VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacguacugccacaaaacagu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
7833
.
Total Genes with multiple seed matches:
2597
.
Genes with at least one seed match:
NM_000016 NM_000021 NM_000024 NM_000027 NM_000028 NM_000030 NM_000031 NM_000034 NM_000035 NM_000046 NM_000049 NM_000052 NM_000053 NM_000065 NM_000074 NM_000080 NM_000081 NM_000082 NM_000085 NM_000088 NM_000090 NM_000092 NM_000102 NM_000110 NM_000112 NM_000113 NM_000115 NM_000116 NM_000118 NM_000122 NM_000131 NM_000132 NM_000138 NM_000139 NM_000141 NM_000143 NM_000164 NM_000165 NM_000166 NM_000167 NM_000176 NM_000183 NM_000189 NM_000191 NM_000192 NM_000202 NM_000210 NM_000214 NM_000216 NM_000220 NM_000222 NM_000232 NM_000233 NM_000237 NM_000239 NM_000240 NM_000242 NM_000246 NM_000247 NM_000248 NM_000254 NM_000259 NM_000266 NM_000271 NM_000272 NM_000285 NM_000286 NM_000288 NM_000291 NM_000297 NM_000299 NM_000303 NM_000304 NM_000306 NM_000315 NM_000316 NM_000321 NM_000322 NM_000324 NM_000326 NM_000329 NM_000330 NM_000332 NM_000333 NM_000337 NM_000340 NM_000346 NM_000347 NM_000349 NM_000351 NM_000361 NM_000362 NM_000367 NM_000368 NM_000369 NM_000376 NM_000380 NM_000381 NM_000383 NM_000386 NM_000389 NM_000393 NM_000394 NM_000401 NM_000402 NM_000415 NM_000417 NM_000424 NM_000430 NM_000432 NM_000436 NM_000437 NM_000439 NM_000441 NM_000442 NM_000448 NM_000450 NM_000451 NM_000452 NM_000460 NM_000462 NM_000463 NM_000474 NM_000476 NM_000480 NM_000485 NM_000489 NM_000493 NM_000494 NM_000497 NM_000499 NM_000503 NM_000510 NM_000511 NM_000512 NM_000516 NM_000527 NM_000529 NM_000533 NM_000534 NM_000543 NM_000553 NM_000554 NM_000555 NM_000557 NM_000560 NM_000565 NM_000566 NM_000573 NM_000579 NM_000584 NM_000585 NM_000587 NM_000588 NM_000595 NM_000598 NM_000602 NM_000610 NM_000611 NM_000612 NM_000614 NM_000616 NM_000617 NM_000618 NM_000621 NM_000623 NM_000627 NM_000628 NM_000629 NM_000633 NM_000635 NM_000641 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000647 NM_000655 NM_000658 NM_000659 NM_000661 NM_000662 NM_000664 NM_000668 NM_000671 NM_000673 NM_000674 NM_000676 NM_000680 NM_000681 NM_000694 NM_000706 NM_000720 NM_000721 NM_000725 NM_000732 NM_000739 NM_000745 NM_000746 NM_000759 NM_000762 NM_000764 NM_000766 NM_000767 NM_000781 NM_000786 NM_000787 NM_000791 NM_000792 NM_000794 NM_000798 NM_000800 NM_000803 NM_000807 NM_000809 NM_000810 NM_000816 NM_000831 NM_000833 NM_000838 NM_000840 NM_000842 NM_000843 NM_000844 NM_000849 NM_000854 NM_000872 NM_000874 NM_000875 NM_000876 NM_000877 NM_000885 NM_000890 NM_000891 NM_000896 NM_000901 NM_000902 NM_000907 NM_000908 NM_000911 NM_000916 NM_000917 NM_000921 NM_000930 NM_000931 NM_000933 NM_000934 NM_000935 NM_000943 NM_000944 NM_000947 NM_000950 NM_000956 NM_000959 NM_000961 NM_000962 NM_000963 NM_000965 NM_000966 NM_000971 NM_000983 NM_000991 NM_000997 NM_000998 NM_001001290 NM_001001323 NM_001001331 NM_001001342 NM_001001343 NM_001001344 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001411 NM_001001412 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001436 NM_001001437 NM_001001481 NM_001001482 NM_001001484 NM_001001485 NM_001001486 NM_001001487 NM_001001523 NM_001001549 NM_001001550 NM_001001551 NM_001001555 NM_001001660 NM_001001664 NM_001001665 NM_001001669 NM_001001671 NM_001001675 NM_001001677 NM_001001679 NM_001001684 NM_001001685 NM_001001686 NM_001001687 NM_001001688 NM_001001690 NM_001001692 NM_001001696 NM_001001698 NM_001001702 NM_001001704 NM_001001707 NM_001001709 NM_001001710 NM_001001711 NM_001001713 NM_001001740 NM_001001789 NM_001001871 NM_001001878 NM_001001890 NM_001001894 NM_001001895 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001936 NM_001001971 NM_001001974 NM_001001976 NM_001002000 NM_001002001 NM_001002002 NM_001002006 NM_001002014 NM_001002015 NM_001002026 NM_001002032 NM_001002033 NM_001002231 NM_001002232 NM_001002233 NM_001002254 NM_001002255 NM_001002260 NM_001002261 NM_001002262 NM_001002265 NM_001002266 NM_001002269 NM_001002762 NM_001002814 NM_001002838 NM_001002841 NM_001002843 NM_001002844 NM_001002848 NM_001002849 NM_001002857 NM_001002858 NM_001002860 NM_001002861 NM_001002862 NM_001002881 NM_001002909 NM_001002919 NM_001002920 NM_001002926 NM_001003398 NM_001003399 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003674 NM_001003675 NM_001003678 NM_001003679 NM_001003681 NM_001003682 NM_001003684 NM_001003686 NM_001003687 NM_001003689 NM_001003694 NM_001003698 NM_001003699 NM_001003712 NM_001003796 NM_001003800 NM_001003807 NM_001003812 NM_001003818 NM_001003845 NM_001003894 NM_001003937 NM_001003938 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001004053 NM_001004054 NM_001004125 NM_001004127 NM_001004196 NM_001004197 NM_001004298 NM_001004299 NM_001004302 NM_001004303 NM_001004306 NM_001004307 NM_001004308 NM_001004313 NM_001004315 NM_001004317 NM_001004320 NM_001004322 NM_001004326 NM_001004328 NM_001004330 NM_001004335 NM_001004336 NM_001004343 NM_001004346 NM_001004352 NM_001004355 NM_001004360 NM_001004417 NM_001004421 NM_001004422 NM_001004432 NM_001004439 NM_001004441 NM_001004720 NM_001004722 NM_001005158 NM_001005159 NM_001005210 NM_001005242 NM_001005266 NM_001005267 NM_001005268 NM_001005269 NM_001005303 NM_001005336 NM_001005337 NM_001005339 NM_001005359 NM_001005364 NM_001005365 NM_001005375 NM_001005376 NM_001005377 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005409 NM_001005410 NM_001005411 NM_001005463 NM_001005473 NM_001005502 NM_001005505 NM_001005527 NM_001005609 NM_001005611 NM_001005736 NM_001005739 NM_001005743 NM_001005744 NM_001005745 NM_001005753 NM_001005785 NM_001005786 NM_001005845 NM_001005849 NM_001005861 NM_001005862 NM_001005918 NM_001005920 NM_001006115 NM_001006600 NM_001006603 NM_001006604 NM_001006606 NM_001006610 NM_001006616 NM_001006617 NM_001006619 NM_001006620 NM_001006621 NM_001006624 NM_001006625 NM_001006626 NM_001006627 NM_001006628 NM_001006629 NM_001006630 NM_001006631 NM_001006632 NM_001006633 NM_001006635 NM_001006636 NM_001006637 NM_001006657 NM_001006665 NM_001006666 NM_001006935 NM_001006936 NM_001006937 NM_001007024 NM_001007025 NM_001007067 NM_001007068 NM_001007069 NM_001007070 NM_001007075 NM_001007088 NM_001007094 NM_001007097 NM_001007099 NM_001007100 NM_001007102 NM_001007169 NM_001007214 NM_001007225 NM_001007226 NM_001007227 NM_001007228 NM_001007229 NM_001007230 NM_001007233 NM_001007243 NM_001007246 NM_001007247 NM_001007248 NM_001007250 NM_001007254 NM_001007262 NM_001007271 NM_001007272 NM_001007273 NM_001007274 NM_001007275 NM_001007278 NM_001007466 NM_001007525 NM_001007535 NM_001007544 NM_001007546 NM_001007559 NM_001007563 NM_001007593 NM_001008 NM_001008211 NM_001008212 NM_001008213 NM_001008215 NM_001008220 NM_001008223 NM_001008225 NM_001008235 NM_001008236 NM_001008239 NM_001008389 NM_001008390 NM_001008392 NM_001008393 NM_001008405 NM_001008406 NM_001008407 NM_001008408 NM_001008410 NM_001008485 NM_001008486 NM_001008487 NM_001008491 NM_001008492 NM_001008493 NM_001008494 NM_001008495 NM_001008529 NM_001008537 NM_001008539 NM_001008541 NM_001008544 NM_001008563 NM_001008564 NM_001008566 NM_001008697 NM_001008707 NM_001008710 NM_001008711 NM_001008726 NM_001008736 NM_001008738 NM_001008742 NM_001008745 NM_001008756 NM_001008779 NM_001008781 NM_001008860 NM_001008892 NM_001008894 NM_001008895 NM_001008925 NM_001008938 NM_001008949 NM_001009551 NM_001009553 NM_001009555 NM_001009566 NM_001009569 NM_001009598 NM_001009610 NM_001009612 NM_001009883 NM_001009894 NM_001009899 NM_001009909 NM_001009913 NM_001009922 NM_001009956 NM_001009959 NM_001009960 NM_001010846 NM_001010853 NM_001010862 NM_001010867 NM_001010870 NM_001010874 NM_001010875 NM_001010882 NM_001010883 NM_001010888 NM_001010891 NM_001010895 NM_001010898 NM_001010903 NM_001010909 NM_001010910 NM_001010915 NM_001010918 NM_001010925 NM_001010926 NM_001010971 NM_001010980 NM_001010984 NM_001010986 NM_001010989 NM_001010990 NM_001011513 NM_001011514 NM_001011537 NM_001011539 NM_001011544 NM_001011546 NM_001011547 NM_001011552 NM_001011553 NM_001011656 NM_001011657 NM_001011664 NM_001011666 NM_001011703 NM_001011885 NM_001012239 NM_001012267 NM_001012274 NM_001012279 NM_001012320 NM_001012329 NM_001012339 NM_001012393 NM_001012409 NM_001012411 NM_001012413 NM_001012418 NM_001012419 NM_001012420 NM_001012421 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012452 NM_001012478 NM_001012506 NM_001012509 NM_001012511 NM_001012626 NM_001012642 NM_001012651 NM_001012659 NM_001012711 NM_001012714 NM_001012729 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012754 NM_001012755 NM_001012756 NM_001012761 NM_001012763 NM_001012957 NM_001012960 NM_001012969 NM_001012981 NM_001012982 NM_001012988 NM_001013 NM_001013000 NM_001013005 NM_001013031 NM_001013398 NM_001013406 NM_001013415 NM_001013619 NM_001013621 NM_001013622 NM_001013625 NM_001013633 NM_001013640 NM_001013649 NM_001013656 NM_001013665 NM_001013666 NM_001013667 NM_001013672 NM_001013674 NM_001013675 NM_001013677 NM_001013679 NM_001013680 NM_001013681 NM_001013682 NM_001013683 NM_001013687 NM_001013688 NM_001013691 NM_001013693 NM_001013703 NM_001013704 NM_001013706 NM_001013710 NM_001013716 NM_001013719 NM_001013721 NM_001013723 NM_001013724 NM_001013726 NM_001013734 NM_001013839 NM_001013845 NM_001014286 NM_001014342 NM_001014373 NM_001014374 NM_001014380 NM_001014765 NM_001014797 NM_001014987 NM_001014988 NM_001014989 NM_001015048 NM_001015049 NM_001015877 NM_001015880 NM_001015882 NM_001015883 NM_001015886 NM_001017368 NM_001017370 NM_001017372 NM_001017392 NM_001017395 NM_001017396 NM_001017408 NM_001017420 NM_001017424 NM_001017425 NM_001017520 NM_001017523 NM_001017524 NM_001017535 NM_001017915 NM_001017920 NM_001017922 NM_001017924 NM_001017926 NM_001017956 NM_001017957 NM_001017958 NM_001017961 NM_001017962 NM_001017970 NM_001017972 NM_001017980 NM_001018008 NM_001018009 NM_001018011 NM_001018025 NM_001018036 NM_001018037 NM_001018055 NM_001018057 NM_001018058 NM_001018061 NM_001018062 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018072 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018080 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018104 NM_001018111 NM_001018112 NM_001018113 NM_001018116 NM_001018122 NM_001020 NM_001023560 NM_001023563 NM_001023565 NM_001023566 NM_001023567 NM_001023582 NM_001023587 NM_001024094 NM_001024216 NM_001024372 NM_001024380 NM_001024381 NM_001024401 NM_001024457 NM_001024460 NM_001024592 NM_001024631 NM_001024649 NM_001024657 NM_001024667 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024676 NM_001024680 NM_001024681 NM_001024688 NM_001024733 NM_001024808 NM_001024843 NM_001024847 NM_001024855 NM_001024916 NM_001024921 NM_001024933 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025081 NM_001025090 NM_001025091 NM_001025092 NM_001025094 NM_001025096 NM_001025097 NM_001025098 NM_001025100 NM_001025101 NM_001025108 NM_001025109 NM_001025201 NM_001025233 NM_001025234 NM_001025235 NM_001025236 NM_001025237 NM_001025238 NM_001025239 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001034 NM_001036 NM_001043 NM_001047 NM_001049 NM_001056 NM_001059 NM_001072 NM_001080 NM_001082 NM_001090 NM_001093 NM_001094 NM_001096 NM_001103 NM_001110 NM_001114 NM_001116 NM_001121 NM_001125 NM_001127 NM_001131 NM_001141 NM_001146 NM_001147 NM_001148 NM_001149 NM_001158 NM_001159 NM_001165 NM_001167 NM_001172 NM_001173 NM_001174 NM_001177 NM_001186 NM_001189 NM_001196 NM_001204 NM_001206 NM_001211 NM_001219 NM_001222 NM_001227 NM_001230 NM_001233 NM_001234 NM_001235 NM_001238 NM_001241 NM_001243 NM_001250 NM_001256 NM_001259 NM_001262 NM_001264 NM_001268 NM_001269 NM_001270 NM_001277 NM_001278 NM_001282 NM_001289 NM_001290 NM_001295 NM_001296 NM_001303 NM_001304 NM_001305 NM_001310 NM_001319 NM_001322 NM_001333 NM_001347 NM_001349 NM_001351 NM_001364 NM_001380 NM_001386 NM_001387 NM_001388 NM_001389 NM_001390 NM_001393 NM_001394 NM_001395 NM_001396 NM_001399 NM_001400 NM_001401 NM_001406 NM_001407 NM_001412 NM_001414 NM_001417 NM_001419 NM_001420 NM_001421 NM_001423 NM_001432 NM_001438 NM_001447 NM_001448 NM_001451 NM_001455 NM_001457 NM_001458 NM_001460 NM_001465 NM_001467 NM_001470 NM_001480 NM_001488 NM_001490 NM_001491 NM_001495 NM_001497 NM_001519 NM_001543 NM_001548 NM_001549 NM_001552 NM_001554 NM_001556 NM_001557 NM_001558 NM_001560 NM_001570 NM_001584 NM_001609 NM_001610 NM_001616 NM_001620 NM_001623 NM_001624 NM_001627 NM_001630 NM_001634 NM_001635 NM_001636 NM_001649 NM_001650 NM_001657 NM_001660 NM_001663 NM_001664 NM_001668 NM_001670 NM_001682 NM_001683 NM_001684 NM_001688 NM_001690 NM_001695 NM_001698 NM_001709 NM_001710 NM_001714 NM_001716 NM_001717 NM_001720 NM_001726 NM_001729 NM_001730 NM_001732 NM_001736 NM_001742 NM_001746 NM_001753 NM_001754 NM_001755 NM_001759 NM_001761 NM_001766 NM_001768 NM_001773 NM_001777 NM_001781 NM_001788 NM_001789 NM_001792 NM_001795 NM_001797 NM_001801 NM_001802 NM_001803 NM_001812 NM_001816 NM_001821 NM_001822 NM_001827 NM_001829 NM_001830 NM_001837 NM_001838 NM_001845 NM_001848 NM_001854 NM_001855 NM_001858 NM_001861 NM_001866 NM_001874 NM_001879 NM_001881 NM_001897 NM_001898 NM_001899 NM_001900 NM_001901 NM_001904 NM_001908 NM_001909 NM_001910 NM_001924 NM_001931 NM_001935 NM_001937 NM_001938 NM_001941 NM_001945 NM_001946 NM_001948 NM_001949 NM_001951 NM_001964 NM_001969 NM_001973 NM_001977 NM_001980 NM_001987 NM_001992 NM_001995 NM_002006 NM_002011 NM_002016 NM_002017 NM_002023 NM_002024 NM_002025 NM_002028 NM_002029 NM_002034 NM_002038 NM_002040 NM_002045 NM_002047 NM_002048 NM_002055 NM_002060 NM_002064 NM_002069 NM_002072 NM_002073 NM_002076 NM_002077 NM_002078 NM_002079 NM_002080 NM_002085 NM_002092 NM_002108 NM_002111 NM_002126 NM_002127 NM_002130 NM_002140 NM_002142 NM_002154 NM_002158 NM_002163 NM_002170 NM_002180 NM_002182 NM_002192 NM_002200 NM_002202 NM_002203 NM_002204 NM_002210 NM_002221 NM_002228 NM_002229 NM_002232 NM_002235 NM_002237 NM_002239 NM_002241 NM_002242 NM_002243 NM_002247 NM_002249 NM_002251 NM_002254 NM_002259 NM_002262 NM_002264 NM_002265 NM_002267 NM_002268 NM_002269 NM_002271 NM_002282 NM_002285 NM_002287 NM_002293 NM_002296 NM_002299 NM_002304 NM_002309 NM_002310 NM_002312 NM_002313 NM_002314 NM_002319 NM_002335 NM_002336 NM_002340 NM_002349 NM_002355 NM_002357 NM_002359 NM_002365 NM_002371 NM_002375 NM_002381 NM_002385 NM_002387 NM_002389 NM_002397 NM_002398 NM_002399 NM_002401 NM_002404 NM_002408 NM_002414 NM_002416 NM_002429 NM_002430 NM_002436 NM_002439 NM_002441 NM_002449 NM_002451 NM_002460 NM_002468 NM_002476 NM_002481 NM_002485 NM_002487 NM_002490 NM_002492 NM_002498 NM_002500 NM_002501 NM_002514 NM_002519 NM_002523 NM_002524 NM_002526 NM_002531 NM_002532 NM_002535 NM_002543 NM_002545 NM_002553 NM_002556 NM_002564 NM_002568 NM_002569 NM_002577 NM_002578 NM_002579 NM_002581 NM_002582 NM_002583 NM_002586 NM_002587 NM_002588 NM_002589 NM_002594 NM_002595 NM_002597 NM_002599 NM_002600 NM_002605 NM_002610 NM_002612 NM_002617 NM_002622 NM_002623 NM_002632 NM_002634 NM_002641 NM_002648 NM_002649 NM_002651 NM_002654 NM_002655 NM_002659 NM_002662 NM_002664 NM_002666 NM_002667 NM_002677 NM_002702 NM_002705 NM_002709 NM_002710 NM_002711 NM_002714 NM_002715 NM_002716 NM_002719 NM_002721 NM_002725 NM_002729 NM_002731 NM_002736 NM_002737 NM_002740 NM_002744 NM_002747 NM_002753 NM_002754 NM_002756 NM_002758 NM_002759 NM_002760 NM_002765 NM_002766 NM_002772 NM_002812 NM_002813 NM_002814 NM_002816 NM_002817 NM_002819 NM_002822 NM_002823 NM_002825 NM_002827 NM_002828 NM_002834 NM_002835 NM_002841 NM_002842 NM_002843 NM_002845 NM_002847 NM_002848 NM_002849 NM_002852 NM_002857 NM_002871 NM_002874 NM_002875 NM_002878 NM_002879 NM_002880 NM_002881 NM_002886 NM_002894 NM_002895 NM_002897 NM_002898 NM_002906 NM_002911 NM_002912 NM_002913 NM_002919 NM_002920 NM_002922 NM_002925 NM_002927 NM_002938 NM_002942 NM_002945 NM_002946 NM_002953 NM_002955 NM_002956 NM_002958 NM_002959 NM_002968 NM_002971 NM_002979 NM_002983 NM_002990 NM_002993 NM_002994 NM_003006 NM_003010 NM_003012 NM_003014 NM_003016 NM_003017 NM_003021 NM_003022 NM_003023 NM_003025 NM_003026 NM_003029 NM_003031 NM_003034 NM_003035 NM_003037 NM_003039 NM_003045 NM_003046 NM_003053 NM_003054 NM_003058 NM_003059 NM_003060 NM_003068 NM_003071 NM_003072 NM_003079 NM_003081 NM_003084 NM_003088 NM_003093 NM_003094 NM_003098 NM_003104 NM_003106 NM_003108 NM_003112 NM_003113 NM_003118 NM_003119 NM_003131 NM_003135 NM_003136 NM_003137 NM_003145 NM_003149 NM_003150 NM_003152 NM_003155 NM_003156 NM_003157 NM_003161 NM_003162 NM_003165 NM_003170 NM_003174 NM_003178 NM_003179 NM_003183 NM_003185 NM_003188 NM_003199 NM_003200 NM_003203 NM_003205 NM_003217 NM_003221 NM_003222 NM_003234 NM_003236 NM_003240 NM_003242 NM_003244 NM_003246 NM_003247 NM_003249 NM_003255 NM_003256 NM_003262 NM_003263 NM_003264 NM_003266 NM_003269 NM_003271 NM_003274 NM_003281 NM_003285 NM_003288 NM_003290 NM_003304 NM_003310 NM_003315 NM_003316 NM_003317 NM_003328 NM_003330 NM_003337 NM_003338 NM_003339 NM_003341 NM_003343 NM_003347 NM_003349 NM_003350 NM_003356 NM_003359 NM_003361 NM_003362 NM_003363 NM_003369 NM_003371 NM_003372 NM_003377 NM_003379 NM_003380 NM_003385 NM_003387 NM_003388 NM_003392 NM_003393 NM_003394 NM_003399 NM_003400 NM_003401 NM_003404 NM_003413 NM_003417 NM_003418 NM_003419 NM_003421 NM_003422 NM_003423 NM_003433 NM_003435 NM_003436 NM_003437 NM_003438 NM_003439 NM_003440 NM_003441 NM_003449 NM_003451 NM_003452 NM_003453 NM_003454 NM_003458 NM_003463 NM_003466 NM_003470 NM_003471 NM_003472 NM_003474 NM_003476 NM_003478 NM_003479 NM_003483 NM_003484 NM_003486 NM_003488 NM_003489 NM_003490 NM_003494 NM_003496 NM_003505 NM_003506 NM_003507 NM_003557 NM_003559 NM_003563 NM_003574 NM_003581 NM_003587 NM_003589 NM_003590 NM_003595 NM_003597 NM_003605 NM_003622 NM_003627 NM_003629 NM_003630 NM_003631 NM_003637 NM_003640 NM_003642 NM_003643 NM_003644 NM_003647 NM_003648 NM_003653 NM_003661 NM_003663 NM_003668 NM_003670 NM_003671 NM_003672 NM_003676 NM_003679 NM_003680 NM_003681 NM_003692 NM_003693 NM_003705 NM_003708 NM_003711 NM_003713 NM_003714 NM_003718 NM_003722 NM_003724 NM_003725 NM_003728 NM_003735 NM_003736 NM_003740 NM_003743 NM_003744 NM_003749 NM_003750 NM_003759 NM_003760 NM_003763 NM_003766 NM_003774 NM_003778 NM_003783 NM_003787 NM_003789 NM_003794 NM_003800 NM_003803 NM_003805 NM_003806 NM_003809 NM_003810 NM_003816 NM_003820 NM_003822 NM_003830 NM_003837 NM_003838 NM_003840 NM_003848 NM_003850 NM_003851 NM_003855 NM_003856 NM_003861 NM_003866 NM_003872 NM_003873 NM_003874 NM_003877 NM_003882 NM_003884 NM_003885 NM_003887 NM_003889 NM_003895 NM_003898 NM_003899 NM_003901 NM_003902 NM_003904 NM_003909 NM_003913 NM_003916 NM_003921 NM_003930 NM_003933 NM_003938 NM_003939 NM_003950 NM_003953 NM_003954 NM_003955 NM_003957 NM_003968 NM_003971 NM_003979 NM_003995 NM_003999 NM_004004 NM_004019 NM_004028 NM_004036 NM_004039 NM_004044 NM_004050 NM_004051 NM_004053 NM_004060 NM_004061 NM_004063 NM_004064 NM_004066 NM_004070 NM_004075 NM_004079 NM_004081 NM_004085 NM_004088 NM_004090 NM_004091 NM_004093 NM_004094 NM_004096 NM_004100 NM_004101 NM_004105 NM_004110 NM_004113 NM_004114 NM_004117 NM_004124 NM_004128 NM_004133 NM_004155 NM_004157 NM_004161 NM_004162 NM_004164 NM_004170 NM_004171 NM_004172 NM_004177 NM_004180 NM_004186 NM_004193 NM_004200 NM_004210 NM_004213 NM_004227 NM_004229 NM_004236 NM_004253 NM_004254 NM_004257 NM_004264 NM_004268 NM_004270 NM_004272 NM_004273 NM_004274 NM_004279 NM_004287 NM_004288 NM_004293 NM_004302 NM_004311 NM_004314 NM_004315 NM_004316 NM_004319 NM_004321 NM_004329 NM_004330 NM_004331 NM_004332 NM_004337 NM_004338 NM_004339 NM_004341 NM_004346 NM_004349 NM_004350 NM_004354 NM_004367 NM_004370 NM_004376 NM_004379 NM_004384 NM_004392 NM_004393 NM_004394 NM_004398 NM_004403 NM_004404 NM_004414 NM_004426 NM_004427 NM_004428 NM_004429 NM_004430 NM_004431 NM_004432 NM_004434 NM_004436 NM_004437 NM_004438 NM_004439 NM_004441 NM_004442 NM_004444 NM_004447 NM_004448 NM_004454 NM_004456 NM_004459 NM_004462 NM_004463 NM_004464 NM_004466 NM_004480 NM_004487 NM_004488 NM_004496 NM_004504 NM_004505 NM_004508 NM_004513 NM_004516 NM_004523 NM_004525 NM_004527 NM_004533 NM_004536 NM_004538 NM_004543 NM_004544 NM_004549 NM_004554 NM_004561 NM_004562 NM_004564 NM_004566 NM_004567 NM_004569 NM_004571 NM_004572 NM_004575 NM_004585 NM_004586 NM_004588 NM_004590 NM_004593 NM_004594 NM_004598 NM_004602 NM_004612 NM_004613 NM_004619 NM_004620 NM_004621 NM_004634 NM_004641 NM_004643 NM_004657 NM_004660 NM_004661 NM_004663 NM_004664 NM_004666 NM_004668 NM_004670 NM_004672 NM_004685 NM_004686 NM_004687 NM_004702 NM_004703 NM_004707 NM_004709 NM_004711 NM_004715 NM_004717 NM_004729 NM_004730 NM_004731 NM_004733 NM_004734 NM_004735 NM_004736 NM_004738 NM_004739 NM_004744 NM_004745 NM_004747 NM_004753 NM_004757 NM_004759 NM_004760 NM_004764 NM_004766 NM_004772 NM_004774 NM_004775 NM_004776 NM_004778 NM_004781 NM_004782 NM_004788 NM_004789 NM_004796 NM_004797 NM_004798 NM_004800 NM_004801 NM_004803 NM_004805 NM_004807 NM_004809 NM_004814 NM_004816 NM_004820 NM_004823 NM_004824 NM_004827 NM_004830 NM_004834 NM_004837 NM_004840 NM_004842 NM_004844 NM_004847 NM_004848 NM_004849 NM_004859 NM_004862 NM_004863 NM_004864 NM_004869 NM_004871 NM_004873 NM_004874 NM_004886 NM_004887 NM_004892 NM_004896 NM_004897 NM_004898 NM_004900 NM_004904 NM_004912 NM_004915 NM_004921 NM_004926 NM_004929 NM_004934 NM_004938 NM_004939 NM_004941 NM_004949 NM_004956 NM_004958 NM_004959 NM_004961 NM_004962 NM_004973 NM_004983 NM_004985 NM_004987 NM_004992 NM_004998 NM_005008 NM_005010 NM_005017 NM_005020 NM_005023 NM_005025 NM_005026 NM_005028 NM_005030 NM_005032 NM_005034 NM_005036 NM_005042 NM_005044 NM_005045 NM_005047 NM_005053 NM_005060 NM_005063 NM_005064 NM_005065 NM_005067 NM_005069 NM_005074 NM_005076 NM_005079 NM_005081 NM_005082 NM_005085 NM_005086 NM_005088 NM_005093 NM_005095 NM_005100 NM_005102 NM_005103 NM_005105 NM_005107 NM_005108 NM_005110 NM_005113 NM_005116 NM_005117 NM_005118 NM_005126 NM_005127 NM_005139 NM_005144 NM_005149 NM_005153 NM_005157 NM_005160 NM_005164 NM_005180 NM_005181 NM_005184 NM_005185 NM_005187 NM_005188 NM_005197 NM_005199 NM_005201 NM_005202 NM_005207 NM_005215 NM_005219 NM_005220 NM_005224 NM_005226 NM_005228 NM_005230 NM_005232 NM_005235 NM_005239 NM_005256 NM_005257 NM_005259 NM_005264 NM_005266 NM_005271 NM_005272 NM_005277 NM_005282 NM_005284 NM_005296 NM_005310 NM_005311 NM_005312 NM_005316 NM_005324 NM_005327 NM_005329 NM_005333 NM_005334 NM_005338 NM_005342 NM_005355 NM_005359 NM_005366 NM_005373 NM_005374 NM_005376 NM_005380 NM_005382 NM_005385 NM_005388 NM_005397 NM_005399 NM_005400 NM_005401 NM_005407 NM_005409 NM_005412 NM_005417 NM_005419 NM_005426 NM_005429 NM_005430 NM_005431 NM_005433 NM_005435 NM_005436 NM_005437 NM_005443 NM_005446 NM_005458 NM_005459 NM_005461 NM_005463 NM_005465 NM_005467 NM_005470 NM_005472 NM_005475 NM_005477 NM_005487 NM_005491 NM_005494 NM_005499 NM_005501 NM_005502 NM_005503 NM_005504 NM_005506 NM_005507 NM_005509 NM_005512 NM_005513 NM_005515 NM_005516 NM_005522 NM_005524 NM_005526 NM_005530 NM_005536 NM_005541 NM_005542 NM_005544 NM_005545 NM_005546 NM_005551 NM_005565 NM_005569 NM_005570 NM_005574 NM_005584 NM_005593 NM_005595 NM_005596 NM_005598 NM_005604 NM_005607 NM_005625 NM_005628 NM_005630 NM_005634 NM_005637 NM_005638 NM_005639 NM_005646 NM_005647 NM_005649 NM_005650 NM_005656 NM_005658 NM_005665 NM_005667 NM_005668 NM_005669 NM_005670 NM_005679 NM_005701 NM_005708 NM_005709 NM_005715 NM_005722 NM_005725 NM_005730 NM_005733 NM_005736 NM_005739 NM_005741 NM_005746 NM_005748 NM_005752 NM_005756 NM_005766 NM_005769 NM_005776 NM_005779 NM_005780 NM_005782 NM_005792 NM_005795 NM_005797 NM_005798 NM_005801 NM_005802 NM_005806 NM_005807 NM_005808 NM_005810 NM_005813 NM_005816 NM_005819 NM_005822 NM_005827 NM_005828 NM_005829 NM_005831 NM_005832 NM_005839 NM_005840 NM_005842 NM_005843 NM_005848 NM_005853 NM_005857 NM_005859 NM_005862 NM_005870 NM_005877 NM_005879 NM_005883 NM_005885 NM_005895 NM_005901 NM_005902 NM_005903 NM_005909 NM_005911 NM_005923 NM_005924 NM_005931 NM_005933 NM_005935 NM_005941 NM_005942 NM_005943 NM_005944 NM_005949 NM_005951 NM_005962 NM_005964 NM_005965 NM_005966 NM_005981 NM_005989 NM_005990 NM_006000 NM_006005 NM_006006 NM_006010 NM_006011 NM_006013 NM_006015 NM_006018 NM_006020 NM_006025 NM_006026 NM_006030 NM_006037 NM_006040 NM_006047 NM_006052 NM_006056 NM_006060 NM_006067 NM_006068 NM_006079 NM_006085 NM_006089 NM_006092 NM_006094 NM_006096 NM_006097 NM_006099 NM_006106 NM_006107 NM_006108 NM_006111 NM_006113 NM_006116 NM_006120 NM_006121 NM_006122 NM_006134 NM_006135 NM_006138 NM_006139 NM_006141 NM_006143 NM_006148 NM_006149 NM_006154 NM_006155 NM_006160 NM_006166 NM_006167 NM_006178 NM_006183 NM_006187 NM_006190 NM_006193 NM_006203 NM_006206 NM_006208 NM_006212 NM_006214 NM_006216 NM_006218 NM_006226 NM_006228 NM_006235 NM_006237 NM_006240 NM_006241 NM_006242 NM_006246 NM_006249 NM_006251 NM_006252 NM_006253 NM_006255 NM_006256 NM_006257 NM_006258 NM_006265 NM_006268 NM_006275 NM_006277 NM_006282 NM_006283 NM_006289 NM_006290 NM_006291 NM_006294 NM_006298 NM_006306 NM_006309 NM_006310 NM_006313 NM_006315 NM_006321 NM_006325 NM_006327 NM_006335 NM_006340 NM_006345 NM_006352 NM_006353 NM_006355 NM_006359 NM_006364 NM_006366 NM_006367 NM_006369 NM_006371 NM_006372 NM_006373 NM_006375 NM_006379 NM_006387 NM_006390 NM_006393 NM_006401 NM_006404 NM_006407 NM_006413 NM_006421 NM_006439 NM_006446 NM_006449 NM_006452 NM_006454 NM_006457 NM_006460 NM_006464 NM_006465 NM_006469 NM_006474 NM_006481 NM_006492 NM_006493 NM_006496 NM_006504 NM_006505 NM_006516 NM_006517 NM_006520 NM_006522 NM_006527 NM_006531 NM_006532 NM_006534 NM_006538 NM_006544 NM_006545 NM_006546 NM_006547 NM_006548 NM_006549 NM_006550 NM_006554 NM_006557 NM_006559 NM_006561 NM_006564 NM_006572 NM_006575 NM_006580 NM_006591 NM_006595 NM_006598 NM_006599 NM_006602 NM_006603 NM_006604 NM_006605 NM_006606 NM_006609 NM_006610 NM_006612 NM_006613 NM_006614 NM_006618 NM_006620 NM_006624 NM_006626 NM_006627 NM_006628 NM_006631 NM_006636 NM_006641 NM_006646 NM_006650 NM_006656 NM_006658 NM_006661 NM_006665 NM_006667 NM_006673 NM_006674 NM_006676 NM_006697 NM_006699 NM_006701 NM_006706 NM_006707 NM_006710 NM_006720 NM_006722 NM_006729 NM_006731 NM_006734 NM_006735 NM_006738 NM_006741 NM_006742 NM_006746 NM_006748 NM_006749 NM_006752 NM_006753 NM_006754 NM_006756 NM_006761 NM_006762 NM_006763 NM_006764 NM_006766 NM_006772 NM_006773 NM_006775 NM_006777 NM_006781 NM_006786 NM_006788 NM_006789 NM_006790 NM_006791 NM_006794 NM_006801 NM_006803 NM_006812 NM_006813 NM_006814 NM_006815 NM_006818 NM_006820 NM_006827 NM_006830 NM_006831 NM_006836 NM_006841 NM_006847 NM_006850 NM_006857 NM_006859 NM_006862 NM_006867 NM_006870 NM_006873 NM_006880 NM_006881 NM_006888 NM_006889 NM_006895 NM_006902 NM_006903 NM_006904 NM_006905 NM_006914 NM_006915 NM_006916 NM_006922 NM_006929 NM_006930 NM_006931 NM_006936 NM_006937 NM_006941 NM_006942 NM_006943 NM_006946 NM_006947 NM_006951 NM_006953 NM_006955 NM_006961 NM_006962 NM_006965 NM_006974 NM_006980 NM_006981 NM_006984 NM_006987 NM_006990 NM_006992 NM_006994 NM_007001 NM_007007 NM_007010 NM_007011 NM_007013 NM_007014 NM_007018 NM_007030 NM_007031 NM_007035 NM_007036 NM_007040 NM_007041 NM_007043 NM_007048 NM_007050 NM_007053 NM_007054 NM_007065 NM_007068 NM_007070 NM_007072 NM_007073 NM_007076 NM_007078 NM_007079 NM_007085 NM_007107 NM_007108 NM_007111 NM_007115 NM_007120 NM_007121 NM_007130 NM_007135 NM_007137 NM_007144 NM_007145 NM_007146 NM_007150 NM_007151 NM_007157 NM_007159 NM_007165 NM_007167 NM_007173 NM_007175 NM_007176 NM_007177 NM_007178 NM_007182 NM_007185 NM_007187 NM_007197 NM_007199 NM_007200 NM_007202 NM_007203 NM_007210 NM_007211 NM_007212 NM_007213 NM_007214 NM_007216 NM_007218 NM_007220 NM_007222 NM_007224 NM_007229 NM_007235 NM_007236 NM_007245 NM_007246 NM_007247 NM_007249 NM_007250 NM_007261 NM_007262 NM_007271 NM_007279 NM_007282 NM_007287 NM_007288 NM_007289 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007309 NM_007313 NM_007318 NM_007328 NM_007331 NM_007332 NM_007334 NM_007335 NM_007336 NM_007338 NM_007341 NM_007345 NM_007348 NM_007350 NM_007351 NM_007353 NM_007359 NM_007360 NM_007366 NM_007368 NM_007370 NM_007373 NM_009590 NM_012062 NM_012069 NM_012072 NM_012073 NM_012074 NM_012075 NM_012081 NM_012083 NM_012086 NM_012089 NM_012091 NM_012093 NM_012096 NM_012098 NM_012099 NM_012102 NM_012104 NM_012105 NM_012121 NM_012125 NM_012129 NM_012137 NM_012143 NM_012153 NM_012156 NM_012158 NM_012171 NM_012174 NM_012184 NM_012192 NM_012193 NM_012199 NM_012203 NM_012204 NM_012210 NM_012211 NM_012213 NM_012215 NM_012219 NM_012224 NM_012225 NM_012229 NM_012234 NM_012237 NM_012239 NM_012249 NM_012252 NM_012257 NM_012261 NM_012262 NM_012269 NM_012275 NM_012279 NM_012286 NM_012287 NM_012288 NM_012290 NM_012297 NM_012300 NM_012301 NM_012304 NM_012306 NM_012307 NM_012308 NM_012309 NM_012311 NM_012323 NM_012325 NM_012327 NM_012329 NM_012333 NM_012334 NM_012342 NM_012345 NM_012381 NM_012384 NM_012393 NM_012395 NM_012397 NM_012402 NM_012405 NM_012406 NM_012409 NM_012416 NM_012425 NM_012431 NM_012433 NM_012434 NM_012443 NM_012445 NM_012452 NM_012455 NM_012461 NM_012464 NM_012465 NM_012470 NM_012474 NM_012477 NM_013230 NM_013231 NM_013252 NM_013253 NM_013255 NM_013257 NM_013262 NM_013268 NM_013272 NM_013275 NM_013276 NM_013282 NM_013285 NM_013286 NM_013309 NM_013313 NM_013316 NM_013325 NM_013328 NM_013336 NM_013345 NM_013349 NM_013351 NM_013354 NM_013357 NM_013367 NM_013372 NM_013374 NM_013375 NM_013381 NM_013387 NM_013388 NM_013390 NM_013393 NM_013397 NM_013400 NM_013402 NM_013423 NM_013427 NM_013435 NM_013441 NM_013444 NM_013447 NM_013450 NM_013951 NM_013952 NM_013953 NM_013956 NM_013964 NM_013987 NM_013988 NM_013992 NM_013999 NM_014005 NM_014007 NM_014009 NM_014011 NM_014014 NM_014015 NM_014016 NM_014021 NM_014023 NM_014031 NM_014034 NM_014035 NM_014039 NM_014043 NM_014048 NM_014049 NM_014050 NM_014057 NM_014058 NM_014062 NM_014066 NM_014077 NM_014089 NM_014096 NM_014106 NM_014117 NM_014138 NM_014141 NM_014143 NM_014146 NM_014154 NM_014155 NM_014157 NM_014164 NM_014171 NM_014178 NM_014182 NM_014184 NM_014188 NM_014191 NM_014203 NM_014207 NM_014208 NM_014213 NM_014217 NM_014231 NM_014233 NM_014236 NM_014242 NM_014243 NM_014250 NM_014263 NM_014268 NM_014271 NM_014280 NM_014286 NM_014296 NM_014301 NM_014310 NM_014319 NM_014324 NM_014325 NM_014333 NM_014336 NM_014338 NM_014342 NM_014344 NM_014349 NM_014351 NM_014353 NM_014354 NM_014358 NM_014364 NM_014365 NM_014368 NM_014369 NM_014374 NM_014379 NM_014387 NM_014388 NM_014393 NM_014394 NM_014395 NM_014396 NM_014397 NM_014406 NM_014412 NM_014415 NM_014418 NM_014421 NM_014429 NM_014431 NM_014432 NM_014438 NM_014442 NM_014445 NM_014454 NM_014455 NM_014462 NM_014468 NM_014469 NM_014472 NM_014473 NM_014474 NM_014478 NM_014479 NM_014488 NM_014489 NM_014499 NM_014503 NM_014505 NM_014506 NM_014517 NM_014518 NM_014547 NM_014548 NM_014552 NM_014553 NM_014554 NM_014562 NM_014564 NM_014572 NM_014573 NM_014574 NM_014580 NM_014583 NM_014586 NM_014588 NM_014592 NM_014594 NM_014601 NM_014607 NM_014613 NM_014614 NM_014616 NM_014620 NM_014622 NM_014625 NM_014629 NM_014631 NM_014634 NM_014636 NM_014637 NM_014644 NM_014646 NM_014647 NM_014653 NM_014656 NM_014663 NM_014665 NM_014668 NM_014670 NM_014671 NM_014674 NM_014679 NM_014682 NM_014683 NM_014685 NM_014690 NM_014693 NM_014700 NM_014701 NM_014702 NM_014703 NM_014704 NM_014707 NM_014719 NM_014721 NM_014723 NM_014728 NM_014729 NM_014730 NM_014732 NM_014733 NM_014734 NM_014735 NM_014737 NM_014739 NM_014743 NM_014744 NM_014746 NM_014747 NM_014752 NM_014755 NM_014756 NM_014757 NM_014759 NM_014760 NM_014761 NM_014762 NM_014765 NM_014767 NM_014772 NM_014773 NM_014776 NM_014781 NM_014786 NM_014787 NM_014788 NM_014789 NM_014792 NM_014793 NM_014797 NM_014800 NM_014802 NM_014803 NM_014804 NM_014805 NM_014808 NM_014809 NM_014810 NM_014811 NM_014812 NM_014819 NM_014820 NM_014821 NM_014824 NM_014828 NM_014829 NM_014830 NM_014835 NM_014836 NM_014837 NM_014844 NM_014847 NM_014850 NM_014854 NM_014858 NM_014860 NM_014862 NM_014864 NM_014867 NM_014868 NM_014869 NM_014870 NM_014871 NM_014872 NM_014873 NM_014876 NM_014879 NM_014880 NM_014886 NM_014890 NM_014893 NM_014898 NM_014899 NM_014901 NM_014903 NM_014904 NM_014906 NM_014908 NM_014909 NM_014910 NM_014917 NM_014918 NM_014919 NM_014923 NM_014924 NM_014932 NM_014934 NM_014935 NM_014936 NM_014940 NM_014944 NM_014946 NM_014949 NM_014951 NM_014953 NM_014954 NM_014959 NM_014961 NM_014962 NM_014965 NM_014967 NM_014978 NM_014985 NM_014988 NM_014991 NM_014992 NM_014997 NM_014999 NM_015001 NM_015003 NM_015008 NM_015009 NM_015015 NM_015020 NM_015022 NM_015023 NM_015025 NM_015027 NM_015032 NM_015033 NM_015035 NM_015039 NM_015040 NM_015044 NM_015045 NM_015049 NM_015051 NM_015052 NM_015053 NM_015055 NM_015056 NM_015061 NM_015070 NM_015071 NM_015075 NM_015076 NM_015077 NM_015079 NM_015082 NM_015085 NM_015087 NM_015088 NM_015090 NM_015092 NM_015094 NM_015097 NM_015100 NM_015101 NM_015113 NM_015115 NM_015116 NM_015124 NM_015130 NM_015137 NM_015138 NM_015143 NM_015144 NM_015148 NM_015149 NM_015158 NM_015169 NM_015170 NM_015172 NM_015173 NM_015178 NM_015180 NM_015185 NM_015192 NM_015194 NM_015198 NM_015200 NM_015205 NM_015206 NM_015208 NM_015210 NM_015214 NM_015215 NM_015216 NM_015219 NM_015224 NM_015225 NM_015226 NM_015227 NM_015229 NM_015234 NM_015235 NM_015238 NM_015246 NM_015250 NM_015251 NM_015253 NM_015257 NM_015263 NM_015265 NM_015266 NM_015267 NM_015271 NM_015272 NM_015278 NM_015282 NM_015285 NM_015286 NM_015288 NM_015293 NM_015294 NM_015296 NM_015310 NM_015314 NM_015318 NM_015323 NM_015328 NM_015329 NM_015332 NM_015335 NM_015336 NM_015342 NM_015346 NM_015347 NM_015352 NM_015355 NM_015358 NM_015359 NM_015369 NM_015375 NM_015378 NM_015383 NM_015384 NM_015385 NM_015387 NM_015391 NM_015393 NM_015394 NM_015396 NM_015397 NM_015409 NM_015411 NM_015416 NM_015429 NM_015434 NM_015436 NM_015440 NM_015443 NM_015446 NM_015455 NM_015458 NM_015463 NM_015464 NM_015477 NM_015493 NM_015497 NM_015506 NM_015510 NM_015526 NM_015532 NM_015534 NM_015550 NM_015553 NM_015556 NM_015558 NM_015560 NM_015564 NM_015567 NM_015568 NM_015569 NM_015570 NM_015576 NM_015578 NM_015584 NM_015590 NM_015605 NM_015608 NM_015621 NM_015633 NM_015635 NM_015640 NM_015641 NM_015654 NM_015655 NM_015666 NM_015678 NM_015680 NM_015683 NM_015685 NM_015689 NM_015691 NM_015695 NM_015713 NM_015715 NM_015726 NM_015852 NM_015881 NM_015886 NM_015891 NM_015892 NM_015898 NM_015901 NM_015910 NM_015920 NM_015922 NM_015932 NM_015936 NM_015938 NM_015946 NM_015947 NM_015958 NM_015960 NM_015971 NM_015975 NM_015982 NM_015987 NM_015989 NM_015990 NM_015994 NM_015995 NM_015997 NM_016018 NM_016019 NM_016021 NM_016025 NM_016026 NM_016029 NM_016038 NM_016040 NM_016042 NM_016045 NM_016046 NM_016057 NM_016061 NM_016070 NM_016072 NM_016076 NM_016079 NM_016080 NM_016081 NM_016082 NM_016087 NM_016103 NM_016105 NM_016107 NM_016114 NM_016118 NM_016120 NM_016124 NM_016125 NM_016126 NM_016129 NM_016131 NM_016132 NM_016133 NM_016134 NM_016138 NM_016143 NM_016152 NM_016169 NM_016176 NM_016185 NM_016201 NM_016205 NM_016206 NM_016221 NM_016224 NM_016225 NM_016235 NM_016237 NM_016240 NM_016243 NM_016245 NM_016248 NM_016255 NM_016257 NM_016260 NM_016264 NM_016267 NM_016269 NM_016271 NM_016272 NM_016281 NM_016282 NM_016284 NM_016289 NM_016298 NM_016308 NM_016312 NM_016315 NM_016321 NM_016322 NM_016329 NM_016340 NM_016341 NM_016351 NM_016364 NM_016369 NM_016370 NM_016377 NM_016382 NM_016389 NM_016396 NM_016401 NM_016406 NM_016408 NM_016423 NM_016424 NM_016428 NM_016433 NM_016436 NM_016441 NM_016442 NM_016445 NM_016451 NM_016464 NM_016467 NM_016470 NM_016472 NM_016482 NM_016485 NM_016488 NM_016505 NM_016507 NM_016516 NM_016520 NM_016522 NM_016525 NM_016530 NM_016531 NM_016534 NM_016536 NM_016539 NM_016540 NM_016542 NM_016544 NM_016546 NM_016547 NM_016548 NM_016557 NM_016559 NM_016562 NM_016563 NM_016565 NM_016575 NM_016576 NM_016577 NM_016578 NM_016591 NM_016592 NM_016607 NM_016612 NM_016613 NM_016614 NM_016617 NM_016620 NM_016621 NM_016622 NM_016626 NM_016628 NM_016639 NM_016642 NM_016643 NM_016648 NM_016651 NM_016653 NM_016733 NM_016734 NM_016735 NM_016818 NM_016824 NM_016831 NM_016836 NM_016839 NM_016930 NM_016937 NM_017410 NM_017413 NM_017415 NM_017418 NM_017420 NM_017423 NM_017437 NM_017443 NM_017444 NM_017447 NM_017449 NM_017450 NM_017452 NM_017453 NM_017454 NM_017460 NM_017520 NM_017523 NM_017540 NM_017541 NM_017542 NM_017545 NM_017546 NM_017551 NM_017556 NM_017563 NM_017565 NM_017569 NM_017577 NM_017580 NM_017583 NM_017584 NM_017588 NM_017590 NM_017592 NM_017594 NM_017610 NM_017611 NM_017623 NM_017626 NM_017628 NM_017629 NM_017631 NM_017635 NM_017637 NM_017640 NM_017643 NM_017644 NM_017645 NM_017646 NM_017649 NM_017651 NM_017654 NM_017655 NM_017661 NM_017664 NM_017665 NM_017666 NM_017678 NM_017680 NM_017684 NM_017688 NM_017691 NM_017692 NM_017694 NM_017699 NM_017704 NM_017705 NM_017709 NM_017711 NM_017712 NM_017713 NM_017719 NM_017724 NM_017725 NM_017727 NM_017729 NM_017736 NM_017739 NM_017740 NM_017742 NM_017744 NM_017748 NM_017752 NM_017757 NM_017758 NM_017760 NM_017761 NM_017762 NM_017769 NM_017770 NM_017771 NM_017778 NM_017779 NM_017780 NM_017786 NM_017787 NM_017790 NM_017794 NM_017798 NM_017801 NM_017803 NM_017810 NM_017812 NM_017817 NM_017818 NM_017821 NM_017822 NM_017825 NM_017836 NM_017847 NM_017851 NM_017853 NM_017856 NM_017857 NM_017864 NM_017865 NM_017866 NM_017869 NM_017918 NM_017919 NM_017922 NM_017923 NM_017924 NM_017927 NM_017929 NM_017933 NM_017935 NM_017938 NM_017944 NM_017948 NM_017952 NM_017956 NM_017975 NM_017982 NM_017994 NM_018000 NM_018008 NM_018011 NM_018014 NM_018015 NM_018017 NM_018018 NM_018019 NM_018027 NM_018031 NM_018035 NM_018043 NM_018045 NM_018048 NM_018050 NM_018051 NM_018055 NM_018057 NM_018061 NM_018069 NM_018076 NM_018078 NM_018079 NM_018084 NM_018086 NM_018089 NM_018091 NM_018099 NM_018101 NM_018103 NM_018105 NM_018108 NM_018110 NM_018115 NM_018116 NM_018121 NM_018122 NM_018126 NM_018127 NM_018128 NM_018131 NM_018135 NM_018137 NM_018141 NM_018150 NM_018153 NM_018156 NM_018167 NM_018168 NM_018170 NM_018171 NM_018176 NM_018178 NM_018179 NM_018181 NM_018184 NM_018191 NM_018194 NM_018195 NM_018196 NM_018199 NM_018200 NM_018202 NM_018204 NM_018205 NM_018210 NM_018211 NM_018212 NM_018214 NM_018221 NM_018224 NM_018227 NM_018229 NM_018234 NM_018235 NM_018239 NM_018241 NM_018242 NM_018244 NM_018245 NM_018246 NM_018247 NM_018257 NM_018263 NM_018267 NM_018270 NM_018272 NM_018276 NM_018280 NM_018283 NM_018285 NM_018290 NM_018293 NM_018295 NM_018299 NM_018306 NM_018307 NM_018308 NM_018312 NM_018315 NM_018322 NM_018323 NM_018325 NM_018327 NM_018328 NM_018339 NM_018340 NM_018342 NM_018353 NM_018362 NM_018363 NM_018364 NM_018367 NM_018371 NM_018373 NM_018374 NM_018375 NM_018382 NM_018383 NM_018388 NM_018399 NM_018401 NM_018404 NM_018407 NM_018409 NM_018420 NM_018425 NM_018427 NM_018439 NM_018440 NM_018443 NM_018444 NM_018450 NM_018452 NM_018453 NM_018463 NM_018466 NM_018469 NM_018475 NM_018476 NM_018479 NM_018482 NM_018485 NM_018486 NM_018489 NM_018490 NM_018498 NM_018509 NM_018518 NM_018538 NM_018553 NM_018555 NM_018559 NM_018561 NM_018566 NM_018579 NM_018590 NM_018602 NM_018607 NM_018646 NM_018649 NM_018650 NM_018652 NM_018655 NM_018658 NM_018659 NM_018662 NM_018663 NM_018667 NM_018672 NM_018684 NM_018695 NM_018697 NM_018700 NM_018704 NM_018706 NM_018708 NM_018710 NM_018712 NM_018717 NM_018719 NM_018725 NM_018727 NM_018728 NM_018834 NM_018836 NM_018837 NM_018839 NM_018840 NM_018841 NM_018842 NM_018844 NM_018846 NM_018847 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018930 NM_018941 NM_018947 NM_018961 NM_018963 NM_018964 NM_018970 NM_018976 NM_018977 NM_018981 NM_018983 NM_018990 NM_018992 NM_018993 NM_018998 NM_018999 NM_019000 NM_019001 NM_019011 NM_019012 NM_019014 NM_019018 NM_019021 NM_019022 NM_019027 NM_019029 NM_019035 NM_019044 NM_019049 NM_019058 NM_019059 NM_019063 NM_019069 NM_019071 NM_019075 NM_019076 NM_019077 NM_019078 NM_019080 NM_019081 NM_019084 NM_019087 NM_019089 NM_019091 NM_019093 NM_019094 NM_019106 NM_019114 NM_019117 NM_019118 NM_019119 NM_019555 NM_019556 NM_019590 NM_019595 NM_019605 NM_019606 NM_019610 NM_019616 NM_019849 NM_019859 NM_019860 NM_019863 NM_019885 NM_019903 NM_020041 NM_020062 NM_020063 NM_020066 NM_020119 NM_020120 NM_020121 NM_020125 NM_020128 NM_020129 NM_020130 NM_020131 NM_020133 NM_020141 NM_020142 NM_020143 NM_020144 NM_020149 NM_020150 NM_020151 NM_020152 NM_020155 NM_020156 NM_020161 NM_020163 NM_020165 NM_020169 NM_020177 NM_020179 NM_020180 NM_020186 NM_020193 NM_020194 NM_020198 NM_020207 NM_020208 NM_020210 NM_020211 NM_020212 NM_020213 NM_020215 NM_020223 NM_020233 NM_020235 NM_020237 NM_020243 NM_020245 NM_020248 NM_020300 NM_020310 NM_020319 NM_020335 NM_020337 NM_020338 NM_020340 NM_020341 NM_020345 NM_020346 NM_020347 NM_020348 NM_020361 NM_020363 NM_020364 NM_020367 NM_020375 NM_020378 NM_020381 NM_020384 NM_020390 NM_020398 NM_020399 NM_020405 NM_020416 NM_020420 NM_020422 NM_020424 NM_020429 NM_020432 NM_020440 NM_020442 NM_020443 NM_020445 NM_020447 NM_020448 NM_020451 NM_020453 NM_020456 NM_020458 NM_020463 NM_020465 NM_020468 NM_020472 NM_020473 NM_020474 NM_020526 NM_020546 NM_020550 NM_020630 NM_020632 NM_020638 NM_020640 NM_020644 NM_020645 NM_020648 NM_020655 NM_020661 NM_020673 NM_020676 NM_020684 NM_020689 NM_020695 NM_020698 NM_020699 NM_020702 NM_020703 NM_020704 NM_020708 NM_020711 NM_020715 NM_020717 NM_020724 NM_020727 NM_020728 NM_020734 NM_020742 NM_020745 NM_020746 NM_020748 NM_020749 NM_020750 NM_020751 NM_020755 NM_020761 NM_020764 NM_020766 NM_020768 NM_020769 NM_020774 NM_020776 NM_020777 NM_020779 NM_020781 NM_020782 NM_020783 NM_020786 NM_020787 NM_020791 NM_020792 NM_020795 NM_020796 NM_020800 NM_020802 NM_020803 NM_020804 NM_020805 NM_020808 NM_020809 NM_020813 NM_020817 NM_020819 NM_020821 NM_020825 NM_020826 NM_020830 NM_020832 NM_020834 NM_020839 NM_020841 NM_020850 NM_020856 NM_020858 NM_020860 NM_020861 NM_020863 NM_020866 NM_020868 NM_020870 NM_020880 NM_020886 NM_020893 NM_020896 NM_020897 NM_020899 NM_020903 NM_020909 NM_020914 NM_020917 NM_020918 NM_020921 NM_020922 NM_020926 NM_020927 NM_020933 NM_020935 NM_020936 NM_020940 NM_020948 NM_020960 NM_020970 NM_020977 NM_020980 NM_020982 NM_020987 NM_020988 NM_020993 NM_021005 NM_021006 NM_021026 NM_021027 NM_021030 NM_021032 NM_021033 NM_021035 NM_021038 NM_021045 NM_021047 NM_021061 NM_021064 NM_021067 NM_021076 NM_021079 NM_021088 NM_021090 NM_021094 NM_021095 NM_021101 NM_021107 NM_021110 NM_021111 NM_021116 NM_021127 NM_021133 NM_021136 NM_021137 NM_021144 NM_021145 NM_021146 NM_021147 NM_021151 NM_021155 NM_021161 NM_021165 NM_021167 NM_021181 NM_021183 NM_021197 NM_021200 NM_021201 NM_021202 NM_021204 NM_021205 NM_021212 NM_021215 NM_021216 NM_021222 NM_021224 NM_021227 NM_021229 NM_021235 NM_021239 NM_021240 NM_021242 NM_021249 NM_021252 NM_021253 NM_021255 NM_021260 NM_021615 NM_021620 NM_021622 NM_021629 NM_021632 NM_021635 NM_021637 NM_021638 NM_021641 NM_021643 NM_021645 NM_021649 NM_021706 NM_021722 NM_021723 NM_021734 NM_021738 NM_021783 NM_021784 NM_021794 NM_021795 NM_021798 NM_021807 NM_021812 NM_021813 NM_021814 NM_021815 NM_021820 NM_021821 NM_021822 NM_021831 NM_021832 NM_021903 NM_021904 NM_021905 NM_021914 NM_021916 NM_021928 NM_021930 NM_021940 NM_021943 NM_021944 NM_021945 NM_021946 NM_021949 NM_021950 NM_021951 NM_021960 NM_021961 NM_021977 NM_021978 NM_021979 NM_021980 NM_021984 NM_021987 NM_021988 NM_021990 NM_021995 NM_021998 NM_021999 NM_022002 NM_022040 NM_022041 NM_022045 NM_022047 NM_022048 NM_022049 NM_022050 NM_022051 NM_022060 NM_022063 NM_022068 NM_022071 NM_022073 NM_022074 NM_022083 NM_022086 NM_022093 NM_022100 NM_022102 NM_022103 NM_022105 NM_022106 NM_022112 NM_022114 NM_022121 NM_022124 NM_022130 NM_022131 NM_022135 NM_022138 NM_022140 NM_022143 NM_022147 NM_022150 NM_022153 NM_022162 NM_022170 NM_022336 NM_022351 NM_022361 NM_022366 NM_022368 NM_022371 NM_022373 NM_022405 NM_022406 NM_022438 NM_022439 NM_022440 NM_022442 NM_022444 NM_022447 NM_022451 NM_022454 NM_022457 NM_022459 NM_022463 NM_022465 NM_022466 NM_022468 NM_022470 NM_022471 NM_022473 NM_022475 NM_022482 NM_022483 NM_022484 NM_022486 NM_022491 NM_022493 NM_022495 NM_022497 NM_022550 NM_022552 NM_022570 NM_022576 NM_022648 NM_022652 NM_022658 NM_022663 NM_022716 NM_022718 NM_022720 NM_022725 NM_022726 NM_022728 NM_022730 NM_022733 NM_022745 NM_022748 NM_022749 NM_022750 NM_022755 NM_022758 NM_022766 NM_022770 NM_022772 NM_022773 NM_022774 NM_022776 NM_022777 NM_022781 NM_022782 NM_022783 NM_022788 NM_022791 NM_022792 NM_022817 NM_022818 NM_022825 NM_022828 NM_022832 NM_022836 NM_022837 NM_022838 NM_022840 NM_022842 NM_022843 NM_022845 NM_022872 NM_022873 NM_022893 NM_022895 NM_022897 NM_022898 NM_022899 NM_022900 NM_022901 NM_022902 NM_022910 NM_022912 NM_022917 NM_022918 NM_022963 NM_022969 NM_022970 NM_022972 NM_022975 NM_023002 NM_023003 NM_023005 NM_023011 NM_023012 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023073 NM_023074 NM_023078 NM_023110 NM_023112 NM_023914 NM_023920 NM_023923 NM_023927 NM_023940 NM_024017 NM_024029 NM_024034 NM_024043 NM_024046 NM_024052 NM_024055 NM_024056 NM_024067 NM_024071 NM_024076 NM_024082 NM_024087 NM_024090 NM_024092 NM_024095 NM_024097 NM_024101 NM_024102 NM_024114 NM_024117 NM_024294 NM_024295 NM_024296 NM_024301 NM_024312 NM_024315 NM_024324 NM_024327 NM_024328 NM_024332 NM_024408 NM_024416 NM_024417 NM_024422 NM_024423 NM_024430 NM_024490 NM_024492 NM_024507 NM_024510 NM_024511 NM_024512 NM_024513 NM_024516 NM_024522 NM_024526 NM_024527 NM_024539 NM_024541 NM_024544 NM_024551 NM_024554 NM_024557 NM_024558 NM_024561 NM_024563 NM_024569 NM_024575 NM_024583 NM_024584 NM_024590 NM_024592 NM_024593 NM_024595 NM_024598 NM_024607 NM_024608 NM_024611 NM_024612 NM_024613 NM_024614 NM_024615 NM_024616 NM_024629 NM_024630 NM_024631 NM_024636 NM_024638 NM_024641 NM_024643 NM_024645 NM_024646 NM_024647 NM_024649 NM_024652 NM_024653 NM_024654 NM_024659 NM_024663 NM_024665 NM_024666 NM_024670 NM_024672 NM_024674 NM_024677 NM_024678 NM_024683 NM_024685 NM_024686 NM_024688 NM_024689 NM_024691 NM_024692 NM_024693 NM_024700 NM_024701 NM_024735 NM_024738 NM_024744 NM_024745 NM_024753 NM_024754 NM_024758 NM_024761 NM_024768 NM_024771 NM_024772 NM_024778 NM_024781 NM_024785 NM_024787 NM_024795 NM_024803 NM_024807 NM_024808 NM_024811 NM_024812 NM_024813 NM_024819 NM_024824 NM_024826 NM_024828 NM_024830 NM_024832 NM_024834 NM_024837 NM_024843 NM_024847 NM_024861 NM_024863 NM_024866 NM_024871 NM_024875 NM_024878 NM_024881 NM_024882 NM_024889 NM_024891 NM_024893 NM_024899 NM_024900 NM_024901 NM_024910 NM_024917 NM_024919 NM_024920 NM_024921 NM_024922 NM_024926 NM_024929 NM_024930 NM_024938 NM_024939 NM_024942 NM_024943 NM_024944 NM_024946 NM_024947 NM_024953 NM_024958 NM_024959 NM_024969 NM_024989 NM_025002 NM_025009 NM_025010 NM_025054 NM_025057 NM_025059 NM_025074 NM_025082 NM_025106 NM_025107 NM_025109 NM_025125 NM_025128 NM_025129 NM_025133 NM_025138 NM_025144 NM_025147 NM_025151 NM_025154 NM_025160 NM_025161 NM_025164 NM_025165 NM_025168 NM_025182 NM_025191 NM_025194 NM_025195 NM_025196 NM_025201 NM_025218 NM_025224 NM_025235 NM_025237 NM_025238 NM_025239 NM_025244 NM_025259 NM_025263 NM_030569 NM_030571 NM_030574 NM_030577 NM_030579 NM_030582 NM_030589 NM_030593 NM_030594 NM_030615 NM_030621 NM_030625 NM_030626 NM_030627 NM_030629 NM_030631 NM_030633 NM_030636 NM_030639 NM_030641 NM_030643 NM_030644 NM_030648 NM_030650 NM_030661 NM_030662 NM_030664 NM_030665 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030674 NM_030755 NM_030758 NM_030759 NM_030760 NM_030761 NM_030762 NM_030766 NM_030772 NM_030774 NM_030781 NM_030786 NM_030787 NM_030788 NM_030791 NM_030794 NM_030796 NM_030799 NM_030806 NM_030809 NM_030817 NM_030820 NM_030882 NM_030884 NM_030891 NM_030899 NM_030906 NM_030918 NM_030919 NM_030920 NM_030922 NM_030923 NM_030934 NM_030938 NM_030939 NM_030944 NM_030945 NM_030953 NM_030954 NM_030962 NM_030963 NM_030964 NM_030965 NM_030979 NM_030980 NM_031200 NM_031206 NM_031208 NM_031211 NM_031215 NM_031216 NM_031244 NM_031262 NM_031263 NM_031265 NM_031267 NM_031282 NM_031292 NM_031296 NM_031311 NM_031372 NM_031409 NM_031411 NM_031416 NM_031418 NM_031420 NM_031426 NM_031427 NM_031435 NM_031436 NM_031437 NM_031439 NM_031442 NM_031444 NM_031445 NM_031453 NM_031456 NM_031457 NM_031467 NM_031469 NM_031474 NM_031479 NM_031481 NM_031483 NM_031484 NM_031491 NM_031496 NM_031849 NM_031857 NM_031860 NM_031886 NM_031887 NM_031888 NM_031899 NM_031905 NM_031910 NM_031911 NM_031913 NM_031920 NM_031936 NM_031937 NM_031939 NM_031940 NM_031946 NM_031952 NM_031988 NM_031990 NM_031991 NM_031992 NM_032010 NM_032018 NM_032023 NM_032027 NM_032042 NM_032044 NM_032045 NM_032046 NM_032047 NM_032088 NM_032092 NM_032103 NM_032104 NM_032105 NM_032112 NM_032116 NM_032124 NM_032125 NM_032126 NM_032132 NM_032134 NM_032139 NM_032141 NM_032145 NM_032151 NM_032153 NM_032160 NM_032174 NM_032182 NM_032186 NM_032189 NM_032195 NM_032205 NM_032207 NM_032208 NM_032214 NM_032217 NM_032227 NM_032233 NM_032250 NM_032251 NM_032256 NM_032264 NM_032273 NM_032276 NM_032280 NM_032281 NM_032283 NM_032287 NM_032288 NM_032291 NM_032293 NM_032300 NM_032303 NM_032312 NM_032315 NM_032316 NM_032325 NM_032327 NM_032329 NM_032330 NM_032336 NM_032338 NM_032352 NM_032357 NM_032359 NM_032372 NM_032373 NM_032374 NM_032376 NM_032379 NM_032380 NM_032403 NM_032408 NM_032421 NM_032424 NM_032427 NM_032432 NM_032435 NM_032438 NM_032439 NM_032440 NM_032441 NM_032445 NM_032446 NM_032449 NM_032458 NM_032463 NM_032464 NM_032486 NM_032490 NM_032491 NM_032492 NM_032494 NM_032501 NM_032509 NM_032510 NM_032511 NM_032515 NM_032520 NM_032525 NM_032529 NM_032538 NM_032547 NM_032549 NM_032550 NM_032552 NM_032554 NM_032572 NM_032581 NM_032582 NM_032594 NM_032607 NM_032611 NM_032620 NM_032621 NM_032622 NM_032632 NM_032635 NM_032639 NM_032643 NM_032644 NM_032646 NM_032664 NM_032680 NM_032681 NM_032711 NM_032714 NM_032717 NM_032727 NM_032737 NM_032738 NM_032765 NM_032770 NM_032782 NM_032804 NM_032807 NM_032808 NM_032813 NM_032817 NM_032818 NM_032824 NM_032825 NM_032829 NM_032833 NM_032834 NM_032836 NM_032837 NM_032838 NM_032842 NM_032853 NM_032856 NM_032858 NM_032864 NM_032865 NM_032866 NM_032869 NM_032873 NM_032880 NM_032884 NM_032886 NM_032898 NM_032899 NM_032900 NM_032918 NM_032920 NM_032924 NM_032932 NM_032933 NM_032936 NM_032943 NM_032946 NM_032955 NM_032960 NM_032966 NM_032968 NM_032969 NM_032970 NM_032973 NM_032975 NM_032976 NM_032977 NM_032980 NM_032991 NM_032993 NM_033011 NM_033013 NM_033014 NM_033017 NM_033025 NM_033027 NM_033033 NM_033050 NM_033052 NM_033071 NM_033083 NM_033087 NM_033089 NM_033091 NM_033100 NM_033109 NM_033119 NM_033120 NM_033123 NM_033130 NM_033133 NM_033136 NM_033137 NM_033141 NM_033143 NM_033152 NM_033153 NM_033154 NM_033155 NM_033160 NM_033161 NM_033182 NM_033188 NM_033195 NM_033198 NM_033207 NM_033211 NM_033215 NM_033221 NM_033224 NM_033238 NM_033240 NM_033245 NM_033253 NM_033261 NM_033262 NM_033274 NM_033276 NM_033285 NM_033290 NM_033291 NM_033302 NM_033303 NM_033305 NM_033309 NM_033313 NM_033316 NM_033318 NM_033326 NM_033331 NM_033332 NM_033337 NM_033338 NM_033339 NM_033340 NM_033342 NM_033346 NM_033357 NM_033360 NM_033362 NM_033363 NM_033364 NM_033386 NM_033389 NM_033393 NM_033394 NM_033397 NM_033407 NM_033409 NM_033410 NM_033418 NM_033421 NM_033425 NM_033426 NM_033427 NM_033428 NM_033429 NM_033446 NM_033448 NM_033503 NM_033505 NM_033510 NM_033512 NM_033516 NM_033540 NM_033547 NM_033631 NM_033632 NM_033637 NM_033642 NM_033644 NM_033645 NM_033655 NM_033656 NM_033666 NM_048368 NM_052811 NM_052813 NM_052816 NM_052818 NM_052821 NM_052828 NM_052834 NM_052840 NM_052845 NM_052847 NM_052848 NM_052849 NM_052851 NM_052854 NM_052859 NM_052862 NM_052869 NM_052872 NM_052874 NM_052876 NM_052879 NM_052886 NM_052887 NM_052896 NM_052900 NM_052905 NM_052906 NM_052909 NM_052910 NM_052918 NM_052923 NM_052925 NM_052932 NM_052934 NM_052935 NM_052936 NM_052937 NM_052938 NM_052939 NM_052947 NM_052949 NM_052951 NM_052952 NM_052954 NM_052965 NM_052966 NM_052978 NM_052995 NM_053002 NM_053023 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053034 NM_053041 NM_053042 NM_053055 NM_053064 NM_053277 NM_053282 NM_053285 NM_053286 NM_054022 NM_054026 NM_054027 NM_054030 NM_054111 NM_054112 NM_054114 NM_057158 NM_057159 NM_057168 NM_057169 NM_057170 NM_057175 NM_057177 NM_057178 NM_057179 NM_057182 NM_057735 NM_057749 NM_058164 NM_058166 NM_058170 NM_058182 NM_058183 NM_058186 NM_058217 NM_058240 NM_058241 NM_078467 NM_078469 NM_078470 NM_078473 NM_078483 NM_078625 NM_078626 NM_078628 NM_079834 NM_079837 NM_080415 NM_080417 NM_080425 NM_080426 NM_080473 NM_080489 NM_080546 NM_080550 NM_080551 NM_080591 NM_080605 NM_080612 NM_080617 NM_080625 NM_080628 NM_080629 NM_080630 NM_080645 NM_080646 NM_080655 NM_080657 NM_080665 NM_080666 NM_080676 NM_080678 NM_080687 NM_080704 NM_080705 NM_080706 NM_080717 NM_080725 NM_080737 NM_080738 NM_080749 NM_080759 NM_080760 NM_080764 NM_080792 NM_080796 NM_080797 NM_080821 NM_080833 NM_080836 NM_080865 NM_080867 NM_080870 NM_080872 NM_080874 NM_080876 NM_080911 NM_080927 NM_100264 NM_100486 NM_101395 NM_130386 NM_130387 NM_130435 NM_130436 NM_130437 NM_130438 NM_130439 NM_130442 NM_130444 NM_130445 NM_130446 NM_130465 NM_130778 NM_130787 NM_130806 NM_130809 NM_130811 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130840 NM_130841 NM_130842 NM_130843 NM_130846 NM_130847 NM_130848 NM_133170 NM_133171 NM_133180 NM_133181 NM_133328 NM_133329 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133336 NM_133367 NM_133371 NM_133372 NM_133375 NM_133379 NM_133433 NM_133443 NM_133444 NM_133445 NM_133448 NM_133451 NM_133452 NM_133463 NM_133464 NM_133474 NM_133476 NM_133477 NM_133480 NM_133481 NM_133484 NM_133487 NM_133490 NM_133493 NM_133496 NM_133509 NM_133510 NM_133627 NM_133628 NM_133629 NM_133630 NM_133632 NM_133633 NM_133634 NM_133635 NM_133640 NM_133644 NM_133646 NM_133650 NM_134268 NM_134422 NM_134423 NM_134424 NM_134431 NM_134433 NM_134442 NM_138270 NM_138271 NM_138280 NM_138284 NM_138285 NM_138298 NM_138300 NM_138316 NM_138317 NM_138318 NM_138323 NM_138324 NM_138333 NM_138335 NM_138342 NM_138348 NM_138350 NM_138357 NM_138362 NM_138363 NM_138368 NM_138369 NM_138393 NM_138400 NM_138409 NM_138422 NM_138423 NM_138428 NM_138430 NM_138444 NM_138445 NM_138447 NM_138450 NM_138452 NM_138453 NM_138457 NM_138463 NM_138468 NM_138471 NM_138473 NM_138477 NM_138492 NM_138494 NM_138553 NM_138554 NM_138556 NM_138557 NM_138559 NM_138566 NM_138572 NM_138575 NM_138576 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138633 NM_138636 NM_138638 NM_138640 NM_138694 NM_138699 NM_138713 NM_138714 NM_138715 NM_138716 NM_138720 NM_138722 NM_138723 NM_138726 NM_138727 NM_138728 NM_138731 NM_138735 NM_138775 NM_138781 NM_138782 NM_138788 NM_138799 NM_138805 NM_138809 NM_138928 NM_138939 NM_138940 NM_138969 NM_138970 NM_138971 NM_138972 NM_138973 NM_138980 NM_138981 NM_138982 NM_138991 NM_138992 NM_138995 NM_138999 NM_139015 NM_139048 NM_139053 NM_139058 NM_139073 NM_139076 NM_139078 NM_139135 NM_139136 NM_139167 NM_139168 NM_139169 NM_139177 NM_139179 NM_139201 NM_139204 NM_139235 NM_139238 NM_139242 NM_139244 NM_139245 NM_139246 NM_139264 NM_139265 NM_139267 NM_139275 NM_139276 NM_139283 NM_139312 NM_139316 NM_139318 NM_139319 NM_139320 NM_139321 NM_139323 NM_139353 NM_144497 NM_144498 NM_144499 NM_144563 NM_144567 NM_144570 NM_144575 NM_144578 NM_144579 NM_144581 NM_144583 NM_144588 NM_144597 NM_144599 NM_144600 NM_144607 NM_144629 NM_144632 NM_144639 NM_144641 NM_144642 NM_144643 NM_144644 NM_144647 NM_144650 NM_144658 NM_144660 NM_144662 NM_144664 NM_144669 NM_144674 NM_144681 NM_144682 NM_144684 NM_144690 NM_144693 NM_144694 NM_144701 NM_144705 NM_144709 NM_144710 NM_144714 NM_144718 NM_144721 NM_144726 NM_144732 NM_144733 NM_144734 NM_144736 NM_144766 NM_144767 NM_144770 NM_144778 NM_144779 NM_144780 NM_144949 NM_144966 NM_144967 NM_144968 NM_144973 NM_144974 NM_144975 NM_144976 NM_144982 NM_144991 NM_144992 NM_144996 NM_144997 NM_144998 NM_145007 NM_145011 NM_145015 NM_145018 NM_145021 NM_145026 NM_145033 NM_145035 NM_145041 NM_145042 NM_145043 NM_145049 NM_145053 NM_145055 NM_145058 NM_145068 NM_145109 NM_145110 NM_145114 NM_145115 NM_145117 NM_145119 NM_145170 NM_145173 NM_145204 NM_145212 NM_145237 NM_145244 NM_145246 NM_145250 NM_145251 NM_145257 NM_145259 NM_145263 NM_145266 NM_145269 NM_145270 NM_145278 NM_145279 NM_145280 NM_145284 NM_145286 NM_145295 NM_145298 NM_145303 NM_145307 NM_145308 NM_145310 NM_145311 NM_145313 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145326 NM_145328 NM_145331 NM_145332 NM_145333 NM_145343 NM_145344 NM_145347 NM_145348 NM_145349 NM_145350 NM_145351 NM_145352 NM_145637 NM_145638 NM_145639 NM_145640 NM_145641 NM_145642 NM_145646 NM_145649 NM_145650 NM_145655 NM_145660 NM_145685 NM_145686 NM_145687 NM_145691 NM_145693 NM_145699 NM_145727 NM_145728 NM_145730 NM_145753 NM_145754 NM_145759 NM_145764 NM_145791 NM_145792 NM_145793 NM_145803 NM_145804 NM_145805 NM_145808 NM_145818 NM_145858 NM_145861 NM_145872 NM_145891 NM_145892 NM_145893 NM_145896 NM_145898 NM_145909 NM_145911 NM_145912 NM_145914 NM_147129 NM_147131 NM_147132 NM_147147 NM_147152 NM_147156 NM_147180 NM_147189 NM_147190 NM_147194 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_148571 NM_148842 NM_148894 NM_148911 NM_148957 NM_148959 NM_148964 NM_148977 NM_148978 NM_152133 NM_152223 NM_152224 NM_152225 NM_152226 NM_152233 NM_152235 NM_152240 NM_152253 NM_152255 NM_152261 NM_152264 NM_152265 NM_152267 NM_152268 NM_152270 NM_152275 NM_152278 NM_152279 NM_152280 NM_152281 NM_152282 NM_152287 NM_152300 NM_152301 NM_152302 NM_152304 NM_152309 NM_152314 NM_152317 NM_152319 NM_152322 NM_152328 NM_152330 NM_152333 NM_152336 NM_152340 NM_152341 NM_152351 NM_152352 NM_152354 NM_152355 NM_152361 NM_152363 NM_152367 NM_152372 NM_152374 NM_152376 NM_152379 NM_152380 NM_152382 NM_152383 NM_152387 NM_152388 NM_152390 NM_152391 NM_152395 NM_152400 NM_152409 NM_152417 NM_152418 NM_152421 NM_152424 NM_152429 NM_152431 NM_152433 NM_152435 NM_152436 NM_152437 NM_152439 NM_152440 NM_152444 NM_152449 NM_152450 NM_152459 NM_152461 NM_152464 NM_152475 NM_152488 NM_152489 NM_152493 NM_152500 NM_152503 NM_152506 NM_152511 NM_152512 NM_152519 NM_152520 NM_152523 NM_152524 NM_152527 NM_152528 NM_152529 NM_152531 NM_152542 NM_152543 NM_152547 NM_152551 NM_152553 NM_152556 NM_152568 NM_152569 NM_152574 NM_152579 NM_152581 NM_152583 NM_152588 NM_152592 NM_152609 NM_152622 NM_152624 NM_152629 NM_152630 NM_152633 NM_152635 NM_152638 NM_152641 NM_152643 NM_152655 NM_152660 NM_152675 NM_152678 NM_152680 NM_152681 NM_152686 NM_152688 NM_152694 NM_152695 NM_152702 NM_152704 NM_152707 NM_152713 NM_152720 NM_152724 NM_152728 NM_152731 NM_152732 NM_152734 NM_152736 NM_152737 NM_152739 NM_152748 NM_152750 NM_152753 NM_152755 NM_152757 NM_152758 NM_152763 NM_152764 NM_152772 NM_152774 NM_152776 NM_152780 NM_152785 NM_152789 NM_152793 NM_152829 NM_152831 NM_152834 NM_152835 NM_152838 NM_152842 NM_152854 NM_152855 NM_152857 NM_152858 NM_152860 NM_152864 NM_152866 NM_152870 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152878 NM_152879 NM_152903 NM_152910 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152942 NM_152995 NM_152996 NM_152998 NM_152999 NM_153010 NM_153012 NM_153013 NM_153020 NM_153022 NM_153023 NM_153027 NM_153029 NM_153031 NM_153034 NM_153041 NM_153042 NM_153046 NM_153050 NM_153051 NM_153184 NM_153186 NM_153191 NM_153207 NM_153218 NM_153220 NM_153223 NM_153229 NM_153235 NM_153238 NM_153246 NM_153254 NM_153255 NM_153257 NM_153261 NM_153262 NM_153263 NM_153266 NM_153268 NM_153270 NM_153273 NM_153321 NM_153322 NM_153328 NM_153340 NM_153343 NM_153345 NM_153347 NM_153348 NM_153350 NM_153354 NM_153355 NM_153356 NM_153362 NM_153365 NM_153367 NM_153368 NM_153371 NM_153380 NM_153381 NM_153425 NM_153442 NM_153462 NM_153463 NM_153464 NM_153499 NM_153500 NM_153607 NM_153610 NM_153616 NM_153617 NM_153618 NM_153619 NM_153620 NM_153631 NM_153632 NM_153633 NM_153634 NM_153649 NM_153675 NM_153676 NM_153686 NM_153687 NM_153688 NM_153689 NM_153700 NM_153704 NM_153705 NM_153707 NM_153709 NM_153712 NM_153714 NM_153746 NM_153748 NM_153757 NM_153759 NM_153764 NM_153765 NM_153766 NM_153767 NM_153809 NM_153812 NM_153816 NM_153818 NM_153825 NM_153826 NM_153831 NM_153834 NM_153836 NM_156036 NM_170601 NM_170609 NM_170672 NM_170674 NM_170675 NM_170676 NM_170677 NM_170679 NM_170686 NM_170691 NM_170695 NM_170705 NM_170706 NM_170709 NM_170710 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170719 NM_170721 NM_170723 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170743 NM_170750 NM_170751 NM_170752 NM_170768 NM_170773 NM_170774 NM_170782 NM_171827 NM_171998 NM_171999 NM_172016 NM_172020 NM_172024 NM_172037 NM_172058 NM_172059 NM_172060 NM_172103 NM_172104 NM_172105 NM_172159 NM_172160 NM_172165 NM_172166 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172174 NM_172175 NM_172177 NM_172178 NM_172193 NM_172208 NM_172216 NM_172217 NM_172219 NM_172220 NM_172226 NM_172229 NM_172232 NM_172234 NM_172236 NM_172238 NM_172239 NM_172241 NM_172242 NM_172315 NM_172316 NM_172318 NM_172344 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172367 NM_172373 NM_172375 NM_172386 NM_173054 NM_173060 NM_173064 NM_173065 NM_173075 NM_173079 NM_173082 NM_173084 NM_173156 NM_173170 NM_173198 NM_173200 NM_173207 NM_173208 NM_173209 NM_173210 NM_173211 NM_173214 NM_173353 NM_173354 NM_173362 NM_173454 NM_173455 NM_173456 NM_173457 NM_173459 NM_173462 NM_173464 NM_173465 NM_173466 NM_173468 NM_173470 NM_173471 NM_173478 NM_173480 NM_173484 NM_173487 NM_173491 NM_173495 NM_173497 NM_173503 NM_173505 NM_173508 NM_173509 NM_173510 NM_173511 NM_173519 NM_173522 NM_173523 NM_173524 NM_173526 NM_173528 NM_173529 NM_173533 NM_173536 NM_173539 NM_173540 NM_173545 NM_173548 NM_173551 NM_173552 NM_173555 NM_173561 NM_173563 NM_173564 NM_173578 NM_173580 NM_173581 NM_173582 NM_173583 NM_173590 NM_173596 NM_173599 NM_173607 NM_173609 NM_173610 NM_173621 NM_173622 NM_173623 NM_173627 NM_173631 NM_173638 NM_173640 NM_173641 NM_173643 NM_173651 NM_173653 NM_173654 NM_173661 NM_173663 NM_173664 NM_173665 NM_173666 NM_173667 NM_173669 NM_173670 NM_173677 NM_173683 NM_173688 NM_173689 NM_173691 NM_173694 NM_173698 NM_173728 NM_173794 NM_173795 NM_173800 NM_173801 NM_173802 NM_173803 NM_173805 NM_173807 NM_173808 NM_173809 NM_173812 NM_173817 NM_173822 NM_173823 NM_173826 NM_173827 NM_173830 NM_173851 NM_173872 NM_174858 NM_174871 NM_174878 NM_174886 NM_174901 NM_174902 NM_174911 NM_174936 NM_174945 NM_174950 NM_174977 NM_175056 NM_175058 NM_175060 NM_175061 NM_175069 NM_175071 NM_175072 NM_175073 NM_175077 NM_175078 NM_175567 NM_175568 NM_175571 NM_175605 NM_175616 NM_175620 NM_175626 NM_175627 NM_175629 NM_175634 NM_175635 NM_175636 NM_175734 NM_175736 NM_175738 NM_175745 NM_175767 NM_175768 NM_175847 NM_175854 NM_175858 NM_175861 NM_175862 NM_175864 NM_175873 NM_175876 NM_175884 NM_175885 NM_175895 NM_175900 NM_175907 NM_175921 NM_175922 NM_175931 NM_175932 NM_176071 NM_176072 NM_176084 NM_176085 NM_176086 NM_176677 NM_176787 NM_176811 NM_176814 NM_176815 NM_176823 NM_176824 NM_176825 NM_176853 NM_176866 NM_176867 NM_176869 NM_176874 NM_176876 NM_176880 NM_176894 NM_176895 NM_177401 NM_177402 NM_177403 NM_177414 NM_177424 NM_177427 NM_177438 NM_177442 NM_177452 NM_177532 NM_177549 NM_177551 NM_177553 NM_177924 NM_177937 NM_177947 NM_177948 NM_177963 NM_177965 NM_177966 NM_177967 NM_177968 NM_177974 NM_177978 NM_177979 NM_177990 NM_177996 NM_178006 NM_178007 NM_178008 NM_178009 NM_178011 NM_178033 NM_178034 NM_178120 NM_178124 NM_178126 NM_178129 NM_178138 NM_178140 NM_178145 NM_178150 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178167 NM_178169 NM_178177 NM_178225 NM_178226 NM_178232 NM_178270 NM_178271 NM_178314 NM_178326 NM_178329 NM_178338 NM_178339 NM_178340 NM_178341 NM_178344 NM_178423 NM_178426 NM_178427 NM_178439 NM_178441 NM_178445 NM_178460 NM_178470 NM_178495 NM_178496 NM_178505 NM_178509 NM_178514 NM_178516 NM_178517 NM_178520 NM_178527 NM_178542 NM_178544 NM_178549 NM_178550 NM_178558 NM_178562 NM_178563 NM_178564 NM_178566 NM_178578 NM_178579 NM_178582 NM_178583 NM_178584 NM_178585 NM_178586 NM_178816 NM_178818 NM_178820 NM_178823 NM_178831 NM_178832 NM_178833 NM_178834 NM_178835 NM_178850 NM_178867 NM_178868 NM_180989 NM_180991 NM_181041 NM_181076 NM_181077 NM_181078 NM_181079 NM_181265 NM_181293 NM_181298 NM_181299 NM_181311 NM_181312 NM_181313 NM_181314 NM_181332 NM_181336 NM_181337 NM_181339 NM_181342 NM_181349 NM_181351 NM_181354 NM_181356 NM_181358 NM_181359 NM_181361 NM_181435 NM_181443 NM_181457 NM_181458 NM_181459 NM_181460 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181491 NM_181492 NM_181502 NM_181503 NM_181504 NM_181507 NM_181508 NM_181512 NM_181523 NM_181524 NM_181526 NM_181572 NM_181578 NM_181644 NM_181645 NM_181659 NM_181670 NM_181703 NM_181704 NM_181709 NM_181714 NM_181722 NM_181723 NM_181724 NM_181740 NM_181774 NM_181782 NM_181789 NM_181836 NM_181837 NM_181838 NM_181844 NM_181847 NM_181872 NM_181874 NM_181876 NM_181877 NM_181900 NM_182314 NM_182470 NM_182471 NM_182472 NM_182481 NM_182482 NM_182483 NM_182484 NM_182485 NM_182486 NM_182488 NM_182497 NM_182501 NM_182503 NM_182508 NM_182518 NM_182519 NM_182520 NM_182521 NM_182522 NM_182525 NM_182528 NM_182533 NM_182534 NM_182540 NM_182541 NM_182543 NM_182546 NM_182553 NM_182554 NM_182556 NM_182557 NM_182558 NM_182568 NM_182572 NM_182573 NM_182579 NM_182584 NM_182587 NM_182596 NM_182598 NM_182603 NM_182607 NM_182613 NM_182626 NM_182631 NM_182634 NM_182635 NM_182641 NM_182643 NM_182646 NM_182661 NM_182663 NM_182664 NM_182665 NM_182666 NM_182679 NM_182685 NM_182686 NM_182688 NM_182703 NM_182715 NM_182717 NM_182720 NM_182721 NM_182722 NM_182723 NM_182729 NM_182734 NM_182740 NM_182742 NM_182743 NM_182744 NM_182751 NM_182752 NM_182757 NM_182758 NM_182763 NM_182764 NM_182765 NM_182775 NM_182791 NM_182797 NM_182798 NM_182799 NM_182801 NM_182829 NM_182830 NM_182831 NM_182848 NM_182853 NM_182896 NM_182898 NM_182899 NM_182909 NM_182910 NM_182911 NM_182912 NM_182913 NM_182914 NM_182915 NM_182916 NM_182925 NM_182932 NM_182933 NM_182936 NM_182943 NM_182948 NM_182960 NM_182961 NM_182962 NM_182964 NM_182966 NM_182970 NM_182975 NM_183002 NM_183004 NM_183011 NM_183012 NM_183013 NM_183040 NM_183045 NM_183063 NM_183238 NM_183239 NM_183241 NM_183353 NM_183372 NM_183376 NM_183377 NM_183381 NM_183382 NM_183383 NM_183384 NM_183385 NM_183387 NM_183412 NM_183413 NM_183414 NM_183416 NM_184041 NM_184042 NM_184043 NM_194071 NM_194252 NM_194281 NM_194282 NM_194283 NM_194284 NM_194285 NM_194286 NM_194288 NM_194290 NM_194298 NM_194299 NM_194300 NM_194310 NM_194313 NM_194314 NM_194316 NM_194317 NM_194318 NM_194324 NM_194327 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194356 NM_194434 NM_194442 NM_194449 NM_194451 NM_194454 NM_194455 NM_194456 NM_194463 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197966 NM_197967 NM_197968 NM_197973 NM_197974 NM_197975 NM_197977 NM_198040 NM_198043 NM_198044 NM_198045 NM_198046 NM_198055 NM_198058 NM_198066 NM_198076 NM_198080 NM_198081 NM_198083 NM_198087 NM_198088 NM_198123 NM_198124 NM_198128 NM_198147 NM_198150 NM_198151 NM_198153 NM_198157 NM_198158 NM_198159 NM_198177 NM_198178 NM_198181 NM_198182 NM_198189 NM_198195 NM_198196 NM_198197 NM_198207 NM_198212 NM_198215 NM_198225 NM_198240 NM_198261 NM_198262 NM_198266 NM_198268 NM_198269 NM_198270 NM_198271 NM_198276 NM_198279 NM_198281 NM_198287 NM_198291 NM_198315 NM_198320 NM_198321 NM_198327 NM_198328 NM_198333 NM_198336 NM_198337 NM_198389 NM_198390 NM_198392 NM_198394 NM_198399 NM_198400 NM_198401 NM_198402 NM_198403 NM_198404 NM_198431 NM_198432 NM_198439 NM_198440 NM_198441 NM_198442 NM_198447 NM_198451 NM_198458 NM_198465 NM_198466 NM_198477 NM_198484 NM_198485 NM_198489 NM_198490 NM_198493 NM_198494 NM_198496 NM_198498 NM_198499 NM_198501 NM_198502 NM_198503 NM_198504 NM_198512 NM_198513 NM_198519 NM_198530 NM_198531 NM_198532 NM_198537 NM_198542 NM_198545 NM_198550 NM_198553 NM_198555 NM_198557 NM_198562 NM_198563 NM_198564 NM_198567 NM_198569 NM_198571 NM_198581 NM_198582 NM_198584 NM_198585 NM_198595 NM_198596 NM_198679 NM_198686 NM_198793 NM_198794 NM_198795 NM_198830 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198841 NM_198847 NM_198859 NM_198887 NM_198889 NM_198900 NM_198903 NM_198904 NM_198907 NM_198925 NM_198935 NM_198941 NM_198947 NM_198968 NM_198974 NM_198976 NM_198988 NM_198990 NM_198992 NM_198995 NM_199000 NM_199003 NM_199039 NM_199040 NM_199044 NM_199045 NM_199047 NM_199050 NM_199072 NM_199075 NM_199076 NM_199078 NM_199126 NM_199131 NM_199133 NM_199135 NM_199138 NM_199139 NM_199144 NM_199160 NM_199162 NM_199165 NM_199176 NM_199182 NM_199188 NM_199189 NM_199190 NM_199203 NM_199227 NM_199228 NM_199229 NM_199245 NM_199246 NM_199262 NM_199282 NM_199324 NM_199328 NM_199329 NM_199335 NM_199339 NM_199355 NM_199356 NM_199358 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199421 NM_199423 NM_199424 NM_199436 NM_199443 NM_199451 NM_199452 NM_199454 NM_199461 NM_199462 NM_199478 NM_199482 NM_199483 NM_199484 NM_199485 NM_199487 NM_199513 NM_201252 NM_201264 NM_201266 NM_201269 NM_201279 NM_201348 NM_201403 NM_201431 NM_201432 NM_201433 NM_201437 NM_201438 NM_201439 NM_201440 NM_201515 NM_201526 NM_201546 NM_201550 NM_201559 NM_201565 NM_201567 NM_201568 NM_201569 NM_201591 NM_201592 NM_201612 NM_201613 NM_201614 NM_201650 NM_201651 NM_203282 NM_203291 NM_203292 NM_203305 NM_203308 NM_203314 NM_203315 NM_203327 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_203347 NM_203351 NM_203364 NM_203365 NM_203373 NM_203374 NM_203382 NM_203390 NM_203391 NM_203394 NM_203406 NM_203417 NM_203418 NM_203426 NM_203436 NM_203438 NM_203439 NM_203440 NM_203441 NM_203446 NM_203452 NM_203453 NM_203454 NM_203459 NM_203462 NM_203463 NM_203471 NM_203472 NM_203473 NM_203474 NM_203475 NM_203476 NM_203495 NM_203497 NM_203504 NM_203505 NM_205548 NM_205768 NM_205833 NM_205846 NM_205848 NM_205853 NM_205855 NM_205857 NM_205860 NM_205862 NM_205864 NM_206594 NM_206595 NM_206827 NM_206831 NM_206834 NM_206839 NM_206841 NM_206852 NM_206853 NM_206854 NM_206855 NM_206857 NM_206866 NM_206876 NM_206877 NM_206887 NM_206892 NM_206907 NM_206909 NM_206910 NM_206911 NM_206926 NM_206927 NM_206928 NM_206929 NM_206930 NM_206933 NM_206937 NM_206938 NM_206939 NM_206940 NM_206943 NM_206963 NM_206964 NM_206966 NM_206996 NM_207003 NM_207009 NM_207013 NM_207036 NM_207037 NM_207038 NM_207040 NM_207042 NM_207045 NM_207046 NM_207111 NM_207116 NM_207119 NM_207122 NM_207171 NM_207174 NM_207181 NM_207189 NM_207283 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207303 NM_207304 NM_207306 NM_207311 NM_207316 NM_207324 NM_207325 NM_207330 NM_207333 NM_207335 NM_207337 NM_207345 NM_207350 NM_207352 NM_207357 NM_207358 NM_207362 NM_207367 NM_207378 NM_207381 NM_207382 NM_207383 NM_207387 NM_207390 NM_207391 NM_207394 NM_207395 NM_207398 NM_207401 NM_207404 NM_207411 NM_207412 NM_207413 NM_207429 NM_207430 NM_207434 NM_207438 NM_207442 NM_207446 NM_207447 NM_207451 NM_207454 NM_207463 NM_207469 NM_207470 NM_207471 NM_207474 NM_207475 NM_207478 NM_207479 NM_207481 NM_207482 NM_207484 NM_207486 NM_207489 NM_207491 NM_207497 NM_207500 NM_207504 NM_207505 NM_207506 NM_207517 NM_207577 NM_207582 NM_207584 NM_207585 NM_207627 NM_207628 NM_207629 NM_207630 NM_207646 NM_207660 NM_207661 NM_207662 NM_212464 NM_212467 NM_212469 NM_212543 NM_212551 NM_212554 NM_212555 NM_212558 NM_212559 NM_213566 NM_213589 NM_213590 NM_213593 NM_213594 NM_213595 NM_213604 NM_213606 NM_213607 NM_213612 NM_213647 NM_213654 NM_213656 NM_213657 NM_213658 NM_213662 NM_214711 XM_018432 XM_027236 XM_027307 XM_029101 XM_029805 XM_031553 XM_031689 XM_032278 XM_032571 XM_032996 XM_034274 XM_034872 XM_038436 XM_039515 XM_039570 XM_039627 XM_039676 XM_039908 XM_041126 XM_042066 XM_042301 XM_042698 XM_042833 XM_042936 XM_042978 XM_043493 XM_044178 XM_044434 XM_044921 XM_045290 XM_046437 XM_046581 XM_047355 XM_047554 XM_047610 XM_048592 XM_048898 XM_049237 XM_050278 XM_051081 XM_051200 XM_054313 XM_055636 XM_056455 XM_057296 XM_058513 XM_058628 XM_059482 XM_059689 XM_059929 XM_059954 XM_066058 XM_067585 XM_084529 XM_085831 XM_086001 XM_086876 XM_087353 XM_087490 XM_087672 XM_088726 XM_097278 XM_097351 XM_113743 XM_113763 XM_113947 XM_117117 XM_117294 XM_166132 XM_166164 XM_166320 XM_168055 XM_168530 XM_170708 XM_170754 XM_171054 XM_172801 XM_172889 XM_173087 XM_208060 XM_208061 XM_208313 XM_208333 XM_208522 XM_208545 XM_209429 XM_209559 XM_209569 XM_209607 XM_209700 XM_210048 XM_211251 XM_211287 XM_211529 XM_211871 XM_211988 XM_290342 XM_290401 XM_290527 XM_290546 XM_290597 XM_290737 XM_290809 XM_290867 XM_290922 XM_291020 XM_291028 XM_291095 XM_291128 XM_291154 XM_291170 XM_291247 XM_291344 XM_291671 XM_291947 XM_292184 XM_292357 XM_292717 XM_293398 XM_293828 XM_293918 XM_294450 XM_294521 XM_294765 XM_295062 XM_295309 XM_297816 XM_350880 XM_370585 XM_370607 XM_370621 XM_370654 XM_370665 XM_370686 XM_370728 XM_370759 XM_370837 XM_370838 XM_370839 XM_370840 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_370965 XM_370980 XM_371009 XM_371074 XM_371139 XM_371151 XM_371181 XM_371204 XM_371214 XM_371230 XM_371254 XM_371299 XM_371302 XM_371304 XM_371461 XM_371470 XM_371476 XM_371486 XM_371488 XM_371514 XM_371535 XM_371542 XM_371575 XM_371590 XM_371614 XM_371623 XM_371664 XM_371670 XM_371680 XM_371741 XM_371754 XM_371757 XM_371759 XM_371760 XM_371761 XM_371770 XM_371777 XM_371778 XM_371783 XM_371801 XM_371820 XM_371838 XM_371891 XM_372004 XM_372028 XM_372030 XM_372038 XM_372039 XM_372090 XM_372097 XM_372110 XM_372118 XM_372267 XM_372556 XM_372579 XM_372584 XM_372723 XM_373453 XM_373498 XM_373513 XM_373546 XM_373594 XM_373600 XM_373616 XM_373660 XM_373671 XM_373704 XM_373726 XM_373744 XM_373811 XM_373826 XM_373827 XM_373850 XM_373885 XM_373896 XM_373909 XM_373925 XM_373950 XM_373958 XM_373967 XM_374002 XM_374004 XM_374013 XM_374021 XM_374052 XM_374053 XM_374059 XM_374069 XM_374070 XM_374086 XM_374113 XM_374115 XM_374133 XM_374162 XM_374192 XM_374249 XM_374266 XM_374317 XM_374326 XM_374414 XM_374422 XM_374484 XM_374529 XM_374589 XM_374766 XM_374803 XM_374902 XM_374912 XM_374915 XM_374919 XM_374973 XM_374983 XM_375029 XM_375099 XM_375152 XM_375174 XM_375183 XM_375307 XM_375357 XM_375359 XM_375373 XM_375449 XM_375456 XM_375527 XM_375558 XM_375606 XM_375608 XM_375629 XM_375632 XM_375646 XM_375669 XM_375697 XM_375713 XM_375803 XM_375821 XM_375838 XM_375853 XM_375914 XM_376018 XM_376051 XM_376062 XM_376148 XM_376179 XM_376186 XM_376189 XM_376207 XM_376212 XM_376241 XM_376254 XM_376257 XM_376269 XM_376303 XM_376320 XM_376372 XM_376386 XM_376412 XM_376454 XM_376550 XM_376558 XM_376560 XM_376586 XM_376587 XM_376588 XM_376652 XM_376677 XM_376679 XM_376680 XM_376684 XM_376720 XM_376722 XM_376727 XM_376783 XM_376784 XM_376795 XM_376841 XM_376846 XM_376902 XM_376905 XM_376981 XM_376986 XM_377002 XM_377041 XM_377259 XM_377476 XM_377742 XM_378184 XM_378202 XM_378203 XM_378247 XM_378250 XM_378259 XM_378272 XM_378273 XM_378299 XM_378300 XM_378301 XM_378312 XM_378316 XM_378327 XM_378329 XM_378346 XM_378349 XM_378353 XM_378358 XM_378362 XM_378363 XM_378368 XM_378372 XM_378379 XM_378389 XM_378390 XM_378394 XM_378411 XM_378413 XM_378421 XM_378452 XM_378456 XM_378460 XM_378462 XM_378473 XM_378487 XM_378491 XM_378507 XM_378512 XM_378517 XM_378523 XM_378529 XM_378535 XM_378538 XM_378544 XM_378545 XM_378546 XM_378550 XM_378553 XM_378567 XM_378573 XM_378589 XM_378590 XM_378608 XM_378620 XM_378623 XM_378625 XM_378661 XM_378678 XM_378684 XM_378686 XM_378692 XM_378698 XM_378701 XM_378708 XM_378735 XM_378743 XM_378746 XM_378747 XM_378751 XM_378753 XM_378756 XM_378758 XM_378777 XM_378783 XM_378786 XM_378787 XM_378793 XM_378795 XM_378810 XM_378824 XM_378843 XM_378852 XM_378866 XM_378876 XM_378883 XM_378886 XM_378914 XM_378917 XM_378921 XM_378925 XM_378946 XM_378964 XM_378970 XM_378971 XM_378973 XM_378976 XM_378980 XM_378982 XM_378983 XM_378985 XM_378993 XM_379029 XM_379030 XM_379041 XM_379044 XM_379046 XM_379060 XM_379068 XM_379069 XM_379075 XM_379079 XM_379086 XM_379096 XM_379097 XM_379100 XM_379102 XM_379108 XM_379111 XM_379112 XM_379121 XM_379123 XM_379135 XM_379136 XM_379141 XM_379156 XM_379173 XM_379177 XM_379183 XM_379189 XM_379203 XM_379204 XM_379205 XM_379206 XM_379207 XM_379214 XM_379215 XM_379228 XM_379230 XM_379243 XM_379254 XM_379255 XM_379273 XM_379276 XM_379280 XM_379309 XM_379320 XM_379324 XM_379339 XM_379363 XM_379373 XM_379381 XM_379386 XM_379398 XM_379403 XM_379409 XM_379437 XM_379452 XM_379454 XM_379456 XM_379459 XM_379474 XM_379477 XM_379482 XM_379483 XM_379510 XM_379534 XM_379535 XM_379562 XM_379582 XM_379584 XM_379592 XM_379594 XM_379595 XM_379597 XM_379608 XM_379619 XM_379622 XM_379629 XM_379632 XM_379634 XM_379637 XM_379656 XM_379667 XM_379668 XM_379694 XM_379696 XM_379716 XM_379720 XM_379736 XM_379798 XM_379800 XM_379877 XM_379892 XM_379931 XM_379933 XM_379934 XM_379940 XM_379967 XM_379977 XM_379979 XM_380089 XM_380092 XM_380098 XM_380099 XM_380103 XM_380131 XM_380159 XM_380160 XM_495798 XM_495841 XM_495844 XM_495845 XM_495848 XM_495872 XM_495873 XM_495874 XM_495877 XM_495881 XM_495886 XM_495888 XM_495890 XM_495909 XM_495918 XM_495937 XM_495950 XM_495961 XM_495989 XM_495996 XM_496036 XM_496048 XM_496050 XM_496054 XM_496056 XM_496061 XM_496070 XM_496076 XM_496081 XM_496088 XM_496093 XM_496096 XM_496103 XM_496115 XM_496216 XM_496223 XM_496251 XM_496255 XM_496266 XM_496268 XM_496290 XM_496299 XM_496315 XM_496316 XM_496328 XM_496358 XM_496388 XM_496390 XM_496391 XM_496394 XM_496399 XM_496401 XM_496515 XM_496519 XM_496539 XM_496547 XM_496575 XM_496579 XM_496584 XM_496603 XM_496608 XM_496637 XM_496672 XM_496682 XM_496690 XM_496692 XM_496723 XM_496724 XM_496777 XM_496780 XM_496798 XM_496799 XM_496836 XM_496844 XM_496849 XM_496873 XM_496879 XM_496895 XM_496905 XM_496916 XM_496959 XM_496966 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_496987 XM_497002 XM_497010 XM_497019 XM_497062 XM_497089 XM_497098 XM_497134 XM_498427 XM_498429 XM_498436 XM_498437 XM_498439 XM_498440 XM_498445 XM_498446 XM_498449 XM_498451 XM_498452 XM_498456 XM_498457 XM_498463 XM_498464 XM_498469 XM_498485 XM_498487 XM_498489 XM_498490 XM_498516 XM_498525 XM_498526 XM_498528 XM_498532 XM_498540 XM_498545 XM_498555 XM_498557 XM_498563 XM_498567 XM_498572 XM_498575 XM_498578 XM_498579 XM_498582 XM_498593 XM_498594 XM_498596 XM_498604 XM_498609 XM_498611 XM_498614 XM_498619 XM_498620 XM_498621 XM_498646 XM_498649 XM_498662 XM_498673 XM_498675 XM_498683 XM_498691 XM_498693 XM_498703 XM_498704 XM_498724 XM_498735 XM_498743 XM_498753 XM_498814 XM_498823 XM_498824 XM_498826 XM_498828 XM_498841 XM_498851 XM_498853 XM_498861 XM_498871 XM_498876 XM_498883 XM_498884 XM_498898 XM_498900 XM_498901 XM_498902 XM_498903 XM_498910 XM_498917 XM_498925 XM_498929 XM_498934 XM_498935 XM_498946 XM_498956 XM_498969 XM_498981 XM_498992 XM_499022 XM_499027 XM_499034 XM_499035 XM_499047 XM_499050 XM_499051 XM_499063 XM_499065 XM_499068 XM_499071 XM_499084 XM_499085 XM_499087 XM_499105 XM_499110 XM_499121 XM_499123 XM_499130 XM_499131 XM_499147 XM_499148 XM_499149 XM_499152 XM_499153 XM_499154 XM_499158 XM_499161 XM_499176 XM_499182 XM_499257 XM_499265 XM_499288 XM_499298 XM_499309 XM_499323 XM_499338 XM_499361 XM_499362 XM_499366 XM_499391 XM_499495 XM_499502 XM_499512 XM_499514 XM_499515 XM_499519 XM_499524 XM_499539 XM_499540 XM_499542 XM_499552 XM_499556 XM_499558 XM_499564 XM_499566 XM_499569 XM_499570 XM_499575 XM_499576 XM_499577 XM_499579 XM_499581 XM_499585 XM_499586 XM_499593 XM_499594 XM_499602 XR_000182 XR_000195 XR_000216 XR_000227 XR_000254 XR_000261 XR_000263 XR_000264 XR_000292
Genes with multiple seed matches:
NM_000028 NM_000030 NM_000031 NM_000065 NM_000080 NM_000081 NM_000112 NM_000132 NM_000139 NM_000143 NM_000164 NM_000165 NM_000167 NM_000176 NM_000189 NM_000192 NM_000210 NM_000216 NM_000222 NM_000237 NM_000239 NM_000242 NM_000248 NM_000254 NM_000272 NM_000304 NM_000321 NM_000332 NM_000337 NM_000349 NM_000351 NM_000361 NM_000362 NM_000368 NM_000369 NM_000376 NM_000381 NM_000386 NM_000430 NM_000436 NM_000439 NM_000448 NM_000450 NM_000452 NM_000476 NM_000489 NM_000493 NM_000494 NM_000497 NM_000499 NM_000503 NM_000511 NM_000533 NM_000555 NM_000566 NM_000610 NM_000611 NM_000614 NM_000618 NM_000623 NM_000627 NM_000628 NM_000629 NM_000633 NM_000641 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000664 NM_000721 NM_000792 NM_000794 NM_000809 NM_000810 NM_000833 NM_000838 NM_000840 NM_000842 NM_000872 NM_000876 NM_000891 NM_000901 NM_000902 NM_000921 NM_000933 NM_000943 NM_000950 NM_000956 NM_000959 NM_000961 NM_000962 NM_000963 NM_000965 NM_000997 NM_001001331 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001523 NM_001001669 NM_001001677 NM_001001686 NM_001001690 NM_001001696 NM_001001698 NM_001001704 NM_001001707 NM_001001709 NM_001001890 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001974 NM_001002014 NM_001002015 NM_001002231 NM_001002232 NM_001002254 NM_001002265 NM_001002266 NM_001002269 NM_001002843 NM_001002860 NM_001002926 NM_001003399 NM_001003652 NM_001003674 NM_001003675 NM_001003682 NM_001003684 NM_001003689 NM_001003796 NM_001003800 NM_001003807 NM_001003818 NM_001003894 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001004053 NM_001004298 NM_001004299 NM_001004303 NM_001004313 NM_001004322 NM_001004328 NM_001004335 NM_001004355 NM_001004441 NM_001005210 NM_001005303 NM_001005375 NM_001005388 NM_001005404 NM_001005463 NM_001005473 NM_001005505 NM_001005609 NM_001005785 NM_001005786 NM_001005845 NM_001005861 NM_001005920 NM_001006600 NM_001006617 NM_001006619 NM_001006620 NM_001006621 NM_001006624 NM_001006625 NM_001006633 NM_001006657 NM_001007024 NM_001007025 NM_001007067 NM_001007068 NM_001007069 NM_001007070 NM_001007094 NM_001007097 NM_001007225 NM_001007226 NM_001007227 NM_001007228 NM_001007229 NM_001007230 NM_001007243 NM_001007262 NM_001007271 NM_001007274 NM_001007278 NM_001007466 NM_001007535 NM_001007546 NM_001007559 NM_001008211 NM_001008212 NM_001008213 NM_001008215 NM_001008223 NM_001008239 NM_001008390 NM_001008392 NM_001008406 NM_001008408 NM_001008410 NM_001008493 NM_001008494 NM_001008537 NM_001008539 NM_001008726 NM_001008738 NM_001008781 NM_001009555 NM_001009566 NM_001009883 NM_001009909 NM_001009913 NM_001010846 NM_001010862 NM_001010867 NM_001010874 NM_001010883 NM_001010888 NM_001010891 NM_001010898 NM_001010903 NM_001010910 NM_001010925 NM_001010984 NM_001011513 NM_001011514 NM_001011546 NM_001011547 NM_001011552 NM_001011656 NM_001011657 NM_001011664 NM_001011666 NM_001011885 NM_001012239 NM_001012267 NM_001012274 NM_001012339 NM_001012393 NM_001012418 NM_001012420 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012511 NM_001012626 NM_001012651 NM_001012659 NM_001012711 NM_001012714 NM_001012733 NM_001012734 NM_001012755 NM_001012761 NM_001013031 NM_001013406 NM_001013656 NM_001013666 NM_001013667 NM_001013677 NM_001013680 NM_001013681 NM_001013688 NM_001013704 NM_001013721 NM_001013839 NM_001014342 NM_001014380 NM_001014797 NM_001015048 NM_001015049 NM_001015877 NM_001015882 NM_001015886 NM_001017395 NM_001017424 NM_001017425 NM_001017535 NM_001017922 NM_001017970 NM_001018008 NM_001018037 NM_001018058 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018089 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018104 NM_001018111 NM_001018116 NM_001023560 NM_001023563 NM_001023565 NM_001023567 NM_001023582 NM_001024094 NM_001024401 NM_001024457 NM_001024592 NM_001024631 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024676 NM_001024681 NM_001024843 NM_001024855 NM_001024916 NM_001024933 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025081 NM_001025090 NM_001025092 NM_001025094 NM_001025098 NM_001025100 NM_001025101 NM_001025108 NM_001025201 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001080 NM_001093 NM_001114 NM_001121 NM_001131 NM_001141 NM_001146 NM_001167 NM_001177 NM_001204 NM_001206 NM_001227 NM_001241 NM_001250 NM_001259 NM_001282 NM_001289 NM_001290 NM_001310 NM_001351 NM_001390 NM_001394 NM_001396 NM_001399 NM_001401 NM_001414 NM_001419 NM_001432 NM_001480 NM_001490 NM_001491 NM_001497 NM_001543 NM_001556 NM_001560 NM_001610 NM_001627 NM_001634 NM_001683 NM_001684 NM_001688 NM_001709 NM_001716 NM_001720 NM_001730 NM_001736 NM_001742 NM_001754 NM_001755 NM_001759 NM_001777 NM_001797 NM_001821 NM_001822 NM_001854 NM_001855 NM_001858 NM_001938 NM_001941 NM_001946 NM_001949 NM_001964 NM_001969 NM_001987 NM_002006 NM_002025 NM_002040 NM_002069 NM_002073 NM_002077 NM_002092 NM_002140 NM_002158 NM_002182 NM_002221 NM_002232 NM_002237 NM_002241 NM_002251 NM_002265 NM_002267 NM_002285 NM_002293 NM_002304 NM_002312 NM_002319 NM_002336 NM_002355 NM_002357 NM_002385 NM_002387 NM_002397 NM_002401 NM_002429 NM_002430 NM_002449 NM_002460 NM_002481 NM_002514 NM_002524 NM_002526 NM_002545 NM_002553 NM_002577 NM_002581 NM_002582 NM_002599 NM_002600 NM_002610 NM_002617 NM_002623 NM_002641 NM_002655 NM_002662 NM_002664 NM_002667 NM_002709 NM_002711 NM_002714 NM_002716 NM_002719 NM_002725 NM_002731 NM_002736 NM_002737 NM_002747 NM_002760 NM_002816 NM_002871 NM_002874 NM_002875 NM_002880 NM_002881 NM_002886 NM_002894 NM_002898 NM_002906 NM_002911 NM_002922 NM_002927 NM_002942 NM_002958 NM_002959 NM_002968 NM_002971 NM_003006 NM_003010 NM_003012 NM_003017 NM_003023 NM_003046 NM_003108 NM_003112 NM_003113 NM_003137 NM_003149 NM_003161 NM_003162 NM_003165 NM_003188 NM_003203 NM_003234 NM_003236 NM_003244 NM_003247 NM_003255 NM_003262 NM_003328 NM_003369 NM_003377 NM_003387 NM_003388 NM_003392 NM_003404 NM_003413 NM_003421 NM_003435 NM_003436 NM_003438 NM_003439 NM_003478 NM_003479 NM_003483 NM_003486 NM_003489 NM_003490 NM_003496 NM_003506 NM_003563 NM_003590 NM_003597 NM_003605 NM_003622 NM_003644 NM_003661 NM_003663 NM_003671 NM_003672 NM_003676 NM_003681 NM_003713 NM_003722 NM_003724 NM_003759 NM_003763 NM_003800 NM_003803 NM_003810 NM_003816 NM_003822 NM_003851 NM_003861 NM_003877 NM_003884 NM_003887 NM_003895 NM_003898 NM_003909 NM_003913 NM_003939 NM_003953 NM_004004 NM_004036 NM_004051 NM_004060 NM_004079 NM_004081 NM_004091 NM_004093 NM_004094 NM_004096 NM_004117 NM_004128 NM_004133 NM_004161 NM_004164 NM_004171 NM_004172 NM_004200 NM_004227 NM_004236 NM_004272 NM_004293 NM_004311 NM_004315 NM_004319 NM_004337 NM_004338 NM_004350 NM_004367 NM_004376 NM_004384 NM_004392 NM_004393 NM_004414 NM_004430 NM_004431 NM_004438 NM_004439 NM_004441 NM_004442 NM_004447 NM_004459 NM_004505 NM_004513 NM_004554 NM_004571 NM_004586 NM_004598 NM_004602 NM_004612 NM_004619 NM_004657 NM_004660 NM_004663 NM_004666 NM_004686 NM_004687 NM_004702 NM_004703 NM_004709 NM_004717 NM_004729 NM_004734 NM_004736 NM_004738 NM_004745 NM_004747 NM_004759 NM_004766 NM_004774 NM_004775 NM_004797 NM_004798 NM_004807 NM_004820 NM_004842 NM_004859 NM_004863 NM_004869 NM_004871 NM_004873 NM_004897 NM_004904 NM_004912 NM_004921 NM_004929 NM_004956 NM_004983 NM_004985 NM_004992 NM_004998 NM_005008 NM_005036 NM_005044 NM_005045 NM_005047 NM_005060 NM_005063 NM_005065 NM_005076 NM_005079 NM_005081 NM_005082 NM_005093 NM_005095 NM_005116 NM_005188 NM_005197 NM_005199 NM_005207 NM_005224 NM_005239 NM_005264 NM_005272 NM_005296 NM_005312 NM_005329 NM_005338 NM_005385 NM_005388 NM_005397 NM_005431 NM_005433 NM_005436 NM_005472 NM_005499 NM_005504 NM_005513 NM_005522 NM_005536 NM_005542 NM_005551 NM_005565 NM_005570 NM_005595 NM_005625 NM_005630 NM_005637 NM_005639 NM_005647 NM_005656 NM_005658 NM_005665 NM_005668 NM_005669 NM_005701 NM_005715 NM_005739 NM_005748 NM_005766 NM_005769 NM_005779 NM_005797 NM_005798 NM_005802 NM_005808 NM_005813 NM_005816 NM_005819 NM_005828 NM_005840 NM_005843 NM_005895 NM_005901 NM_005902 NM_005903 NM_005931 NM_005933 NM_005935 NM_005942 NM_005943 NM_005965 NM_006010 NM_006025 NM_006030 NM_006037 NM_006052 NM_006096 NM_006113 NM_006116 NM_006122 NM_006141 NM_006154 NM_006166 NM_006187 NM_006203 NM_006212 NM_006237 NM_006240 NM_006241 NM_006242 NM_006246 NM_006253 NM_006258 NM_006265 NM_006275 NM_006283 NM_006306 NM_006315 NM_006355 NM_006367 NM_006371 NM_006375 NM_006393 NM_006401 NM_006407 NM_006439 NM_006457 NM_006464 NM_006465 NM_006474 NM_006496 NM_006504 NM_006517 NM_006532 NM_006534 NM_006538 NM_006544 NM_006546 NM_006548 NM_006549 NM_006561 NM_006575 NM_006591 NM_006599 NM_006609 NM_006618 NM_006646 NM_006667 NM_006699 NM_006722 NM_006729 NM_006738 NM_006742 NM_006746 NM_006762 NM_006764 NM_006773 NM_006789 NM_006813 NM_006818 NM_006820 NM_006827 NM_006847 NM_006850 NM_006870 NM_006888 NM_006895 NM_006902 NM_006916 NM_006931 NM_006955 NM_006961 NM_006981 NM_006984 NM_007007 NM_007010 NM_007014 NM_007035 NM_007036 NM_007050 NM_007053 NM_007065 NM_007068 NM_007078 NM_007111 NM_007146 NM_007150 NM_007151 NM_007159 NM_007175 NM_007200 NM_007203 NM_007211 NM_007213 NM_007229 NM_007246 NM_007249 NM_007262 NM_007271 NM_007287 NM_007288 NM_007289 NM_007306 NM_007331 NM_007332 NM_007335 NM_007336 NM_007338 NM_007351 NM_012069 NM_012081 NM_012083 NM_012089 NM_012102 NM_012104 NM_012121 NM_012129 NM_012158 NM_012174 NM_012219 NM_012252 NM_012262 NM_012286 NM_012287 NM_012288 NM_012290 NM_012297 NM_012300 NM_012304 NM_012306 NM_012309 NM_012325 NM_012345 NM_012406 NM_012409 NM_012425 NM_012431 NM_012464 NM_012465 NM_013230 NM_013231 NM_013252 NM_013255 NM_013262 NM_013276 NM_013282 NM_013286 NM_013309 NM_013313 NM_013316 NM_013372 NM_013374 NM_013375 NM_013387 NM_013393 NM_013402 NM_013444 NM_013447 NM_013450 NM_014005 NM_014007 NM_014021 NM_014023 NM_014048 NM_014050 NM_014057 NM_014066 NM_014106 NM_014141 NM_014157 NM_014207 NM_014217 NM_014243 NM_014319 NM_014324 NM_014333 NM_014349 NM_014351 NM_014368 NM_014369 NM_014388 NM_014394 NM_014395 NM_014396 NM_014397 NM_014418 NM_014421 NM_014468 NM_014479 NM_014518 NM_014548 NM_014553 NM_014572 NM_014586 NM_014592 NM_014607 NM_014614 NM_014616 NM_014620 NM_014631 NM_014636 NM_014646 NM_014656 NM_014670 NM_014679 NM_014682 NM_014683 NM_014690 NM_014701 NM_014702 NM_014703 NM_014704 NM_014719 NM_014723 NM_014729 NM_014730 NM_014732 NM_014733 NM_014734 NM_014735 NM_014739 NM_014746 NM_014755 NM_014772 NM_014776 NM_014781 NM_014787 NM_014788 NM_014800 NM_014803 NM_014805 NM_014819 NM_014821 NM_014828 NM_014830 NM_014836 NM_014844 NM_014850 NM_014854 NM_014862 NM_014864 NM_014867 NM_014868 NM_014869 NM_014880 NM_014893 NM_014899 NM_014903 NM_014909 NM_014910 NM_014919 NM_014924 NM_014934 NM_014935 NM_014940 NM_014944 NM_014946 NM_014949 NM_014953 NM_014961 NM_014962 NM_014978 NM_014991 NM_014992 NM_015001 NM_015003 NM_015008 NM_015009 NM_015020 NM_015022 NM_015025 NM_015027 NM_015035 NM_015039 NM_015044 NM_015051 NM_015052 NM_015053 NM_015056 NM_015070 NM_015076 NM_015082 NM_015087 NM_015088 NM_015090 NM_015092 NM_015094 NM_015100 NM_015101 NM_015115 NM_015130 NM_015137 NM_015144 NM_015169 NM_015178 NM_015194 NM_015200 NM_015208 NM_015215 NM_015219 NM_015229 NM_015238 NM_015250 NM_015263 NM_015267 NM_015271 NM_015278 NM_015282 NM_015286 NM_015288 NM_015293 NM_015294 NM_015310 NM_015314 NM_015323 NM_015336 NM_015346 NM_015352 NM_015375 NM_015378 NM_015385 NM_015393 NM_015394 NM_015396 NM_015397 NM_015409 NM_015411 NM_015416 NM_015443 NM_015455 NM_015458 NM_015463 NM_015464 NM_015497 NM_015550 NM_015560 NM_015564 NM_015567 NM_015568 NM_015569 NM_015570 NM_015576 NM_015621 NM_015635 NM_015640 NM_015655 NM_015695 NM_015886 NM_015898 NM_015901 NM_015910 NM_015938 NM_015946 NM_015975 NM_015995 NM_016018 NM_016019 NM_016021 NM_016025 NM_016040 NM_016045 NM_016076 NM_016081 NM_016107 NM_016114 NM_016124 NM_016131 NM_016132 NM_016152 NM_016206 NM_016225 NM_016255 NM_016264 NM_016271 NM_016282 NM_016322 NM_016377 NM_016389 NM_016441 NM_016445 NM_016472 NM_016485 NM_016530 NM_016534 NM_016536 NM_016540 NM_016544 NM_016546 NM_016548 NM_016562 NM_016563 NM_016577 NM_016613 NM_016617 NM_016620 NM_016622 NM_016651 NM_016824 NM_016831 NM_016930 NM_017413 NM_017420 NM_017444 NM_017450 NM_017452 NM_017453 NM_017454 NM_017523 NM_017540 NM_017542 NM_017546 NM_017583 NM_017584 NM_017588 NM_017594 NM_017610 NM_017628 NM_017637 NM_017644 NM_017645 NM_017661 NM_017680 NM_017692 NM_017712 NM_017719 NM_017736 NM_017742 NM_017752 NM_017761 NM_017769 NM_017778 NM_017787 NM_017821 NM_017822 NM_017847 NM_017927 NM_017935 NM_017952 NM_018014 NM_018027 NM_018045 NM_018048 NM_018057 NM_018061 NM_018069 NM_018089 NM_018091 NM_018108 NM_018115 NM_018128 NM_018156 NM_018167 NM_018170 NM_018181 NM_018204 NM_018211 NM_018212 NM_018224 NM_018227 NM_018234 NM_018257 NM_018263 NM_018267 NM_018293 NM_018323 NM_018339 NM_018340 NM_018342 NM_018353 NM_018362 NM_018364 NM_018367 NM_018374 NM_018382 NM_018420 NM_018427 NM_018439 NM_018440 NM_018452 NM_018463 NM_018469 NM_018475 NM_018479 NM_018489 NM_018518 NM_018538 NM_018566 NM_018590 NM_018695 NM_018704 NM_018708 NM_018719 NM_018727 NM_018841 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018947 NM_018976 NM_018977 NM_018999 NM_019000 NM_019022 NM_019035 NM_019044 NM_019069 NM_019080 NM_019084 NM_019087 NM_019094 NM_019106 NM_019114 NM_019556 NM_019610 NM_019859 NM_019860 NM_019863 NM_019885 NM_019903 NM_020066 NM_020119 NM_020130 NM_020131 NM_020133 NM_020141 NM_020143 NM_020144 NM_020165 NM_020177 NM_020180 NM_020193 NM_020208 NM_020245 NM_020337 NM_020338 NM_020341 NM_020345 NM_020348 NM_020361 NM_020363 NM_020364 NM_020367 NM_020381 NM_020390 NM_020405 NM_020420 NM_020429 NM_020445 NM_020448 NM_020463 NM_020468 NM_020472 NM_020473 NM_020474 NM_020546 NM_020550 NM_020645 NM_020661 NM_020673 NM_020689 NM_020699 NM_020702 NM_020717 NM_020742 NM_020745 NM_020748 NM_020755 NM_020774 NM_020776 NM_020779 NM_020782 NM_020786 NM_020792 NM_020795 NM_020800 NM_020802 NM_020809 NM_020813 NM_020817 NM_020825 NM_020826 NM_020830 NM_020858 NM_020861 NM_020863 NM_020866 NM_020914 NM_020921 NM_020933 NM_020935 NM_020940 NM_020948 NM_021030 NM_021038 NM_021045 NM_021090 NM_021101 NM_021110 NM_021116 NM_021133 NM_021136 NM_021146 NM_021155 NM_021161 NM_021181 NM_021183 NM_021212 NM_021215 NM_021216 NM_021224 NM_021252 NM_021260 NM_021622 NM_021629 NM_021638 NM_021645 NM_021783 NM_021784 NM_021795 NM_021807 NM_021812 NM_021813 NM_021814 NM_021815 NM_021832 NM_021914 NM_021916 NM_021940 NM_021945 NM_021961 NM_021977 NM_021980 NM_022050 NM_022051 NM_022074 NM_022106 NM_022121 NM_022124 NM_022138 NM_022153 NM_022351 NM_022405 NM_022451 NM_022459 NM_022463 NM_022483 NM_022484 NM_022491 NM_022552 NM_022648 NM_022652 NM_022716 NM_022720 NM_022725 NM_022749 NM_022755 NM_022766 NM_022770 NM_022781 NM_022782 NM_022791 NM_022792 NM_022832 NM_022837 NM_022840 NM_022842 NM_022843 NM_022845 NM_022893 NM_022898 NM_022899 NM_022900 NM_022912 NM_023002 NM_023005 NM_023016 NM_024017 NM_024043 NM_024052 NM_024071 NM_024090 NM_024092 NM_024095 NM_024117 NM_024324 NM_024327 NM_024408 NM_024416 NM_024423 NM_024490 NM_024512 NM_024513 NM_024541 NM_024554 NM_024557 NM_024561 NM_024563 NM_024569 NM_024575 NM_024583 NM_024598 NM_024607 NM_024611 NM_024612 NM_024614 NM_024629 NM_024631 NM_024638 NM_024641 NM_024645 NM_024646 NM_024649 NM_024654 NM_024665 NM_024666 NM_024683 NM_024685 NM_024686 NM_024689 NM_024745 NM_024758 NM_024761 NM_024778 NM_024785 NM_024795 NM_024824 NM_024828 NM_024837 NM_024843 NM_024871 NM_024881 NM_024900 NM_024942 NM_024943 NM_024989 NM_025125 NM_025133 NM_025160 NM_025161 NM_025164 NM_025191 NM_025195 NM_025218 NM_025235 NM_025237 NM_025238 NM_030625 NM_030627 NM_030629 NM_030633 NM_030644 NM_030650 NM_030661 NM_030665 NM_030670 NM_030671 NM_030755 NM_030762 NM_030781 NM_030786 NM_030794 NM_030806 NM_030882 NM_030891 NM_030918 NM_030919 NM_030945 NM_030953 NM_030962 NM_030964 NM_030965 NM_031262 NM_031263 NM_031292 NM_031409 NM_031411 NM_031418 NM_031435 NM_031436 NM_031439 NM_031442 NM_031444 NM_031445 NM_031469 NM_031474 NM_031849 NM_031857 NM_031860 NM_031911 NM_031913 NM_031939 NM_031952 NM_032047 NM_032105 NM_032116 NM_032139 NM_032145 NM_032151 NM_032160 NM_032174 NM_032186 NM_032195 NM_032208 NM_032227 NM_032276 NM_032291 NM_032300 NM_032325 NM_032329 NM_032352 NM_032374 NM_032408 NM_032421 NM_032427 NM_032439 NM_032441 NM_032445 NM_032449 NM_032458 NM_032486 NM_032492 NM_032509 NM_032525 NM_032549 NM_032554 NM_032607 NM_032622 NM_032632 NM_032644 NM_032717 NM_032738 NM_032765 NM_032770 NM_032804 NM_032818 NM_032829 NM_032838 NM_032858 NM_032866 NM_032869 NM_032886 NM_032899 NM_032900 NM_032932 NM_032933 NM_032960 NM_032966 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032980 NM_033014 NM_033052 NM_033071 NM_033087 NM_033109 NM_033133 NM_033143 NM_033161 NM_033207 NM_033211 NM_033224 NM_033238 NM_033262 NM_033291 NM_033305 NM_033331 NM_033338 NM_033339 NM_033340 NM_033346 NM_033360 NM_033389 NM_033393 NM_033394 NM_033397 NM_033421 NM_033425 NM_033426 NM_033427 NM_033428 NM_033429 NM_033503 NM_033505 NM_033512 NM_033540 NM_033631 NM_033637 NM_033644 NM_033645 NM_033656 NM_052811 NM_052821 NM_052851 NM_052879 NM_052887 NM_052906 NM_052910 NM_052918 NM_052932 NM_052937 NM_052954 NM_052978 NM_053002 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053064 NM_053286 NM_054026 NM_057158 NM_057159 NM_057169 NM_057170 NM_057175 NM_057735 NM_057749 NM_058166 NM_058240 NM_058241 NM_078469 NM_078470 NM_078483 NM_078628 NM_080473 NM_080546 NM_080551 NM_080591 NM_080628 NM_080629 NM_080630 NM_080665 NM_080666 NM_080676 NM_080704 NM_080705 NM_080706 NM_080717 NM_080725 NM_080737 NM_080759 NM_080760 NM_080821 NM_080836 NM_080867 NM_080872 NM_080874 NM_080927 NM_101395 NM_130387 NM_130435 NM_130436 NM_130437 NM_130438 NM_130442 NM_130446 NM_130778 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130847 NM_133170 NM_133329 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133367 NM_133372 NM_133443 NM_133445 NM_133451 NM_133452 NM_133463 NM_133477 NM_133487 NM_133490 NM_133509 NM_133632 NM_133633 NM_133646 NM_133650 NM_138270 NM_138271 NM_138280 NM_138298 NM_138317 NM_138318 NM_138323 NM_138324 NM_138357 NM_138368 NM_138400 NM_138409 NM_138423 NM_138428 NM_138444 NM_138450 NM_138457 NM_138468 NM_138473 NM_138553 NM_138559 NM_138576 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138633 NM_138638 NM_138640 NM_138694 NM_138713 NM_138714 NM_138715 NM_138716 NM_138726 NM_138731 NM_138781 NM_138788 NM_138799 NM_138809 NM_138928 NM_138969 NM_138971 NM_138972 NM_138973 NM_139168 NM_139244 NM_139319 NM_139321 NM_139323 NM_144570 NM_144578 NM_144599 NM_144664 NM_144682 NM_144701 NM_144766 NM_144767 NM_144778 NM_144973 NM_144982 NM_144996 NM_145011 NM_145021 NM_145055 NM_145117 NM_145257 NM_145263 NM_145279 NM_145298 NM_145307 NM_145310 NM_145311 NM_145313 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145331 NM_145332 NM_145333 NM_145343 NM_145344 NM_145637 NM_145639 NM_145640 NM_145641 NM_145642 NM_145646 NM_145649 NM_145655 NM_145693 NM_145728 NM_145759 NM_145793 NM_145858 NM_145911 NM_147131 NM_147132 NM_148842 NM_148894 NM_152223 NM_152224 NM_152225 NM_152226 NM_152235 NM_152253 NM_152261 NM_152275 NM_152280 NM_152287 NM_152300 NM_152302 NM_152317 NM_152340 NM_152341 NM_152361 NM_152376 NM_152380 NM_152382 NM_152387 NM_152395 NM_152409 NM_152418 NM_152429 NM_152431 NM_152433 NM_152444 NM_152449 NM_152464 NM_152488 NM_152511 NM_152519 NM_152520 NM_152523 NM_152588 NM_152609 NM_152622 NM_152624 NM_152630 NM_152635 NM_152638 NM_152655 NM_152660 NM_152678 NM_152686 NM_152688 NM_152695 NM_152702 NM_152707 NM_152724 NM_152734 NM_152736 NM_152753 NM_152774 NM_152776 NM_152793 NM_152834 NM_152835 NM_152854 NM_152864 NM_152903 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152999 NM_153010 NM_153013 NM_153027 NM_153029 NM_153041 NM_153042 NM_153050 NM_153051 NM_153184 NM_153218 NM_153235 NM_153238 NM_153266 NM_153321 NM_153322 NM_153345 NM_153348 NM_153350 NM_153355 NM_153356 NM_153362 NM_153367 NM_153442 NM_153499 NM_153500 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153620 NM_153631 NM_153632 NM_153633 NM_153675 NM_153676 NM_153686 NM_153688 NM_153705 NM_153712 NM_153759 NM_153816 NM_153818 NM_156036 NM_170609 NM_170672 NM_170695 NM_170706 NM_170723 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170740 NM_170750 NM_170768 NM_171998 NM_172058 NM_172059 NM_172060 NM_172177 NM_172178 NM_172216 NM_172217 NM_172226 NM_172234 NM_172344 NM_172346 NM_172367 NM_172375 NM_173054 NM_173079 NM_173082 NM_173198 NM_173200 NM_173207 NM_173208 NM_173209 NM_173210 NM_173211 NM_173214 NM_173462 NM_173464 NM_173466 NM_173478 NM_173510 NM_173511 NM_173522 NM_173536 NM_173548 NM_173582 NM_173599 NM_173627 NM_173654 NM_173661 NM_173664 NM_173667 NM_173677 NM_173683 NM_173698 NM_173795 NM_173812 NM_173817 NM_173822 NM_173823 NM_173851 NM_174871 NM_174878 NM_174886 NM_174901 NM_174902 NM_174911 NM_175061 NM_175069 NM_175071 NM_175072 NM_175073 NM_175078 NM_175571 NM_175629 NM_175736 NM_175767 NM_175854 NM_175864 NM_175884 NM_175907 NM_175922 NM_176823 NM_176874 NM_177414 NM_177442 NM_177549 NM_177551 NM_177924 NM_177937 NM_177974 NM_177990 NM_178006 NM_178007 NM_178129 NM_178140 NM_178151 NM_178152 NM_178153 NM_178177 NM_178423 NM_178441 NM_178505 NM_178509 NM_178514 NM_178516 NM_178520 NM_178527 NM_178544 NM_178550 NM_178566 NM_178583 NM_178585 NM_178586 NM_178816 NM_178818 NM_178823 NM_178831 NM_180989 NM_180991 NM_181041 NM_181076 NM_181077 NM_181332 NM_181337 NM_181339 NM_181349 NM_181358 NM_181435 NM_181443 NM_181481 NM_181482 NM_181483 NM_181486 NM_181504 NM_181523 NM_181524 NM_181659 NM_181704 NM_181723 NM_181724 NM_181740 NM_181774 NM_181789 NM_181836 NM_181847 NM_182314 NM_182472 NM_182481 NM_182482 NM_182484 NM_182485 NM_182501 NM_182508 NM_182518 NM_182534 NM_182540 NM_182568 NM_182584 NM_182587 NM_182596 NM_182626 NM_182631 NM_182641 NM_182646 NM_182661 NM_182751 NM_182752 NM_182758 NM_182765 NM_182797 NM_182831 NM_182848 NM_182896 NM_182898 NM_182899 NM_182915 NM_182932 NM_182933 NM_182936 NM_182948 NM_182961 NM_182964 NM_182966 NM_182970 NM_183002 NM_183004 NM_183238 NM_183376 NM_183382 NM_194071 NM_194282 NM_194283 NM_194286 NM_194290 NM_194298 NM_194299 NM_194313 NM_194314 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194454 NM_194455 NM_194456 NM_197941 NM_197973 NM_198128 NM_198151 NM_198158 NM_198159 NM_198177 NM_198178 NM_198196 NM_198207 NM_198225 NM_198266 NM_198268 NM_198269 NM_198270 NM_198287 NM_198321 NM_198336 NM_198337 NM_198389 NM_198390 NM_198392 NM_198399 NM_198400 NM_198401 NM_198403 NM_198404 NM_198439 NM_198458 NM_198465 NM_198466 NM_198484 NM_198485 NM_198496 NM_198499 NM_198501 NM_198504 NM_198562 NM_198581 NM_198595 NM_198679 NM_198793 NM_198794 NM_198835 NM_198841 NM_198847 NM_198859 NM_198900 NM_198907 NM_198935 NM_198947 NM_198968 NM_199040 NM_199045 NM_199072 NM_199126 NM_199131 NM_199139 NM_199160 NM_199162 NM_199176 NM_199188 NM_199190 NM_199229 NM_199246 NM_199324 NM_199421 NM_199423 NM_199424 NM_199436 NM_199451 NM_199452 NM_199462 NM_199478 NM_199513 NM_201252 NM_201269 NM_201348 NM_201403 NM_201432 NM_201433 NM_201546 NM_201550 NM_201613 NM_203291 NM_203308 NM_203314 NM_203315 NM_203327 NM_203329 NM_203330 NM_203331 NM_203351 NM_203382 NM_203391 NM_203417 NM_203418 NM_203436 NM_203446 NM_203452 NM_203497 NM_203504 NM_203505 NM_205855 NM_205857 NM_205860 NM_206834 NM_206852 NM_206854 NM_206855 NM_206857 NM_206876 NM_206877 NM_206909 NM_206933 NM_206937 NM_206943 NM_206963 NM_207003 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207335 NM_207367 NM_207394 NM_207401 NM_207404 NM_207412 NM_207429 NM_207434 NM_207463 NM_207469 NM_207470 NM_207474 NM_207475 NM_207479 NM_207481 NM_207482 NM_207489 NM_207497 NM_207504 NM_207517 NM_207660 NM_207661 NM_207662 NM_212554 NM_212559 NM_213589 NM_213590 NM_213593 NM_213606 NM_214711 XM_032278 XM_032571 XM_034274 XM_034872 XM_039515 XM_039570 XM_039627 XM_039676 XM_042066 XM_042301 XM_042698 XM_043493 XM_044178 XM_044434 XM_045290 XM_047355 XM_048592 XM_048898 XM_055636 XM_059482 XM_059689 XM_059929 XM_067585 XM_113743 XM_113947 XM_117117 XM_117294 XM_166320 XM_168530 XM_171054 XM_209569 XM_209607 XM_209700 XM_210048 XM_211529 XM_290546 XM_290597 XM_290737 XM_290922 XM_291028 XM_291128 XM_291247 XM_291344 XM_291671 XM_292717 XM_370607 XM_370654 XM_370728 XM_370837 XM_370838 XM_370839 XM_370840 XM_370843 XM_370917 XM_371074 XM_371204 XM_371254 XM_371302 XM_371304 XM_371461 XM_371590 XM_371664 XM_371680 XM_371759 XM_371761 XM_371783 XM_371838 XM_372028 XM_372030 XM_372039 XM_372556 XM_372584 XM_373513 XM_373744 XM_374317 XM_374484 XM_374912 XM_374973 XM_374983 XM_375152 XM_375373 XM_375449 XM_375527 XM_375606 XM_375669 XM_375821 XM_375853 XM_376062 XM_376254 XM_376269 XM_376303 XM_376372 XM_376454 XM_376558 XM_376586 XM_376588 XM_376679 XM_376680 XM_376783 XM_376795 XM_376902 XM_376905 XM_376986 XM_377041 XM_378202 XM_378247 XM_378259 XM_378273 XM_378299 XM_378300 XM_378312 XM_378316 XM_378327 XM_378329 XM_378358 XM_378362 XM_378372 XM_378379 XM_378389 XM_378394 XM_378460 XM_378512 XM_378517 XM_378529 XM_378544 XM_378550 XM_378573 XM_378589 XM_378608 XM_378620 XM_378625 XM_378686 XM_378698 XM_378735 XM_378753 XM_378758 XM_378783 XM_378795 XM_378810 XM_378852 XM_378866 XM_378886 XM_378914 XM_378925 XM_378946 XM_378982 XM_378983 XM_379068 XM_379075 XM_379079 XM_379141 XM_379189 XM_379205 XM_379206 XM_379207 XM_379214 XM_379215 XM_379243 XM_379276 XM_379403 XM_379409 XM_379482 XM_379510 XM_379584 XM_379595 XM_379629 XM_379634 XM_379637 XM_379667 XM_379694 XM_379720 XM_379736 XM_379798 XM_379800 XM_379933 XM_379934 XM_380098 XM_380131 XM_495848 XM_495886 XM_495890 XM_495909 XM_495937 XM_496036 XM_496050 XM_496054 XM_496070 XM_496093 XM_496315 XM_496328 XM_496401 XM_496519 XM_496547 XM_496575 XM_496690 XM_496692 XM_496723 XM_496780 XM_496836 XM_496849 XM_496879 XM_496959 XM_496966 XM_496984 XM_497089 XM_498429 XM_498439 XM_498440 XM_498446 XM_498451 XM_498452 XM_498469 XM_498555 XM_498557 XM_498567 XM_498582 XM_498596 XM_498611 XM_498662 XM_498673 XM_498735 XM_498823 XM_498824 XM_498851 XM_498901 XM_498946 XM_498992 XM_499047 XM_499065 XM_499123 XM_499147 XM_499148 XM_499149 XM_499182 XM_499257 XM_499298 XM_499495 XM_499514 XM_499515 XM_499558 XM_499569 XM_499570 XM_499576 XM_499577 XM_499581 XR_000195 XR_000227 XR_000261 XR_000292
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)