM_042936 XM_043493 XM_047355 XM_048898 XM_059929 XM_166132 XM_291007 XM_291016 XM_291095 XM_294521 XM_370839 XM_371009 XM_371132 XM_371254 XM_371354 XM_371823 XM_371933 XM_372193 XM_372273 XM_372584 XM_373290 XM_373578 XM_373742 XM_373779 XM_373827 XM_373831 XM_373850 XM_373873 XM_374341 XM_374343 XM_374491 XM_374902 XM_376062 XM_376165 XM_376550 XM_376586 XM_376616 XM_377076 XM_378219 XM_378250 XM_378327 XM_378529 XM_378661 XM_378700 XM_378708 XM_378858 XM_378971 XM_379079 XM_379118 XM_379391 XM_379434 XM_379454 XM_379456 XM_379515 XM_379518 XM_379547 XM_379656 XM_379798 XM_379843 XM_379844 XM_380139 XM_380143 XM_495807 XM_495844 XM_495873 XM_495902 XM_495984 XM_496272 XM_496603 XM_496637 XM_496766 XM_496966 XM_497080 XM_498513 XM_498534 XM_498540 XM_498580 XM_498614 XM_498620 XM_498754 XM_498825 XM_498954 XM_499051 XM_499063 XM_499093 XM_499111 XM_499142 XM_499155 XM_499512 XR_000182 XR_000217 XR_000273
Genes with multiple seed matches:
NM_000332 NM_000634 NM_000671 NM_000878 NM_001001418 NM_001001700 NM_001003794 NM_001008493 NM_001013670 NM_001013679 NM_001543 NM_003822 NM_005184 NM_005665 NM_006922 NM_007249 NM_007283 NM_014243 NM_014665 NM_015144 NM_015267 NM_015409 NM_017668 NM_017798 NM_018191 NM_018212 NM_018450 NM_020148 NM_020698 NM_020918 NM_021083 NM_024676 NM_030621 NM_031954 NM_032012 NM_144626 NM_152376 NM_152760 NM_173661 NM_174911 NM_177438 NM_205860 XM_371933 XM_374491 XM_379547
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)