VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"agagaucacuguggcuacauc"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
4103
.
Total Genes with multiple seed matches:
826
.
Genes with at least one seed match:
NM_000016 NM_000028 NM_000037 NM_000046 NM_000056 NM_000061 NM_000066 NM_000080 NM_000084 NM_000088 NM_000092 NM_000103 NM_000109 NM_000110 NM_000115 NM_000125 NM_000126 NM_000129 NM_000134 NM_000139 NM_000141 NM_000148 NM_000153 NM_000162 NM_000163 NM_000165 NM_000167 NM_000176 NM_000179 NM_000190 NM_000219 NM_000222 NM_000227 NM_000231 NM_000232 NM_000242 NM_000246 NM_000250 NM_000262 NM_000266 NM_000276 NM_000278 NM_000283 NM_000291 NM_000297 NM_000299 NM_000313 NM_000314 NM_000315 NM_000319 NM_000320 NM_000330 NM_000332 NM_000333 NM_000334 NM_000337 NM_000340 NM_000346 NM_000351 NM_000361 NM_000362 NM_000381 NM_000382 NM_000383 NM_000389 NM_000393 NM_000402 NM_000406 NM_000410 NM_000411 NM_000412 NM_000428 NM_000439 NM_000441 NM_000448 NM_000449 NM_000459 NM_000460 NM_000462 NM_000477 NM_000480 NM_000484 NM_000495 NM_000497 NM_000503 NM_000509 NM_000510 NM_000525 NM_000530 NM_000536 NM_000538 NM_000551 NM_000560 NM_000611 NM_000617 NM_000618 NM_000627 NM_000628 NM_000629 NM_000633 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000655 NM_000661 NM_000663 NM_000664 NM_000667 NM_000668 NM_000669 NM_000671 NM_000681 NM_000682 NM_000686 NM_000693 NM_000694 NM_000697 NM_000700 NM_000724 NM_000726 NM_000732 NM_000746 NM_000782 NM_000788 NM_000793 NM_000806 NM_000809 NM_000814 NM_000824 NM_000833 NM_000868 NM_000891 NM_000896 NM_000899 NM_000902 NM_000908 NM_000917 NM_000919 NM_000933 NM_000945 NM_000950 NM_000953 NM_000957 NM_000959 NM_000997 NM_001001188 NM_001001290 NM_001001323 NM_001001331 NM_001001342 NM_001001395 NM_001001396 NM_001001411 NM_001001412 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001664 NM_001001668 NM_001001669 NM_001001671 NM_001001679 NM_001001684 NM_001001688 NM_001001690 NM_001001696 NM_001001697 NM_001001698 NM_001001699 NM_001001707 NM_001001711 NM_001001789 NM_001001872 NM_001001874 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001974 NM_001001977 NM_001001995 NM_001002021 NM_001002026 NM_001002257 NM_001002295 NM_001002838 NM_001002844 NM_001002860 NM_001002861 NM_001002881 NM_001002906 NM_001002912 NM_001002916 NM_001002926 NM_001003395 NM_001003396 NM_001003397 NM_001003398 NM_001003399 NM_001003407 NM_001003408 NM_001003674 NM_001003675 NM_001003679 NM_001003681 NM_001003683 NM_001003684 NM_001003688 NM_001003712 NM_001003715 NM_001003716 NM_001003800 NM_001003818 NM_001003897 NM_001004299 NM_001004303 NM_001004305 NM_001004313 NM_001004315 NM_001004330 NM_001004346 NM_001004348 NM_001004351 NM_001004355 NM_001004433 NM_001005217 NM_001005242 NM_001005337 NM_001005353 NM_001005360 NM_001005361 NM_001005362 NM_001005375 NM_001005386 NM_001005387 NM_001005388 NM_001005407 NM_001005410 NM_001005411 NM_001005413 NM_001005414 NM_001005463 NM_001005473 NM_001005502 NM_001005609 NM_001005738 NM_001005746 NM_001005747 NM_001005751 NM_001005785 NM_001005786 NM_001005845 NM_001005852 NM_001006113 NM_001006623 NM_001006667 NM_001006939 NM_001006940 NM_001006941 NM_001006942 NM_001007023 NM_001007024 NM_001007025 NM_001007026 NM_001007072 NM_001007075 NM_001007097 NM_001007098 NM_001007214 NM_001007234 NM_001007239 NM_001007246 NM_001007255 NM_001007466 NM_001007535 NM_001007536 NM_001007538 NM_001007540 NM_001008215 NM_001008224 NM_001008226 NM_001008388 NM_001008392 NM_001008493 NM_001008528 NM_001008537 NM_001008539 NM_001008541 NM_001008564 NM_001008658 NM_001008660 NM_001008699 NM_001008726 NM_001008737 NM_001008738 NM_001008756 NM_001008925 NM_001009181 NM_001009555 NM_001009610 NM_001009883 NM_001009894 NM_001009909 NM_001009913 NM_001009922 NM_001009931 NM_001009956 NM_001009959 NM_001009960 NM_001010000 NM_001010852 NM_001010854 NM_001010861 NM_001010871 NM_001010874 NM_001010882 NM_001010883 NM_001010910 NM_001010913 NM_001010918 NM_001010925 NM_001010931 NM_001010933 NM_001010939 NM_001010942 NM_001010971 NM_001010980 NM_001010984 NM_001011513 NM_001011514 NM_001011539 NM_001011546 NM_001011551 NM_001011553 NM_001011554 NM_001011655 NM_001011666 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011708 NM_001012279 NM_001012393 NM_001012410 NM_001012412 NM_001012418 NM_001012419 NM_001012424 NM_001012651 NM_001012732 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012756 NM_001012763 NM_001012957 NM_001012958 NM_001012960 NM_001012961 NM_001012968 NM_001012981 NM_001012982 NM_001012993 NM_001013399 NM_001013406 NM_001013438 NM_001013439 NM_001013619 NM_001013624 NM_001013627 NM_001013629 NM_001013630 NM_001013643 NM_001013669 NM_001013687 NM_001013698 NM_001013707 NM_001013713 NM_001013746 NM_001014380 NM_001014435 NM_001014439 NM_001014797 NM_001015045 NM_001015881 NM_001015882 NM_001015883 NM_001015886 NM_001015887 NM_001017368 NM_001017370 NM_001017371 NM_001017408 NM_001017415 NM_001017416 NM_001017434 NM_001017440 NM_001017923 NM_001017962 NM_001017972 NM_001018025 NM_001018051 NM_001018055 NM_001018057 NM_001018058 NM_001018065 NM_001018066 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018080 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018111 NM_001018116 NM_001020825 NM_001023563 NM_001024094 NM_001024380 NM_001024381 NM_001024382 NM_001024649 NM_001024657 NM_001024676 NM_001024688 NM_001024733 NM_001024843 NM_001024855 NM_001024921 NM_001024933 NM_001024948 NM_001024956 NM_001025072 NM_001025073 NM_001025077 NM_001025081 NM_001025090 NM_001025092 NM_001025094 NM_001025096 NM_001025097 NM_001025098 NM_001025101 NM_001025201 NM_001025232 NM_001025234 NM_001025235 NM_001025236 NM_001025237 NM_001025238 NM_001025239 NM_001025242 NM_001025243 NM_001025252 NM_001025253 NM_001038 NM_001046 NM_001049 NM_001062 NM_001067 NM_001080 NM_001083 NM_001086 NM_001094 NM_001095 NM_001099 NM_001102 NM_001103 NM_001114 NM_001117 NM_001121 NM_001144 NM_001148 NM_001156 NM_001167 NM_001177 NM_001178 NM_001183 NM_001186 NM_001189 NM_001191 NM_001196 NM_001204 NM_001206 NM_001218 NM_001233 NM_001241 NM_001259 NM_001269 NM_001278 NM_001286 NM_001296 NM_001304 NM_001310 NM_001315 NM_001324 NM_001330 NM_001334 NM_001340 NM_001346 NM_001371 NM_001375 NM_001380 NM_001383 NM_001386 NM_001390 NM_001396 NM_001399 NM_001406 NM_001415 NM_001417 NM_001432 NM_001439 NM_001448 NM_001449 NM_001452 NM_001460 NM_001462 NM_001465 NM_001480 NM_001483 NM_001498 NM_001530 NM_001543 NM_001546 NM_001553 NM_001557 NM_001561 NM_001565 NM_001569 NM_001587 NM_001610 NM_001616 NM_001617 NM_001621 NM_001622 NM_001635 NM_001650 NM_001656 NM_001659 NM_001660 NM_001682 NM_001683 NM_001684 NM_001693 NM_001698 NM_001704 NM_001709 NM_001714 NM_001723 NM_001730 NM_001732 NM_001744 NM_001746 NM_001753 NM_001754 NM_001755 NM_001759 NM_001768 NM_001788 NM_001821 NM_001822 NM_001829 NM_001833 NM_001835 NM_001837 NM_001839 NM_001855 NM_001858 NM_001874 NM_001875 NM_001897 NM_001901 NM_001908 NM_001921 NM_001924 NM_001935 NM_001940 NM_001941 NM_001942 NM_001945 NM_001952 NM_001957 NM_001981 NM_001982 NM_001987 NM_001992 NM_002006 NM_002019 NM_002033 NM_002042 NM_002051 NM_002053 NM_002055 NM_002063 NM_002064 NM_002069 NM_002072 NM_002077 NM_002079 NM_002084 NM_002099 NM_002107 NM_002119 NM_002141 NM_002158 NM_002182 NM_002184 NM_002196 NM_002197 NM_002203 NM_002210 NM_002224 NM_002234 NM_002235 NM_002242 NM_002243 NM_002251 NM_002262 NM_002272 NM_002291 NM_002293 NM_002296 NM_002310 NM_002312 NM_002313 NM_002319 NM_002334 NM_002351 NM_002357 NM_002359 NM_002373 NM_002374 NM_002375 NM_002376 NM_002380 NM_002385 NM_002387 NM_002390 NM_002401 NM_002403 NM_002408 NM_002416 NM_002424 NM_002429 NM_002439 NM_002445 NM_002451 NM_002460 NM_002468 NM_002480 NM_002481 NM_002483 NM_002485 NM_002518 NM_002522 NM_002524 NM_002538 NM_002540 NM_002545 NM_002553 NM_002556 NM_002562 NM_002570 NM_002575 NM_002581 NM_002588 NM_002602 NM_002610 NM_002612 NM_002613 NM_002614 NM_002618 NM_002620 NM_002626 NM_002631 NM_002641 NM_002646 NM_002655 NM_002662 NM_002665 NM_002667 NM_002670 NM_002689 NM_002703 NM_002709 NM_002710 NM_002711 NM_002714 NM_002715 NM_002716 NM_002717 NM_002718 NM_002719 NM_002725 NM_002729 NM_002734 NM_002736 NM_002737 NM_002745 NM_002747 NM_002748 NM_002760 NM_002762 NM_002764 NM_002765 NM_002778 NM_002783 NM_002787 NM_002806 NM_002822 NM_002828 NM_002829 NM_002833 NM_002834 NM_002837 NM_002846 NM_002847 NM_002858 NM_002879 NM_002880 NM_002893 NM_002898 NM_002906 NM_002911 NM_002922 NM_002927 NM_002937 NM_002945 NM_002956 NM_002971 NM_002993 NM_003010 NM_003012 NM_003016 NM_003022 NM_003027 NM_003045 NM_003046 NM_003051 NM_003060 NM_003071 NM_003076 NM_003094 NM_003108 NM_003110 NM_003111 NM_003112 NM_003114 NM_003130 NM_003133 NM_003137 NM_003139 NM_003144 NM_003150 NM_003154 NM_003161 NM_003173 NM_003176 NM_003202 NM_003203 NM_003205 NM_003212 NM_003235 NM_003236 NM_003238 NM_003239 NM_003257 NM_003262 NM_003270 NM_003271 NM_003274 NM_003287 NM_003291 NM_003309 NM_003318 NM_003330 NM_003338 NM_003339 NM_003341 NM_003344 NM_003355 NM_003368 NM_003372 NM_003373 NM_003381 NM_003385 NM_003392 NM_003400 NM_003406 NM_003408 NM_003413 NM_003418 NM_003433 NM_003436 NM_003442 NM_003444 NM_003446 NM_003462 NM_003463 NM_003471 NM_003473 NM_003478 NM_003479 NM_003483 NM_003489 NM_003528 NM_003557 NM_003558 NM_003559 NM_003569 NM_003574 NM_003580 NM_003590 NM_003591 NM_003615 NM_003617 NM_003624 NM_003626 NM_003629 NM_003633 NM_003637 NM_003640 NM_003644 NM_003672 NM_003676 NM_003679 NM_003688 NM_003693 NM_003695 NM_003702 NM_003714 NM_003715 NM_003716 NM_003719 NM_003722 NM_003735 NM_003736 NM_003742 NM_003743 NM_003746 NM_003759 NM_003763 NM_003768 NM_003769 NM_003774 NM_003786 NM_003791 NM_003794 NM_003796 NM_003800 NM_003813 NM_003816 NM_003821 NM_003823 NM_003827 NM_003831 NM_003842 NM_003848 NM_003872 NM_003873 NM_003874 NM_003877 NM_003884 NM_003887 NM_003895 NM_003899 NM_003909 NM_003922 NM_003924 NM_003932 NM_003939 NM_003941 NM_003943 NM_003953 NM_003958 NM_003982 NM_003985 NM_003987 NM_003988 NM_003989 NM_003990 NM_003994 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004028 NM_004034 NM_004036 NM_004056 NM_004064 NM_004079 NM_004081 NM_004089 NM_004091 NM_004105 NM_004129 NM_004133 NM_004134 NM_004142 NM_004147 NM_004163 NM_004170 NM_004180 NM_004198 NM_004227 NM_004229 NM_004237 NM_004241 NM_004258 NM_004262 NM_004264 NM_004265 NM_004268 NM_004273 NM_004274 NM_004275 NM_004281 NM_004296 NM_004299 NM_004315 NM_004338 NM_004352 NM_004364 NM_004385 NM_004391 NM_004396 NM_004406 NM_004412 NM_004423 NM_004426 NM_004430 NM_004432 NM_004438 NM_004440 NM_004459 NM_004464 NM_004482 NM_004495 NM_004497 NM_004501 NM_004504 NM_004505 NM_004516 NM_004523 NM_004536 NM_004540 NM_004549 NM_004571 NM_004572 NM_004575 NM_004578 NM_004586 NM_004588 NM_004598 NM_004613 NM_004622 NM_004624 NM_004637 NM_004650 NM_004654 NM_004661 NM_004663 NM_004677 NM_004685 NM_004694 NM_004696 NM_004697 NM_004703 NM_004707 NM_004709 NM_004712 NM_004713 NM_004727 NM_004728 NM_004734 NM_004745 NM_004760 NM_004768 NM_004776 NM_004781 NM_004795 NM_004796 NM_004802 NM_004804 NM_004805 NM_004810 NM_004824 NM_004827 NM_004829 NM_004840 NM_004842 NM_004856 NM_004863 NM_004871 NM_004872 NM_004882 NM_004896 NM_004898 NM_004904 NM_004912 NM_004921 NM_004926 NM_004929 NM_004932 NM_004945 NM_004947 NM_004948 NM_004950 NM_004956 NM_004966 NM_004982 NM_004985 NM_005010 NM_005032 NM_005036 NM_005040 NM_005042 NM_005044 NM_005045 NM_005047 NM_005048 NM_005054 NM_005056 NM_005063 NM_005065 NM_005068 NM_005069 NM_005077 NM_005079 NM_005087 NM_005096 NM_005098 NM_005100 NM_005105 NM_005110 NM_005116 NM_005123 NM_005148 NM_005154 NM_005164 NM_005177 NM_005180 NM_005181 NM_005182 NM_005188 NM_005189 NM_005190 NM_005195 NM_005202 NM_005226 NM_005233 NM_005234 NM_005238 NM_005244 NM_005248 NM_005257 NM_005264 NM_005266 NM_005274 NM_005313 NM_005327 NM_005329 NM_005333 NM_005338 NM_005345 NM_005376 NM_005385 NM_005387 NM_005397 NM_005399 NM_005402 NM_005407 NM_005433 NM_005434 NM_005436 NM_005437 NM_005443 NM_005446 NM_005455 NM_005463 NM_005467 NM_005475 NM_005486 NM_005487 NM_005491 NM_005504 NM_005506 NM_005527 NM_005538 NM_005547 NM_005566 NM_005570 NM_005575 NM_005578 NM_005587 NM_005590 NM_005591 NM_005599 NM_005604 NM_005610 NM_005613 NM_005619 NM_005647 NM_005648 NM_005653 NM_005668 NM_005669 NM_005679 NM_005687 NM_005708 NM_005711 NM_005712 NM_005722 NM_005725 NM_005730 NM_005732 NM_005746 NM_005748 NM_005752 NM_005756 NM_005765 NM_005769 NM_005779 NM_005780 NM_005785 NM_005786 NM_005787 NM_005797 NM_005807 NM_005808 NM_005819 NM_005822 NM_005826 NM_005832 NM_005840 NM_005842 NM_005843 NM_005847 NM_005856 NM_005859 NM_005863 NM_005868 NM_005874 NM_005891 NM_005892 NM_005894 NM_005900 NM_005902 NM_005903 NM_005909 NM_005923 NM_005935 NM_005947 NM_005949 NM_005950 NM_005951 NM_005952 NM_005962 NM_005965 NM_005966 NM_005967 NM_005989 NM_006011 NM_006013 NM_006015 NM_006016 NM_006020 NM_006022 NM_006036 NM_006038 NM_006045 NM_006047 NM_006060 NM_006065 NM_006071 NM_006072 NM_006094 NM_006139 NM_006148 NM_006167 NM_006176 NM_006178 NM_006195 NM_006201 NM_006203 NM_006205 NM_006207 NM_006228 NM_006240 NM_006242 NM_006253 NM_006276 NM_006281 NM_006282 NM_006283 NM_006287 NM_006291 NM_006298 NM_006307 NM_006315 NM_006319 NM_006324 NM_006335 NM_006352 NM_006379 NM_006380 NM_006410 NM_006418 NM_006438 NM_006446 NM_006449 NM_006457 NM_006469 NM_006495 NM_006496 NM_006500 NM_006504 NM_006527 NM_006540 NM_006544 NM_006546 NM_006547 NM_006559 NM_006572 NM_006587 NM_006591 NM_006599 NM_006601 NM_006614 NM_006620 NM_006625 NM_006626 NM_006628 NM_006629 NM_006635 NM_006636 NM_006644 NM_006646 NM_006658 NM_006661 NM_006674 NM_006675 NM_006694 NM_006697 NM_006699 NM_006720 NM_006729 NM_006731 NM_006738 NM_006749 NM_006756 NM_006761 NM_006775 NM_006777 NM_006802 NM_006807 NM_006809 NM_006811 NM_006813 NM_006818 NM_006822 NM_006826 NM_006833 NM_006838 NM_006866 NM_006870 NM_006873 NM_006874 NM_006886 NM_006902 NM_006905 NM_006908 NM_006915 NM_006916 NM_006918 NM_006924 NM_006940 NM_006951 NM_006955 NM_006958 NM_006963 NM_006984 NM_006989 NM_006995 NM_006996 NM_007005 NM_007006 NM_007023 NM_007050 NM_007053 NM_007054 NM_007057 NM_007087 NM_007096 NM_007098 NM_007131 NM_007136 NM_007137 NM_007146 NM_007148 NM_007166 NM_007168 NM_007170 NM_007175 NM_007181 NM_007197 NM_007200 NM_007203 NM_007208 NM_007210 NM_007211 NM_007213 NM_007214 NM_007220 NM_007223 NM_007231 NM_007246 NM_007249 NM_007256 NM_007259 NM_007276 NM_007281 NM_007287 NM_007288 NM_007289 NM_007306 NM_007329 NM_007331 NM_007334 NM_007335 NM_007336 NM_007338 NM_007362 NM_007375 NM_012062 NM_012072 NM_012073 NM_012076 NM_012080 NM_012081 NM_012091 NM_012092 NM_012093 NM_012096 NM_012104 NM_012105 NM_012106 NM_012129 NM_012133 NM_012137 NM_012156 NM_012158 NM_012161 NM_012173 NM_012175 NM_012184 NM_012186 NM_012193 NM_012199 NM_012213 NM_012218 NM_012219 NM_012223 NM_012224 NM_012233 NM_012234 NM_012243 NM_012252 NM_012262 NM_012271 NM_012287 NM_012290 NM_012309 NM_012329 NM_012333 NM_012342 NM_012345 NM_012382 NM_012395 NM_012397 NM_012399 NM_012405 NM_012409 NM_012431 NM_012464 NM_012468 NM_012471 NM_012473 NM_012479 NM_012484 NM_012485 NM_013230 NM_013231 NM_013236 NM_013251 NM_013253 NM_013255 NM_013256 NM_013261 NM_013266 NM_013279 NM_013281 NM_013302 NM_013341 NM_013354 NM_013357 NM_013373 NM_013374 NM_013381 NM_013387 NM_013410 NM_013447 NM_013448 NM_013449 NM_013453 NM_013943 NM_013989 NM_013995 NM_014000 NM_014001 NM_014005 NM_014011 NM_014021 NM_014035 NM_014043 NM_014048 NM_014058 NM_014089 NM_014112 NM_014138 NM_014141 NM_014155 NM_014157 NM_014159 NM_014167 NM_014178 NM_014230 NM_014232 NM_014235 NM_014242 NM_014250 NM_014252 NM_014258 NM_014289 NM_014290 NM_014294 NM_014320 NM_014323 NM_014331 NM_014333 NM_014335 NM_014337 NM_014338 NM_014342 NM_014351 NM_014352 NM_014358 NM_014372 NM_014388 NM_014393 NM_014394 NM_014399 NM_014412 NM_014418 NM_014421 NM_014426 NM_014430 NM_014438 NM_014451 NM_014454 NM_014456 NM_014479 NM_014485 NM_014494 NM_014500 NM_014519 NM_014553 NM_014554 NM_014570 NM_014572 NM_014574 NM_014585 NM_014586 NM_014600 NM_014606 NM_014607 NM_014615 NM_014622 NM_014623 NM_014631 NM_014635 NM_014636 NM_014646 NM_014647 NM_014650 NM_014661 NM_014666 NM_014667 NM_014682 NM_014683 NM_014686 NM_014690 NM_014691 NM_014698 NM_014726 NM_014735 NM_014737 NM_014739 NM_014743 NM_014746 NM_014747 NM_014751 NM_014755 NM_014757 NM_014766 NM_014774 NM_014777 NM_014779 NM_014787 NM_014789 NM_014791 NM_014792 NM_014799 NM_014801 NM_014805 NM_014810 NM_014820 NM_014822 NM_014824 NM_014828 NM_014830 NM_014832 NM_014839 NM_014850 NM_014862 NM_014880 NM_014883 NM_014888 NM_014898 NM_014899 NM_014904 NM_014906 NM_014910 NM_014919 NM_014930 NM_014934 NM_014940 NM_014947 NM_014948 NM_014951 NM_014953 NM_014955 NM_014959 NM_014961 NM_014962 NM_014967 NM_014969 NM_014977 NM_014991 NM_015000 NM_015011 NM_015017 NM_015020 NM_015022 NM_015029 NM_015032 NM_015035 NM_015040 NM_015044 NM_015045 NM_015047 NM_015052 NM_015056 NM_015064 NM_015066 NM_015069 NM_015070 NM_015077 NM_015079 NM_015084 NM_015085 NM_015087 NM_015088 NM_015090 NM_015091 NM_015092 NM_015093 NM_015097 NM_015101 NM_015138 NM_015155 NM_015162 NM_015166 NM_015172 NM_015173 NM_015176 NM_015178 NM_015185 NM_015187 NM_015193 NM_015199 NM_015205 NM_015224 NM_015225 NM_015229 NM_015235 NM_015239 NM_015250 NM_015251 NM_015252 NM_015257 NM_015262 NM_015265 NM_015271 NM_015272 NM_015275 NM_015277 NM_015285 NM_015296 NM_015299 NM_015310 NM_015315 NM_015317 NM_015328 NM_015329 NM_015331 NM_015335 NM_015338 NM_015345 NM_015349 NM_015352 NM_015356 NM_015358 NM_015378 NM_015385 NM_015387 NM_015395 NM_015401 NM_015412 NM_015415 NM_015429 NM_015432 NM_015435 NM_015436 NM_015458 NM_015460 NM_015466 NM_015469 NM_015475 NM_015478 NM_015497 NM_015517 NM_015523 NM_015529 NM_015530 NM_015532 NM_015548 NM_015550 NM_015565 NM_015568 NM_015570 NM_015600 NM_015605 NM_015642 NM_015646 NM_015651 NM_015655 NM_015677 NM_015678 NM_015690 NM_015725 NM_015726 NM_015727 NM_015831 NM_015848 NM_015878 NM_015881 NM_015886 NM_015895 NM_015927 NM_015935 NM_015946 NM_015967 NM_015975 NM_015981 NM_015990 NM_016018 NM_016019 NM_016021 NM_016023 NM_016038 NM_016040 NM_016047 NM_016072 NM_016085 NM_016107 NM_016119 NM_016122 NM_016132 NM_016133 NM_016141 NM_016143 NM_016156 NM_016173 NM_016200 NM_016205 NM_016206 NM_016220 NM_016224 NM_016235 NM_016245 NM_016248 NM_016252 NM_016257 NM_016261 NM_016264 NM_016271 NM_016272 NM_016289 NM_016304 NM_016308 NM_016315 NM_016323 NM_016352 NM_016353 NM_016357 NM_016359 NM_016360 NM_016369 NM_016376 NM_016377 NM_016389 NM_016436 NM_016442 NM_016449 NM_016475 NM_016510 NM_016522 NM_016530 NM_016532 NM_016536 NM_016564 NM_016570 NM_016575 NM_016587 NM_016592 NM_016596 NM_016613 NM_016614 NM_016620 NM_016622 NM_016626 NM_016643 NM_016647 NM_016651 NM_016653 NM_016824 NM_016950 NM_017420 NM_017423 NM_017424 NM_017444 NM_017459 NM_017460 NM_017483 NM_017485 NM_017486 NM_017488 NM_017540 NM_017542 NM_017544 NM_017554 NM_017559 NM_017564 NM_017579 NM_017583 NM_017588 NM_017593 NM_017594 NM_017610 NM_017612 NM_017617 NM_017623 NM_017628 NM_017634 NM_017637 NM_017643 NM_017644 NM_017645 NM_017666 NM_017671 NM_017676 NM_017678 NM_017680 NM_017693 NM_017699 NM_017702 NM_017704 NM_017709 NM_017711 NM_017716 NM_017717 NM_017724 NM_017725 NM_017732 NM_017737 NM_017760 NM_017763 NM_017768 NM_017773 NM_017813 NM_017817 NM_017824 NM_017831 NM_017832 NM_017846 NM_017849 NM_017872 NM_017882 NM_017919 NM_017927 NM_017928 NM_017936 NM_017938 NM_017946 NM_017952 NM_017955 NM_017957 NM_017966 NM_017982 NM_017987 NM_017993 NM_018003 NM_018011 NM_018024 NM_018027 NM_018037 NM_018038 NM_018040 NM_018051 NM_018076 NM_018084 NM_018086 NM_018091 NM_018098 NM_018109 NM_018112 NM_018121 NM_018128 NM_018143 NM_018150 NM_018153 NM_018156 NM_018168 NM_018170 NM_018172 NM_018178 NM_018179 NM_018181 NM_018182 NM_018194 NM_018197 NM_018204 NM_018210 NM_018211 NM_018212 NM_018222 NM_018229 NM_018230 NM_018233 NM_018241 NM_018242 NM_018243 NM_018244 NM_018254 NM_018263 NM_018268 NM_018279 NM_018287 NM_018290 NM_018299 NM_018304 NM_018307 NM_018312 NM_018316 NM_018320 NM_018332 NM_018342 NM_018361 NM_018362 NM_018367 NM_018371 NM_018374 NM_018375 NM_018383 NM_018390 NM_018400 NM_018401 NM_018407 NM_018409 NM_018416 NM_018423 NM_018427 NM_018439 NM_018440 NM_018448 NM_018450 NM_018452 NM_018454 NM_018464 NM_018466 NM_018469 NM_018471 NM_018472 NM_018482 NM_018492 NM_018509 NM_018555 NM_018557 NM_018590 NM_018640 NM_018650 NM_018658 NM_018662 NM_018683 NM_018684 NM_018686 NM_018689 NM_018698 NM_018699 NM_018711 NM_018713 NM_018725 NM_018839 NM_018890 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018930 NM_018938 NM_018947 NM_018970 NM_018975 NM_018976 NM_018981 NM_018987 NM_018990 NM_018993 NM_019008 NM_019027 NM_019030 NM_019034 NM_019036 NM_019042 NM_019054 NM_019069 NM_019072 NM_019074 NM_019081 NM_019086 NM_019094 NM_019098 NM_019099 NM_019110 NM_019119 NM_019590 NM_019605 NM_019613 NM_019618 NM_019644 NM_019842 NM_019885 NM_019903 NM_020037 NM_020038 NM_020039 NM_020041 NM_020119 NM_020123 NM_020126 NM_020133 NM_020141 NM_020143 NM_020147 NM_020148 NM_020149 NM_020151 NM_020169 NM_020178 NM_020180 NM_020193 NM_020195 NM_020198 NM_020228 NM_020237 NM_020245 NM_020338 NM_020341 NM_020342 NM_020363 NM_020364 NM_020373 NM_020374 NM_020381 NM_020390 NM_020399 NM_020400 NM_020405 NM_020420 NM_020421 NM_020424 NM_020440 NM_020447 NM_020453 NM_020472 NM_020473 NM_020475 NM_020476 NM_020477 NM_020536 NM_020546 NM_020550 NM_020640 NM_020648 NM_020651 NM_020653 NM_020654 NM_020661 NM_020673 NM_020686 NM_020696 NM_020702 NM_020704 NM_020708 NM_020710 NM_020711 NM_020727 NM_020738 NM_020742 NM_020745 NM_020746 NM_020749 NM_020750 NM_020768 NM_020769 NM_020771 NM_020773 NM_020774 NM_020776 NM_020784 NM_020786 NM_020791 NM_020803 NM_020807 NM_020809 NM_020810 NM_020813 NM_020819 NM_020824 NM_020826 NM_020839 NM_020841 NM_020844 NM_020873 NM_020880 NM_020899 NM_020909 NM_020918 NM_020919 NM_020921 NM_020922 NM_020948 NM_020951 NM_020962 NM_020970 NM_020973 NM_020977 NM_020980 NM_021003 NM_021035 NM_021038 NM_021045 NM_021083 NM_021094 NM_021098 NM_021100 NM_021101 NM_021105 NM_021116 NM_021129 NM_021137 NM_021139 NM_021144 NM_021153 NM_021159 NM_021183 NM_021205 NM_021218 NM_021224 NM_021229 NM_021238 NM_021252 NM_021612 NM_021614 NM_021615 NM_021622 NM_021633 NM_021637 NM_021642 NM_021735 NM_021736 NM_021737 NM_021783 NM_021813 NM_021814 NM_021821 NM_021823 NM_021825 NM_021912 NM_021922 NM_021925 NM_021927 NM_021928 NM_021940 NM_021950 NM_021957 NM_021961 NM_021963 NM_021965 NM_021977 NM_022037 NM_022062 NM_022073 NM_022074 NM_022077 NM_022078 NM_022079 NM_022080 NM_022087 NM_022088 NM_022099 NM_022101 NM_022102 NM_022105 NM_022106 NM_022111 NM_022112 NM_022121 NM_022124 NM_022144 NM_022150 NM_022151 NM_022153 NM_022173 NM_022307 NM_022336 NM_022351 NM_022356 NM_022437 NM_022465 NM_022473 NM_022474 NM_022481 NM_022482 NM_022483 NM_022486 NM_022491 NM_022564 NM_022571 NM_022661 NM_022716 NM_022726 NM_022735 NM_022739 NM_022744 NM_022746 NM_022749 NM_022753 NM_022754 NM_022756 NM_022761 NM_022772 NM_022780 NM_022781 NM_022782 NM_022783 NM_022791 NM_022792 NM_022819 NM_022820 NM_022822 NM_022829 NM_022831 NM_022832 NM_022836 NM_022837 NM_022845 NM_022893 NM_022894 NM_022898 NM_022911 NM_022918 NM_022969 NM_022970 NM_022972 NM_022975 NM_023005 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023075 NM_023079 NM_023914 NM_023920 NM_023926 NM_023927 NM_023930 NM_023938 NM_024005 NM_024019 NM_024035 NM_024052 NM_024054 NM_024080 NM_024086 NM_024087 NM_024102 NM_024116 NM_024295 NM_024300 NM_024306 NM_024332 NM_024420 NM_024421 NM_024423 NM_024501 NM_024511 NM_024512 NM_024513 NM_024520 NM_024531 NM_024539 NM_024541 NM_024551 NM_024563 NM_024569 NM_024572 NM_024584 NM_024585 NM_024593 NM_024625 NM_024627 NM_024628 NM_024632 NM_024638 NM_024646 NM_024649 NM_024656 NM_024665 NM_024672 NM_024674 NM_024677 NM_024693 NM_024699 NM_024713 NM_024725 NM_024738 NM_024743 NM_024744 NM_024753 NM_024761 NM_024764 NM_024778 NM_024779 NM_024803 NM_024824 NM_024834 NM_024841 NM_024850 NM_024852 NM_024854 NM_024870 NM_024873 NM_024900 NM_024901 NM_024910 NM_024915 NM_024917 NM_024930 NM_024949 NM_024953 NM_024966 NM_024969 NM_024989 NM_025019 NM_025029 NM_025047 NM_025054 NM_025059 NM_025072 NM_025073 NM_025075 NM_025104 NM_025106 NM_025109 NM_025134 NM_025138 NM_025141 NM_025146 NM_025160 NM_025169 NM_025181 NM_025187 NM_025188 NM_025191 NM_025208 NM_025220 NM_025236 NM_025244 NM_025263 NM_025265 NM_030579 NM_030583 NM_030627 NM_030631 NM_030633 NM_030636 NM_030639 NM_030648 NM_030670 NM_030671 NM_030755 NM_030756 NM_030764 NM_030766 NM_030773 NM_030777 NM_030781 NM_030791 NM_030806 NM_030809 NM_030817 NM_030820 NM_030878 NM_030884 NM_030919 NM_030934 NM_030957 NM_030959 NM_031226 NM_031265 NM_031268 NM_031296 NM_031301 NM_031302 NM_031305 NM_031372 NM_031411 NM_031412 NM_031418 NM_031435 NM_031438 NM_031442 NM_031453 NM_031458 NM_031459 NM_031460 NM_031463 NM_031465 NM_031468 NM_031473 NM_031485 NM_031844 NM_031845 NM_031846 NM_031847 NM_031849 NM_031857 NM_031860 NM_031885 NM_031899 NM_031905 NM_031920 NM_031922 NM_031940 NM_031949 NM_031958 NM_031961 NM_031962 NM_031965 NM_031994 NM_032010 NM_032016 NM_032017 NM_032018 NM_032038 NM_032050 NM_032052 NM_032088 NM_032092 NM_032103 NM_032104 NM_032105 NM_032116 NM_032121 NM_032128 NM_032135 NM_032145 NM_032146 NM_032147 NM_032153 NM_032160 NM_032174 NM_032179 NM_032186 NM_032189 NM_032214 NM_032221 NM_032228 NM_032246 NM_032264 NM_032271 NM_032283 NM_032287 NM_032294 NM_032295 NM_032300 NM_032329 NM_032330 NM_032338 NM_032348 NM_032352 NM_032375 NM_032390 NM_032403 NM_032408 NM_032413 NM_032417 NM_032427 NM_032440 NM_032444 NM_032446 NM_032456 NM_032461 NM_032466 NM_032468 NM_032484 NM_032490 NM_032491 NM_032506 NM_032508 NM_032509 NM_032515 NM_032521 NM_032532 NM_032538 NM_032560 NM_032567 NM_032569 NM_032576 NM_032582 NM_032588 NM_032608 NM_032626 NM_032644 NM_032646 NM_032656 NM_032679 NM_032689 NM_032706 NM_032711 NM_032737 NM_032783 NM_032797 NM_032826 NM_032833 NM_032837 NM_032839 NM_032849 NM_032866 NM_032869 NM_032876 NM_032916 NM_032932 NM_032933 NM_032945 NM_032946 NM_032957 NM_032968 NM_032969 NM_032973 NM_032975 NM_032980 NM_032997 NM_033018 NM_033027 NM_033035 NM_033048 NM_033056 NM_033060 NM_033083 NM_033088 NM_033100 NM_033109 NM_033115 NM_033119 NM_033135 NM_033143 NM_033152 NM_033153 NM_033154 NM_033155 NM_033184 NM_033207 NM_033210 NM_033214 NM_033222 NM_033227 NM_033228 NM_033255 NM_033262 NM_033285 NM_033290 NM_033291 NM_033312 NM_033326 NM_033332 NM_033346 NM_033360 NM_033364 NM_033375 NM_033380 NM_033381 NM_033405 NM_033410 NM_033425 NM_033428 NM_033429 NM_033430 NM_033437 NM_033439 NM_033505 NM_033507 NM_033508 NM_033512 NM_033514 NM_033535 NM_033551 NM_033637 NM_033656 NM_033671 NM_052816 NM_052821 NM_052834 NM_052840 NM_052851 NM_052857 NM_052859 NM_052860 NM_052862 NM_052865 NM_052869 NM_052878 NM_052879 NM_052887 NM_052890 NM_052900 NM_052910 NM_052917 NM_052919 NM_052932 NM_052934 NM_052937 NM_052943 NM_052968 NM_053001 NM_053002 NM_053023 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053064 NM_053276 NM_053282 NM_054030 NM_054035 NM_057095 NM_057096 NM_057175 NM_057178 NM_058166 NM_058172 NM_058237 NM_058240 NM_058241 NM_058246 NM_078467 NM_078473 NM_078474 NM_080282 NM_080283 NM_080391 NM_080542 NM_080543 NM_080592 NM_080593 NM_080612 NM_080650 NM_080654 NM_080657 NM_080664 NM_080666 NM_080725 NM_080737 NM_080748 NM_080751 NM_080764 NM_080796 NM_080797 NM_080817 NM_080822 NM_080829 NM_080832 NM_080867 NM_080870 NM_080872 NM_080927 NM_101395 NM_130435 NM_130436 NM_130437 NM_130438 NM_130439 NM_130463 NM_130766 NM_130807 NM_130838 NM_130839 NM_130842 NM_130843 NM_130847 NM_130848 NM_133170 NM_133175 NM_133176 NM_133259 NM_133330 NM_133331 NM_133332 NM_133333 NM_133335 NM_133367 NM_133370 NM_133371 NM_133372 NM_133445 NM_133448 NM_133464 NM_133466 NM_133468 NM_133473 NM_133474 NM_133476 NM_133477 NM_133482 NM_133509 NM_133637 NM_133646 NM_134263 NM_134325 NM_134422 NM_134423 NM_134424 NM_134426 NM_134431 NM_134447 NM_138279 NM_138282 NM_138298 NM_138299 NM_138319 NM_138322 NM_138335 NM_138390 NM_138399 NM_138402 NM_138409 NM_138417 NM_138444 NM_138447 NM_138459 NM_138473 NM_138477 NM_138484 NM_138494 NM_138551 NM_138555 NM_138576 NM_138578 NM_138608 NM_138612 NM_138619 NM_138633 NM_138636 NM_138640 NM_138694 NM_138699 NM_138706 NM_138713 NM_138714 NM_138722 NM_138723 NM_138731 NM_138737 NM_138738 NM_138766 NM_138779 NM_138801 NM_138804 NM_138821 NM_138822 NM_138958 NM_138962 NM_138970 NM_138971 NM_138972 NM_138973 NM_138983 NM_138991 NM_138992 NM_138999 NM_139005 NM_139012 NM_139014 NM_139018 NM_139028 NM_139071 NM_139076 NM_139131 NM_139135 NM_139159 NM_139164 NM_139167 NM_139168 NM_139169 NM_139177 NM_139202 NM_139207 NM_139246 NM_139264 NM_139267 NM_139275 NM_139276 NM_139283 NM_139316 NM_139319 NM_139320 NM_139321 NM_139353 NM_144497 NM_144573 NM_144597 NM_144600 NM_144617 NM_144621 NM_144623 NM_144632 NM_144633 NM_144642 NM_144662 NM_144669 NM_144678 NM_144682 NM_144688 NM_144692 NM_144693 NM_144718 NM_144722 NM_144766 NM_144767 NM_144775 NM_144778 NM_144780 NM_144949 NM_144969 NM_144975 NM_144976 NM_144984 NM_144988 NM_144995 NM_145005 NM_145010 NM_145011 NM_145016 NM_145034 NM_145035 NM_145040 NM_145042 NM_145063 NM_145117 NM_145165 NM_145166 NM_145169 NM_145179 NM_145204 NM_145246 NM_145254 NM_145257 NM_145263 NM_145278 NM_145279 NM_145284 NM_145307 NM_145310 NM_145313 NM_145315 NM_145316 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145326 NM_145341 NM_145342 NM_145349 NM_145350 NM_145351 NM_145352 NM_145650 NM_145662 NM_145664 NM_145665 NM_145690 NM_145695 NM_145735 NM_145752 NM_145793 NM_145794 NM_145795 NM_145808 NM_145818 NM_145906 NM_145911 NM_145913 NM_147128 NM_147131 NM_147132 NM_147149 NM_147150 NM_147166 NM_147187 NM_147188 NM_147189 NM_147198 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148174 NM_148911 NM_148957 NM_148960 NM_149379 NM_152223 NM_152224 NM_152225 NM_152226 NM_152227 NM_152235 NM_152247 NM_152253 NM_152267 NM_152268 NM_152271 NM_152279 NM_152280 NM_152281 NM_152284 NM_152292 NM_152320 NM_152321 NM_152332 NM_152365 NM_152373 NM_152378 NM_152388 NM_152391 NM_152395 NM_152399 NM_152400 NM_152404 NM_152407 NM_152409 NM_152418 NM_152422 NM_152428 NM_152430 NM_152433 NM_152436 NM_152437 NM_152439 NM_152441 NM_152447 NM_152458 NM_152460 NM_152488 NM_152493 NM_152510 NM_152520 NM_152522 NM_152527 NM_152529 NM_152531 NM_152538 NM_152551 NM_152554 NM_152563 NM_152571 NM_152574 NM_152583 NM_152588 NM_152592 NM_152608 NM_152630 NM_152632 NM_152641 NM_152655 NM_152667 NM_152678 NM_152680 NM_152685 NM_152686 NM_152687 NM_152692 NM_152693 NM_152705 NM_152716 NM_152723 NM_152738 NM_152748 NM_152753 NM_152754 NM_152756 NM_152758 NM_152760 NM_152777 NM_152778 NM_152780 NM_152785 NM_152838 NM_152840 NM_152842 NM_152860 NM_152866 NM_152890 NM_152903 NM_152905 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152945 NM_152989 NM_152999 NM_153008 NM_153010 NM_153027 NM_153029 NM_153032 NM_153038 NM_153041 NM_153042 NM_153183 NM_153184 NM_153202 NM_153231 NM_153234 NM_153240 NM_153246 NM_153252 NM_153262 NM_153343 NM_153346 NM_153355 NM_153360 NM_153362 NM_153367 NM_153442 NM_153456 NM_153464 NM_153609 NM_153634 NM_153683 NM_153685 NM_153686 NM_153687 NM_153689 NM_153695 NM_153705 NM_153711 NM_153712 NM_153714 NM_153756 NM_153810 NM_153832 NM_153836 NM_170587 NM_170600 NM_170607 NM_170705 NM_170716 NM_170717 NM_170719 NM_170721 NM_170725 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170751 NM_170752 NM_170769 NM_170770 NM_170773 NM_170774 NM_170775 NM_171825 NM_171827 NM_171846 NM_171982 NM_171998 NM_172000 NM_172020 NM_172037 NM_172056 NM_172058 NM_172059 NM_172060 NM_172069 NM_172110 NM_172111 NM_172112 NM_172113 NM_172127 NM_172128 NM_172159 NM_172160 NM_172172 NM_172193 NM_172206 NM_172218 NM_172234 NM_172238 NM_172346 NM_172386 NM_173044 NM_173054 NM_173065 NM_173075 NM_173078 NM_173214 NM_173354 NM_173460 NM_173463 NM_173468 NM_173469 NM_173474 NM_173484 NM_173503 NM_173505 NM_173511 NM_173519 NM_173531 NM_173536 NM_173538 NM_173549 NM_173551 NM_173552 NM_173565 NM_173570 NM_173580 NM_173582 NM_173583 NM_173586 NM_173588 NM_173602 NM_173607 NM_173610 NM_173611 NM_173625 NM_173626 NM_173629 NM_173631 NM_173638 NM_173644 NM_173651 NM_173654 NM_173658 NM_173666 NM_173675 NM_173698 NM_173700 NM_173805 NM_173808 NM_173809 NM_173822 NM_173823 NM_173833 NM_173851 NM_173872 NM_174858 NM_174890 NM_174901 NM_174911 NM_174934 NM_174951 NM_174975 NM_175053 NM_175056 NM_175058 NM_175061 NM_175077 NM_175610 NM_175736 NM_175744 NM_175745 NM_175767 NM_175861 NM_175871 NM_175888 NM_175895 NM_175920 NM_175921 NM_175922 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176799 NM_176816 NM_176823 NM_176874 NM_176894 NM_177405 NM_177422 NM_177424 NM_177427 NM_177436 NM_177454 NM_177532 NM_177539 NM_177924 NM_177926 NM_177951 NM_177952 NM_177965 NM_177967 NM_177976 NM_177990 NM_177995 NM_177996 NM_178006 NM_178007 NM_178010 NM_178011 NM_178014 NM_178037 NM_178038 NM_178039 NM_178040 NM_178126 NM_178135 NM_178140 NM_178145 NM_178191 NM_178225 NM_178226 NM_178329 NM_178342 NM_178470 NM_178494 NM_178498 NM_178509 NM_178539 NM_178562 NM_178564 NM_178565 NM_178568 NM_178583 NM_178585 NM_178586 NM_178814 NM_178815 NM_178816 NM_178830 NM_178838 NM_181041 NM_181054 NM_181293 NM_181298 NM_181299 NM_181332 NM_181358 NM_181361 NM_181443 NM_181453 NM_181481 NM_181482 NM_181483 NM_181489 NM_181503 NM_181531 NM_181558 NM_181618 NM_181643 NM_181670 NM_181703 NM_181705 NM_181706 NM_181723 NM_181724 NM_181727 NM_181776 NM_181783 NM_181787 NM_181789 NM_181836 NM_181838 NM_181897 NM_182483 NM_182485 NM_182495 NM_182501 NM_182526 NM_182529 NM_182531 NM_182546 NM_182551 NM_182554 NM_182557 NM_182558 NM_182559 NM_182568 NM_182592 NM_182606 NM_182626 NM_182641 NM_182643 NM_182646 NM_182648 NM_182666 NM_182691 NM_182692 NM_182697 NM_182700 NM_182706 NM_182729 NM_182740 NM_182742 NM_182743 NM_182756 NM_182757 NM_182758 NM_182760 NM_182765 NM_182797 NM_182798 NM_182799 NM_182801 NM_182833 NM_182848 NM_182894 NM_182898 NM_182899 NM_182911 NM_182923 NM_182932 NM_182933 NM_182936 NM_182964 NM_183002 NM_183050 NM_183059 NM_183061 NM_183075 NM_183078 NM_183238 NM_183372 NM_183376 NM_183377 NM_183380 NM_183387 NM_183393 NM_183394 NM_183397 NM_183414 NM_183416 NM_183419 NM_183420 NM_183421 NM_183422 NM_183425 NM_194248 NM_194252 NM_194277 NM_194282 NM_194284 NM_194285 NM_194289 NM_194291 NM_194294 NM_194314 NM_194317 NM_194322 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194352 NM_194358 NM_194359 NM_194430 NM_194431 NM_194434 NM_194435 NM_194442 NM_194452 NM_194453 NM_194454 NM_194455 NM_194456 NM_194463 NM_197941 NM_197955 NM_197966 NM_197967 NM_197976 NM_198057 NM_198066 NM_198080 NM_198083 NM_198086 NM_198098 NM_198123 NM_198124 NM_198128 NM_198129 NM_198147 NM_198152 NM_198156 NM_198181 NM_198204 NM_198205 NM_198212 NM_198240 NM_198256 NM_198257 NM_198258 NM_198268 NM_198269 NM_198270 NM_198271 NM_198315 NM_198320 NM_198321 NM_198325 NM_198391 NM_198397 NM_198401 NM_198402 NM_198428 NM_198439 NM_198451 NM_198452 NM_198462 NM_198463 NM_198480 NM_198485 NM_198499 NM_198526 NM_198549 NM_198569 NM_198712 NM_198713 NM_198714 NM_198715 NM_198716 NM_198717 NM_198829 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198847 NM_198849 NM_198900 NM_198901 NM_198926 NM_198938 NM_198939 NM_198940 NM_198956 NM_198968 NM_198971 NM_198974 NM_198990 NM_198992 NM_199039 NM_199040 NM_199052 NM_199072 NM_199075 NM_199078 NM_199126 NM_199135 NM_199188 NM_199190 NM_199228 NM_199229 NM_199324 NM_199335 NM_199343 NM_199351 NM_199355 NM_199356 NM_199358 NM_199415 NM_199418 NM_199421 NM_199426 NM_199437 NM_199438 NM_199439 NM_199451 NM_199452 NM_199482 NM_199487 NM_199511 NM_199512 NM_199513 NM_201253 NM_201262 NM_201266 NM_201269 NM_201278 NM_201279 NM_201281 NM_201348 NM_201403 NM_201413 NM_201414 NM_201431 NM_201432 NM_201433 NM_201437 NM_201565 NM_201570 NM_201571 NM_201572 NM_201590 NM_201593 NM_201596 NM_201597 NM_201599 NM_201624 NM_201625 NM_201628 NM_201632 NM_201634 NM_201999 NM_203304 NM_203327 NM_203329 NM_203330 NM_203331 NM_203349 NM_203350 NM_203351 NM_203353 NM_203371 NM_203391 NM_203394 NM_203395 NM_203438 NM_203439 NM_203440 NM_203441 NM_203445 NM_203446 NM_203448 NM_203451 NM_203452 NM_203454 NM_203459 NM_203463 NM_203464 NM_205768 NM_205849 NM_205852 NM_205857 NM_205864 NM_206813 NM_206814 NM_206835 NM_206853 NM_206854 NM_206855 NM_206866 NM_206876 NM_206877 NM_206893 NM_206900 NM_206901 NM_206902 NM_206909 NM_206918 NM_206925 NM_206933 NM_206937 NM_206943 NM_207009 NM_207015 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207113 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207305 NM_207307 NM_207308 NM_207317 NM_207321 NM_207332 NM_207333 NM_207352 NM_207358 NM_207359 NM_207365 NM_207366 NM_207372 NM_207376 NM_207387 NM_207400 NM_207404 NM_207413 NM_207428 NM_207429 NM_207430 NM_207434 NM_207451 NM_207454 NM_207469 NM_207470 NM_207478 NM_207501 NM_207505 NM_207506 NM_207511 NM_207517 NM_207577 NM_207645 NM_207647 NM_207660 NM_207661 NM_207662 NM_212464 NM_212467 NM_212471 NM_212472 NM_212540 NM_212558 NM_213589 NM_213594 NM_213609 NM_213612 NM_213648 NM_213662 NM_214711 XM_027307 XM_028810 XM_031553 XM_031689 XM_032571 XM_032996 XM_036936 XM_036942 XM_037557 XM_039393 XM_039570 XM_039627 XM_042066 XM_042301 XM_042698 XM_042833 XM_042936 XM_042978 XM_043493 XM_044434 XM_046264 XM_046581 XM_047355 XM_051081 XM_058513 XM_058720 XM_059672 XM_059954 XM_067585 XM_084529 XM_087672 XM_113743 XM_113763 XM_113825 XM_114415 XM_117117 XM_117294 XM_166132 XM_166320 XM_167044 XM_168530 XM_172860 XM_208204 XM_208234 XM_208313 XM_208333 XM_208658 XM_208990 XM_209252 XM_209363 XM_209429 XM_209554 XM_209607 XM_209700 XM_211108 XM_211305 XM_211529 XM_212061 XM_290482 XM_290546 XM_290597 XM_290615 XM_290737 XM_290777 XM_290811 XM_290925 XM_291020 XM_291028 XM_291095 XM_291128 XM_291247 XM_292184 XM_293529 XM_293687 XM_294521 XM_294765 XM_298151 XM_350880 XM_370557 XM_370577 XM_370654 XM_370756 XM_370838 XM_370839 XM_370878 XM_370899 XM_370932 XM_370965 XM_371074 XM_371116 XM_371132 XM_371196 XM_371204 XM_371312 XM_371374 XM_371411 XM_371429 XM_371590 XM_371592 XM_371655 XM_371711 XM_371761 XM_371820 XM_371838 XM_371891 XM_372038 XM_372090 XM_372097 XM_372118 XM_372128 XM_372205 XM_372584 XM_373456 XM_373500 XM_373518 XM_373543 XM_373587 XM_373606 XM_373686 XM_373704 XM_373744 XM_373771 XM_373817 XM_373821 XM_374013 XM_374069 XM_374099 XM_374134 XM_374257 XM_374260 XM_374317 XM_374422 XM_374484 XM_374765 XM_374766 XM_374768 XM_374781 XM_374902 XM_374945 XM_375007 XM_375029 XM_375041 XM_375042 XM_375081 XM_375373 XM_375456 XM_375491 XM_375527 XM_375568 XM_375590 XM_375697 XM_375747 XM_375821 XM_375929 XM_375935 XM_376062 XM_376111 XM_376212 XM_376254 XM_376284 XM_376303 XM_376320 XM_376350 XM_376372 XM_376412 XM_376436 XM_376444 XM_376550 XM_376567 XM_376602 XM_376607 XM_376658 XM_376679 XM_376680 XM_376727 XM_376774 XM_376783 XM_376795 XM_376869 XM_376902 XM_376905 XM_377002 XM_377041 XM_377076 XM_377476 XM_377742 XM_378178 XM_378239 XM_378259 XM_378273 XM_378312 XM_378316 XM_378356 XM_378362 XM_378389 XM_378399 XM_378430 XM_378436 XM_378453 XM_378456 XM_378512 XM_378544 XM_378549 XM_378550 XM_378573 XM_378642 XM_378655 XM_378705 XM_378708 XM_378712 XM_378735 XM_378741 XM_378747 XM_378777 XM_378786 XM_378842 XM_378861 XM_378866 XM_378876 XM_378908 XM_378914 XM_378925 XM_378941 XM_378957 XM_378973 XM_379006 XM_379030 XM_379041 XM_379068 XM_379069 XM_379079 XM_379086 XM_379100 XM_379133 XM_379135 XM_379136 XM_379141 XM_379146 XM_379154 XM_379173 XM_379189 XM_379195 XM_379204 XM_379206 XM_379207 XM_379214 XM_379215 XM_379231 XM_379243 XM_379267 XM_379273 XM_379276 XM_379280 XM_379299 XM_379320 XM_379378 XM_379380 XM_379381 XM_379395 XM_379403 XM_379409 XM_379432 XM_379454 XM_379456 XM_379459 XM_379510 XM_379539 XM_379543 XM_379547 XM_379582 XM_379592 XM_379595 XM_379597 XM_379622 XM_379637 XM_379643 XM_379650 XM_379651 XM_379665 XM_379684 XM_379720 XM_379722 XM_379774 XM_379820 XM_379827 XM_379848 XM_379897 XM_379927 XM_379933 XM_379934 XM_379979 XM_380131 XM_380173 XM_495795 XM_495798 XM_495814 XM_495844 XM_495848 XM_495868 XM_495886 XM_495909 XM_495950 XM_495960 XM_496050 XM_496054 XM_496061 XM_496070 XM_496081 XM_496088 XM_496093 XM_496103 XM_496129 XM_496241 XM_496267 XM_496351 XM_496354 XM_496383 XM_496391 XM_496394 XM_496399 XM_496401 XM_496513 XM_496575 XM_496576 XM_496581 XM_496584 XM_496663 XM_496688 XM_496775 XM_496780 XM_496804 XM_496849 XM_496879 XM_496895 XM_496907 XM_496916 XM_496943 XM_497036 XM_497056 XM_497181 XM_498427 XM_498429 XM_498435 XM_498436 XM_498439 XM_498442 XM_498446 XM_498449 XM_498451 XM_498452 XM_498454 XM_498457 XM_498467 XM_498479 XM_498480 XM_498481 XM_498482 XM_498484 XM_498490 XM_498555 XM_498569 XM_498572 XM_498611 XM_498629 XM_498636 XM_498647 XM_498666 XM_498693 XM_498736 XM_498737 XM_498742 XM_498825 XM_498844 XM_498849 XM_498861 XM_498877 XM_498901 XM_498910 XM_498912 XM_498915 XM_498925 XM_498946 XM_498965 XM_498972 XM_498989 XM_498998 XM_499051 XM_499063 XM_499084 XM_499085 XM_499123 XM_499125 XM_499147 XM_499152 XM_499160 XM_499257 XM_499298 XM_499301 XM_499309 XM_499323 XM_499343 XM_499348 XM_499361 XM_499363 XM_499392 XM_499495 XM_499512 XM_499539 XM_499558 XM_499564 XM_499566 XM_499569 XM_499572 XM_499576 XM_499579 XM_499581 XM_499583 XM_499586 XM_499597 XM_499602 XR_000182 XR_000192 XR_000195 XR_000227 XR_000254 XR_000263 XR_000274 XR_000292 XR_000293
Genes with multiple seed matches:
NM_000115 NM_000125 NM_000163 NM_000176 NM_000222 NM_000232 NM_000242 NM_000246 NM_000314 NM_000330 NM_000337 NM_000406 NM_000536 NM_000611 NM_000618 NM_000629 NM_000664 NM_000671 NM_000686 NM_000793 NM_000809 NM_000868 NM_000896 NM_000933 NM_000959 NM_001001188 NM_001001323 NM_001001396 NM_001001419 NM_001001420 NM_001001481 NM_001001482 NM_001001684 NM_001001688 NM_001001711 NM_001001924 NM_001001925 NM_001001927 NM_001001931 NM_001001974 NM_001002257 NM_001002860 NM_001002881 NM_001002926 NM_001003407 NM_001003408 NM_001003679 NM_001003712 NM_001003897 NM_001004330 NM_001005353 NM_001005386 NM_001005502 NM_001007023 NM_001007024 NM_001007025 NM_001007075 NM_001007214 NM_001007466 NM_001007535 NM_001008215 NM_001008392 NM_001008493 NM_001008539 NM_001009610 NM_001009883 NM_001009959 NM_001010000 NM_001010861 NM_001010883 NM_001010913 NM_001010925 NM_001011513 NM_001011514 NM_001011554 NM_001012393 NM_001012418 NM_001012424 NM_001012732 NM_001012733 NM_001012734 NM_001012755 NM_001012763 NM_001012968 NM_001012981 NM_001013619 NM_001013687 NM_001013698 NM_001013746 NM_001014797 NM_001015881 NM_001015886 NM_001018057 NM_001018058 NM_001018065 NM_001018066 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018097 NM_001020825 NM_001024094 NM_001024688 NM_001025072 NM_001025073 NM_001025252 NM_001025253 NM_001046 NM_001095 NM_001099 NM_001148 NM_001167 NM_001177 NM_001186 NM_001204 NM_001241 NM_001259 NM_001390 NM_001406 NM_001448 NM_001449 NM_001498 NM_001543 NM_001565 NM_001616 NM_001656 NM_001660 NM_001684 NM_001693 NM_001704 NM_001730 NM_001759 NM_001821 NM_001855 NM_001858 NM_001874 NM_001921 NM_002033 NM_002063 NM_002182 NM_002242 NM_002251 NM_002310 NM_002313 NM_002357 NM_002468 NM_002481 NM_002485 NM_002545 NM_002562 NM_002570 NM_002581 NM_002641 NM_002655 NM_002662 NM_002716 NM_002725 NM_002729 NM_002734 NM_002737 NM_002760 NM_002762 NM_002787 NM_002906 NM_002927 NM_003012 NM_003022 NM_003045 NM_003046 NM_003108 NM_003112 NM_003133 NM_003137 NM_003161 NM_003173 NM_003205 NM_003236 NM_003274 NM_003330 NM_003392 NM_003413 NM_003463 NM_003473 NM_003478 NM_003483 NM_003590 NM_003617 NM_003629 NM_003679 NM_003702 NM_003768 NM_003769 NM_003800 NM_003831 NM_003939 NM_003941 NM_003958 NM_004079 NM_004089 NM_004262 NM_004264 NM_004352 NM_004412 NM_004423 NM_004464 NM_004482 NM_004504 NM_004505 NM_004578 NM_004613 NM_004650 NM_004703 NM_004713 NM_004727 NM_004734 NM_004745 NM_004760 NM_004796 NM_004842 NM_004863 NM_004871 NM_004896 NM_004921 NM_004926 NM_004932 NM_004947 NM_005042 NM_005065 NM_005079 NM_005105 NM_005180 NM_005181 NM_005188 NM_005226 NM_005238 NM_005338 NM_005376 NM_005399 NM_005402 NM_005433 NM_005486 NM_005504 NM_005711 NM_005722 NM_005725 NM_005748 NM_005752 NM_005756 NM_005765 NM_005769 NM_005808 NM_005819 NM_005840 NM_005843 NM_005847 NM_005903 NM_005909 NM_005989 NM_006016 NM_006022 NM_006139 NM_006242 NM_006276 NM_006449 NM_006457 NM_006469 NM_006544 NM_006546 NM_006547 NM_006559 NM_006587 NM_006599 NM_006614 NM_006661 NM_006699 NM_006720 NM_006731 NM_006902 NM_006905 NM_006940 NM_006955 NM_007006 NM_007023 NM_007050 NM_007137 NM_007146 NM_007203 NM_007231 NM_007276 NM_007306 NM_007331 NM_007335 NM_007336 NM_007338 NM_007375 NM_012062 NM_012092 NM_012096 NM_012106 NM_012129 NM_012137 NM_012184 NM_012199 NM_012223 NM_012252 NM_012287 NM_012471 NM_013230 NM_013253 NM_013255 NM_013261 NM_013381 NM_013410 NM_013943 NM_013989 NM_013995 NM_014005 NM_014035 NM_014048 NM_014112 NM_014157 NM_014372 NM_014388 NM_014394 NM_014412 NM_014479 NM_014574 NM_014615 NM_014635 NM_014636 NM_014683 NM_014735 NM_014739 NM_014766 NM_014787 NM_014789 NM_014792 NM_014799 NM_014810 NM_014820 NM_014828 NM_014830 NM_014880 NM_014904 NM_014906 NM_014919 NM_014962 NM_015020 NM_015040 NM_015044 NM_015085 NM_015093 NM_015097 NM_015172 NM_015224 NM_015251 NM_015257 NM_015275 NM_015296 NM_015345 NM_015385 NM_015412 NM_015458 NM_015469 NM_015548 NM_015878 NM_015881 NM_015886 NM_015967 NM_015975 NM_015990 NM_016040 NM_016132 NM_016143 NM_016173 NM_016200 NM_016206 NM_016220 NM_016248 NM_016377 NM_016389 NM_016510 NM_016536 NM_016575 NM_016587 NM_017420 NM_017424 NM_017540 NM_017594 NM_017610 NM_017628 NM_017644 NM_017676 NM_017716 NM_017831 NM_017936 NM_017938 NM_017952 NM_018027 NM_018112 NM_018194 NM_018212 NM_018243 NM_018287 NM_018299 NM_018342 NM_018362 NM_018371 NM_018440 NM_018471 NM_018482 NM_018492 NM_018509 NM_018555 NM_018557 NM_018590 NM_018650 NM_018683 NM_018698 NM_018839 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018930 NM_018993 NM_019027 NM_019086 NM_020038 NM_020039 NM_020119 NM_020133 NM_020143 NM_020147 NM_020148 NM_020245 NM_020342 NM_020374 NM_020390 NM_020472 NM_020473 NM_020640 NM_020648 NM_020651 NM_020711 NM_020727 NM_020749 NM_020768 NM_020769 NM_020773 NM_020786 NM_020809 NM_020819 NM_020841 NM_020844 NM_020918 NM_020977 NM_021094 NM_021159 NM_021622 NM_021813 NM_021925 NM_021950 NM_021977 NM_022077 NM_022121 NM_022153 NM_022336 NM_022356 NM_022483 NM_022486 NM_022491 NM_022716 NM_022735 NM_022783 NM_022791 NM_022829 NM_022837 NM_022898 NM_024513 NM_024646 NM_024699 NM_024743 NM_024744 NM_024761 NM_024824 NM_024834 NM_024854 NM_024910 NM_024989 NM_025073 NM_025160 NM_025191 NM_030633 NM_030639 NM_030777 NM_030806 NM_031265 NM_031411 NM_031418 NM_031442 NM_031463 NM_031849 NM_031857 NM_031860 NM_032010 NM_032105 NM_032145 NM_032160 NM_032264 NM_032300 NM_032413 NM_032509 NM_032567 NM_032608 NM_032646 NM_032849 NM_032975 NM_032980 NM_033115 NM_033143 NM_033210 NM_033222 NM_033326 NM_033346 NM_033428 NM_033505 NM_033512 NM_033637 NM_033656 NM_033671 NM_052862 NM_052869 NM_052900 NM_052917 NM_053029 NM_058241 NM_080725 NM_080737 NM_080867 NM_080872 NM_133170 NM_133332 NM_133333 NM_133367 NM_133370 NM_133466 NM_133473 NM_133477 NM_134431 NM_138298 NM_138319 NM_138576 NM_138633 NM_138640 NM_138713 NM_138714 NM_138737 NM_138804 NM_138970 NM_139177 NM_139264 NM_144633 NM_144722 NM_144766 NM_144778 NM_145005 NM_145165 NM_145279 NM_145284 NM_145307 NM_145342 NM_145349 NM_145350 NM_145351 NM_145695 NM_145808 NM_145906 NM_145913 NM_147128 NM_147150 NM_148174 NM_152253 NM_152400 NM_152409 NM_152422 NM_152437 NM_152522 NM_152527 NM_152529 NM_152685 NM_152686 NM_152754 NM_152758 NM_152866 NM_152989 NM_152999 NM_153029 NM_153355 NM_153367 NM_153456 NM_153712 NM_153714 NM_153836 NM_170587 NM_170607 NM_171998 NM_172386 NM_173214 NM_173468 NM_173469 NM_173531 NM_173536 NM_173570 NM_173582 NM_173629 NM_173675 NM_173808 NM_173823 NM_173833 NM_173851 NM_174890 NM_174901 NM_174911 NM_175077 NM_175736 NM_175767 NM_175871 NM_175922 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176823 NM_177405 NM_177427 NM_177965 NM_177995 NM_178010 NM_178509 NM_178539 NM_178583 NM_178814 NM_178815 NM_181358 NM_181443 NM_181453 NM_181723 NM_181787 NM_181836 NM_182483 NM_182485 NM_182551 NM_182557 NM_182592 NM_182646 NM_182729 NM_182740 NM_182742 NM_182743 NM_182758 NM_182765 NM_182797 NM_182933 NM_183050 NM_183078 NM_183238 NM_183380 NM_183414 NM_183422 NM_183425 NM_194252 NM_194291 NM_197941 NM_197955 NM_198057 NM_198123 NM_198124 NM_198152 NM_198181 NM_198204 NM_198205 NM_198268 NM_198269 NM_198270 NM_198320 NM_198321 NM_198835 NM_198900 NM_198939 NM_199039 NM_199135 NM_199421 NM_199511 NM_199512 NM_201348 NM_201403 NM_201565 NM_203329 NM_203330 NM_203331 NM_203371 NM_203394 NM_203446 NM_203459 NM_203464 NM_205852 NM_205857 NM_206853 NM_206854 NM_206855 NM_206866 NM_206902 NM_206918 NM_207015 NM_207036 NM_207037 NM_207038 NM_207040 NM_207304 NM_207305 NM_207333 NM_207387 NM_207430 NM_207434 NM_207454 NM_207647 NM_207660 NM_207661 NM_207662 NM_212471 NM_212472 NM_213589 NM_213609 NM_214711 XM_039570 XM_042833 XM_044434 XM_047355 XM_067585 XM_117117 XM_166320 XM_208204 XM_209363 XM_290597 XM_294765 XM_370878 XM_370899 XM_371074 XM_371132 XM_371204 XM_371891 XM_372038 XM_372584 XM_373456 XM_373704 XM_373744 XM_374422 XM_374768 XM_374902 XM_376372 XM_376412 XM_376444 XM_376607 XM_376679 XM_376902 XM_377002 XM_378312 XM_378453 XM_378456 XM_378512 XM_378544 XM_378876 XM_379006 XM_379030 XM_379079 XM_379206 XM_379276 XM_379280 XM_379381 XM_379403 XM_379409 XM_379432 XM_379454 XM_379643 XM_379650 XM_379684 XM_379827 XM_379933 XM_495909 XM_496081 XM_496088 XM_496103 XM_496351 XM_496575 XM_496576 XM_496943 XM_498439 XM_498467 XM_498479 XM_498481 XM_498484 XM_498569 XM_498572 XM_499123 XM_499147 XM_499309 XM_499569 XM_499597 XM_499602 XR_000182 XR_000195 XR_000227 XR_000254
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)