VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"ccagaccgcucauggaaagug"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6192
.
Total Genes with multiple seed matches:
1803
.
Genes with at least one seed match:
NM_000016 NM_000027 NM_000028 NM_000033 NM_000038 NM_000043 NM_000046 NM_000067 NM_000070 NM_000071 NM_000081 NM_000096 NM_000104 NM_000109 NM_000110 NM_000111 NM_000112 NM_000114 NM_000115 NM_000125 NM_000139 NM_000141 NM_000151 NM_000161 NM_000165 NM_000170 NM_000173 NM_000176 NM_000181 NM_000182 NM_000191 NM_000192 NM_000195 NM_000210 NM_000212 NM_000214 NM_000216 NM_000219 NM_000220 NM_000221 NM_000231 NM_000232 NM_000233 NM_000237 NM_000240 NM_000242 NM_000246 NM_000248 NM_000254 NM_000259 NM_000262 NM_000266 NM_000267 NM_000272 NM_000276 NM_000291 NM_000297 NM_000298 NM_000299 NM_000305 NM_000310 NM_000319 NM_000322 NM_000327 NM_000330 NM_000332 NM_000337 NM_000345 NM_000348 NM_000349 NM_000351 NM_000353 NM_000356 NM_000362 NM_000368 NM_000370 NM_000373 NM_000378 NM_000385 NM_000386 NM_000393 NM_000397 NM_000399 NM_000405 NM_000410 NM_000411 NM_000421 NM_000430 NM_000434 NM_000439 NM_000449 NM_000450 NM_000452 NM_000462 NM_000480 NM_000489 NM_000492 NM_000494 NM_000497 NM_000498 NM_000500 NM_000508 NM_000510 NM_000529 NM_000533 NM_000538 NM_000542 NM_000543 NM_000551 NM_000554 NM_000555 NM_000565 NM_000569 NM_000570 NM_000573 NM_000574 NM_000577 NM_000579 NM_000596 NM_000600 NM_000609 NM_000611 NM_000617 NM_000618 NM_000619 NM_000625 NM_000629 NM_000633 NM_000635 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000651 NM_000655 NM_000661 NM_000664 NM_000668 NM_000670 NM_000672 NM_000681 NM_000683 NM_000684 NM_000690 NM_000692 NM_000693 NM_000695 NM_000700 NM_000720 NM_000721 NM_000724 NM_000726 NM_000749 NM_000775 NM_000779 NM_000782 NM_000791 NM_000792 NM_000793 NM_000800 NM_000801 NM_000806 NM_000809 NM_000810 NM_000811 NM_000814 NM_000815 NM_000834 NM_000843 NM_000844 NM_000849 NM_000859 NM_000860 NM_000861 NM_000862 NM_000868 NM_000872 NM_000877 NM_000879 NM_000885 NM_000890 NM_000891 NM_000899 NM_000900 NM_000901 NM_000902 NM_000910 NM_000913 NM_000914 NM_000917 NM_000921 NM_000930 NM_000931 NM_000933 NM_000935 NM_000943 NM_000945 NM_000958 NM_000961 NM_000962 NM_000963 NM_000997 NM_001001132 NM_001001330 NM_001001344 NM_001001346 NM_001001394 NM_001001418 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001483 NM_001001484 NM_001001523 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001557 NM_001001660 NM_001001662 NM_001001664 NM_001001675 NM_001001684 NM_001001685 NM_001001686 NM_001001688 NM_001001690 NM_001001696 NM_001001698 NM_001001700 NM_001001706 NM_001001707 NM_001001709 NM_001001711 NM_001001723 NM_001001870 NM_001001873 NM_001001874 NM_001001890 NM_001001894 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001938 NM_001001971 NM_001001974 NM_001001976 NM_001001995 NM_001002009 NM_001002010 NM_001002026 NM_001002032 NM_001002033 NM_001002034 NM_001002260 NM_001002265 NM_001002266 NM_001002269 NM_001002294 NM_001002762 NM_001002799 NM_001002800 NM_001002811 NM_001002812 NM_001002843 NM_001002881 NM_001002909 NM_001002924 NM_001003395 NM_001003396 NM_001003397 NM_001003398 NM_001003399 NM_001003406 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003681 NM_001003682 NM_001003692 NM_001003722 NM_001003786 NM_001003787 NM_001003788 NM_001003795 NM_001003807 NM_001003819 NM_001003827 NM_001003927 NM_001004053 NM_001004054 NM_001004127 NM_001004196 NM_001004197 NM_001004299 NM_001004300 NM_001004305 NM_001004306 NM_001004308 NM_001004311 NM_001004315 NM_001004322 NM_001004326 NM_001004328 NM_001004330 NM_001004335 NM_001004342 NM_001004343 NM_001004349 NM_001004356 NM_001004358 NM_001004360 NM_001004417 NM_001004421 NM_001004422 NM_001004426 NM_001004440 NM_001004707 NM_001005207 NM_001005210 NM_001005242 NM_001005266 NM_001005267 NM_001005268 NM_001005269 NM_001005303 NM_001005332 NM_001005333 NM_001005337 NM_001005353 NM_001005356 NM_001005357 NM_001005359 NM_001005364 NM_001005372 NM_001005386 NM_001005388 NM_001005389 NM_001005409 NM_001005473 NM_001005476 NM_001005502 NM_001005526 NM_001005611 NM_001005612 NM_001005614 NM_001005732 NM_001005733 NM_001005734 NM_001005737 NM_001005739 NM_001005746 NM_001005747 NM_001005766 NM_001005781 NM_001005782 NM_001005845 NM_001005861 NM_001006113 NM_001006118 NM_001006121 NM_001006600 NM_001006604 NM_001006610 NM_001006612 NM_001006613 NM_001006614 NM_001006615 NM_001006616 NM_001006623 NM_001006633 NM_001006635 NM_001006656 NM_001006657 NM_001006932 NM_001006945 NM_001007023 NM_001007024 NM_001007025 NM_001007071 NM_001007088 NM_001007094 NM_001007097 NM_001007102 NM_001007169 NM_001007214 NM_001007225 NM_001007237 NM_001007239 NM_001007243 NM_001007254 NM_001007267 NM_001007278 NM_001007466 NM_001007529 NM_001007535 NM_001007536 NM_001007542 NM_001007546 NM_001007559 NM_001007565 NM_001007593 NM_001007793 NM_001007794 NM_001008215 NM_001008224 NM_001008237 NM_001008239 NM_001008388 NM_001008389 NM_001008390 NM_001008392 NM_001008393 NM_001008396 NM_001008405 NM_001008407 NM_001008408 NM_001008410 NM_001008411 NM_001008491 NM_001008492 NM_001008493 NM_001008494 NM_001008528 NM_001008529 NM_001008537 NM_001008539 NM_001008544 NM_001008567 NM_001008656 NM_001008660 NM_001008726 NM_001008736 NM_001008737 NM_001008738 NM_001008742 NM_001008745 NM_001008756 NM_001008781 NM_001008800 NM_001008860 NM_001008883 NM_001008892 NM_001008894 NM_001008895 NM_001008925 NM_001009185 NM_001009554 NM_001009566 NM_001009569 NM_001009584 NM_001009610 NM_001009611 NM_001009880 NM_001009881 NM_001009882 NM_001009883 NM_001009894 NM_001009909 NM_001009913 NM_001009921 NM_001009922 NM_001009931 NM_001009932 NM_001009933 NM_001009934 NM_001009954 NM_001009959 NM_001009992 NM_001010000 NM_001010846 NM_001010852 NM_001010861 NM_001010862 NM_001010864 NM_001010867 NM_001010871 NM_001010874 NM_001010879 NM_001010882 NM_001010883 NM_001010888 NM_001010890 NM_001010891 NM_001010909 NM_001010911 NM_001010913 NM_001010924 NM_001010934 NM_001010935 NM_001010942 NM_001010974 NM_001010977 NM_001010980 NM_001010984 NM_001010986 NM_001010987 NM_001011513 NM_001011514 NM_001011537 NM_001011539 NM_001011551 NM_001011553 NM_001011649 NM_001011656 NM_001011657 NM_001011663 NM_001011664 NM_001011666 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011700 NM_001011708 NM_001011713 NM_001011724 NM_001011725 NM_001011885 NM_001012267 NM_001012270 NM_001012271 NM_001012278 NM_001012279 NM_001012329 NM_001012339 NM_001012361 NM_001012393 NM_001012418 NM_001012420 NM_001012423 NM_001012452 NM_001012507 NM_001012509 NM_001012511 NM_001012626 NM_001012642 NM_001012651 NM_001012659 NM_001012713 NM_001012715 NM_001012720 NM_001012722 NM_001012729 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012756 NM_001012761 NM_001012957 NM_001012960 NM_001012968 NM_001012981 NM_001012982 NM_001012985 NM_001012988 NM_001013029 NM_001013399 NM_001013406 NM_001013407 NM_001013415 NM_001013442 NM_001013615 NM_001013617 NM_001013629 NM_001013633 NM_001013642 NM_001013645 NM_001013648 NM_001013649 NM_001013650 NM_001013666 NM_001013674 NM_001013675 NM_001013676 NM_001013680 NM_001013687 NM_001013688 NM_001013690 NM_001013691 NM_001013697 NM_001013698 NM_001013705 NM_001013717 NM_001013719 NM_001013724 NM_001013726 NM_001013734 NM_001013746 NM_001014373 NM_001014439 NM_001014765 NM_001014797 NM_001014972 NM_001014978 NM_001015045 NM_001015048 NM_001015049 NM_001015051 NM_001015053 NM_001015880 NM_001015881 NM_001015882 NM_001015883 NM_001017370 NM_001017395 NM_001017396 NM_001017408 NM_001017423 NM_001017424 NM_001017425 NM_001017440 NM_001017520 NM_001017523 NM_001017926 NM_001017930 NM_001017962 NM_001017970 NM_001017972 NM_001017975 NM_001017980 NM_001017995 NM_001017998 NM_001018046 NM_001018053 NM_001018058 NM_001018067 NM_001018068 NM_001018069 NM_001018072 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018080 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018100 NM_001018101 NM_001018102 NM_001018111 NM_001018161 NM_001020825 NM_001023563 NM_001023567 NM_001023582 NM_001024094 NM_001024372 NM_001024380 NM_001024381 NM_001024457 NM_001024463 NM_001024596 NM_001024630 NM_001024631 NM_001024649 NM_001024654 NM_001024657 NM_001024660 NM_001024680 NM_001024843 NM_001024844 NM_001024847 NM_001024855 NM_001024858 NM_001024912 NM_001024921 NM_001024934 NM_001024935 NM_001024936 NM_001024947 NM_001024948 NM_001025076 NM_001025077 NM_001025081 NM_001025090 NM_001025092 NM_001025094 NM_001025098 NM_001025101 NM_001025108 NM_001025203 NM_001025204 NM_001025242 NM_001025243 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001038 NM_001039 NM_001044 NM_001045 NM_001046 NM_001049 NM_001050 NM_001056 NM_001066 NM_001080 NM_001083 NM_001094 NM_001099 NM_001103 NM_001114 NM_001121 NM_001128 NM_001144 NM_001146 NM_001147 NM_001157 NM_001167 NM_001168 NM_001174 NM_001177 NM_001179 NM_001186 NM_001188 NM_001191 NM_001196 NM_001204 NM_001206 NM_001219 NM_001228 NM_001230 NM_001233 NM_001234 NM_001235 NM_001241 NM_001243 NM_001245 NM_001254 NM_001256 NM_001257 NM_001259 NM_001260 NM_001268 NM_001271 NM_001281 NM_001284 NM_001290 NM_001293 NM_001295 NM_001303 NM_001304 NM_001315 NM_001331 NM_001336 NM_001338 NM_001340 NM_001345 NM_001349 NM_001351 NM_001356 NM_001358 NM_001376 NM_001381 NM_001384 NM_001387 NM_001390 NM_001391 NM_001394 NM_001401 NM_001407 NM_001417 NM_001419 NM_001422 NM_001423 NM_001427 NM_001430 NM_001431 NM_001432 NM_001438 NM_001440 NM_001450 NM_001451 NM_001452 NM_001454 NM_001457 NM_001463 NM_001465 NM_001483 NM_001490 NM_001496 NM_001498 NM_001515 NM_001532 NM_001535 NM_001542 NM_001543 NM_001544 NM_001546 NM_001556 NM_001563 NM_001569 NM_001587 NM_001609 NM_001610 NM_001614 NM_001616 NM_001617 NM_001622 NM_001624 NM_001627 NM_001628 NM_001642 NM_001650 NM_001655 NM_001661 NM_001664 NM_001668 NM_001674 NM_001675 NM_001690 NM_001695 NM_001696 NM_001709 NM_001712 NM_001714 NM_001718 NM_001721 NM_001724 NM_001728 NM_001731 NM_001742 NM_001746 NM_001754 NM_001759 NM_001761 NM_001766 NM_001769 NM_001788 NM_001791 NM_001793 NM_001801 NM_001802 NM_001806 NM_001815 NM_001817 NM_001819 NM_001821 NM_001831 NM_001838 NM_001844 NM_001850 NM_001870 NM_001874 NM_001879 NM_001881 NM_001884 NM_001885 NM_001886 NM_001904 NM_001908 NM_001927 NM_001933 NM_001938 NM_001941 NM_001942 NM_001951 NM_001952 NM_001957 NM_001963 NM_001964 NM_001966 NM_001967 NM_001969 NM_001982 NM_001992 NM_001993 NM_001995 NM_002006 NM_002009 NM_002015 NM_002016 NM_002020 NM_002021 NM_002024 NM_002025 NM_002026 NM_002028 NM_002033 NM_002040 NM_002041 NM_002044 NM_002048 NM_002053 NM_002054 NM_002061 NM_002062 NM_002069 NM_002070 NM_002073 NM_002076 NM_002077 NM_002080 NM_002086 NM_002101 NM_002111 NM_002128 NM_002130 NM_002136 NM_002139 NM_002140 NM_002145 NM_002154 NM_002158 NM_002163 NM_002182 NM_002196 NM_002202 NM_002203 NM_002210 NM_002223 NM_002224 NM_002226 NM_002228 NM_002231 NM_002239 NM_002240 NM_002241 NM_002243 NM_002246 NM_002251 NM_002259 NM_002260 NM_002264 NM_002265 NM_002267 NM_002268 NM_002283 NM_002285 NM_002287 NM_002293 NM_002296 NM_002301 NM_002310 NM_002312 NM_002313 NM_002340 NM_002348 NM_002349 NM_002350 NM_002351 NM_002357 NM_002358 NM_002359 NM_002364 NM_002367 NM_002375 NM_002381 NM_002385 NM_002386 NM_002389 NM_002397 NM_002402 NM_002406 NM_002408 NM_002416 NM_002420 NM_002424 NM_002430 NM_002451 NM_002454 NM_002460 NM_002468 NM_002469 NM_002474 NM_002480 NM_002481 NM_002482 NM_002487 NM_002489 NM_002499 NM_002500 NM_002515 NM_002526 NM_002543 NM_002545 NM_002546 NM_002547 NM_002556 NM_002558 NM_002570 NM_002577 NM_002581 NM_002588 NM_002604 NM_002609 NM_002610 NM_002635 NM_002639 NM_002640 NM_002641 NM_002655 NM_002664 NM_002670 NM_002674 NM_002677 NM_002703 NM_002709 NM_002714 NM_002715 NM_002718 NM_002719 NM_002725 NM_002731 NM_002734 NM_002736 NM_002737 NM_002740 NM_002744 NM_002748 NM_002758 NM_002762 NM_002772 NM_002786 NM_002806 NM_002813 NM_002815 NM_002816 NM_002822 NM_002832 NM_002834 NM_002836 NM_002839 NM_002845 NM_002848 NM_002857 NM_002860 NM_002868 NM_002869 NM_002873 NM_002874 NM_002876 NM_002881 NM_002884 NM_002886 NM_002895 NM_002901 NM_002918 NM_002919 NM_002921 NM_002922 NM_002924 NM_002927 NM_002937 NM_002938 NM_002940 NM_002941 NM_002948 NM_002957 NM_002958 NM_002959 NM_002968 NM_002973 NM_002977 NM_002990 NM_002994 NM_002998 NM_003012 NM_003014 NM_003015 NM_003016 NM_003017 NM_003024 NM_003026 NM_003031 NM_003043 NM_003046 NM_003048 NM_003051 NM_003060 NM_003074 NM_003079 NM_003103 NM_003108 NM_003112 NM_003118 NM_003123 NM_003130 NM_003133 NM_003136 NM_003144 NM_003149 NM_003155 NM_003161 NM_003165 NM_003168 NM_003170 NM_003183 NM_003184 NM_003189 NM_003200 NM_003202 NM_003203 NM_003204 NM_003211 NM_003212 NM_003215 NM_003216 NM_003222 NM_003223 NM_003226 NM_003236 NM_003239 NM_003242 NM_003246 NM_003252 NM_003255 NM_003262 NM_003266 NM_003270 NM_003274 NM_003287 NM_003316 NM_003319 NM_003320 NM_003326 NM_003336 NM_003337 NM_003338 NM_003339 NM_003343 NM_003345 NM_003348 NM_003349 NM_003352 NM_003355 NM_003361 NM_003362 NM_003363 NM_003366 NM_003379 NM_003381 NM_003385 NM_003387 NM_003392 NM_003403 NM_003404 NM_003405 NM_003409 NM_003411 NM_003415 NM_003421 NM_003423 NM_003428 NM_003429 NM_003431 NM_003435 NM_003436 NM_003439 NM_003440 NM_003441 NM_003444 NM_003452 NM_003453 NM_003454 NM_003455 NM_003458 NM_003462 NM_003463 NM_003469 NM_003471 NM_003472 NM_003473 NM_003478 NM_003480 NM_003486 NM_003488 NM_003507 NM_003558 NM_003559 NM_003560 NM_003574 NM_003576 NM_003583 NM_003585 NM_003589 NM_003590 NM_003597 NM_003600 NM_003603 NM_003605 NM_003607 NM_003615 NM_003617 NM_003628 NM_003629 NM_003630 NM_003636 NM_003637 NM_003644 NM_003648 NM_003649 NM_003658 NM_003663 NM_003672 NM_003675 NM_003677 NM_003679 NM_003687 NM_003695 NM_003704 NM_003705 NM_003708 NM_003719 NM_003722 NM_003724 NM_003735 NM_003736 NM_003742 NM_003745 NM_003748 NM_003759 NM_003760 NM_003763 NM_003772 NM_003774 NM_003777 NM_003781 NM_003783 NM_003794 NM_003795 NM_003799 NM_003804 NM_003810 NM_003816 NM_003818 NM_003822 NM_003824 NM_003825 NM_003831 NM_003838 NM_003842 NM_003851 NM_003861 NM_003869 NM_003873 NM_003882 NM_003884 NM_003887 NM_003888 NM_003889 NM_003895 NM_003896 NM_003898 NM_003899 NM_003913 NM_003918 NM_003928 NM_003929 NM_003931 NM_003936 NM_003937 NM_003939 NM_003943 NM_003951 NM_003952 NM_003953 NM_003958 NM_003966 NM_003976 NM_003994 NM_003996 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004024 NM_004028 NM_004032 NM_004036 NM_004041 NM_004050 NM_004052 NM_004054 NM_004064 NM_004077 NM_004079 NM_004088 NM_004089 NM_004090 NM_004093 NM_004094 NM_004095 NM_004099 NM_004109 NM_004111 NM_004113 NM_004114 NM_004124 NM_004125 NM_004133 NM_004155 NM_004157 NM_004170 NM_004171 NM_004172 NM_004177 NM_004184 NM_004197 NM_004200 NM_004204 NM_004215 NM_004216 NM_004233 NM_004234 NM_004239 NM_004253 NM_004262 NM_004264 NM_004268 NM_004272 NM_004273 NM_004274 NM_004286 NM_004287 NM_004288 NM_004293 NM_004294 NM_004311 NM_004316 NM_004319 NM_004326 NM_004331 NM_004338 NM_004339 NM_004342 NM_004346 NM_004348 NM_004350 NM_004362 NM_004367 NM_004368 NM_004369 NM_004370 NM_004376 NM_004379 NM_004382 NM_004383 NM_004385 NM_004389 NM_004392 NM_004397 NM_004399 NM_004404 NM_004412 NM_004419 NM_004421 NM_004426 NM_004429 NM_004437 NM_004438 NM_004441 NM_004442 NM_004447 NM_004449 NM_004454 NM_004458 NM_004462 NM_004464 NM_004466 NM_004468 NM_004473 NM_004481 NM_004486 NM_004487 NM_004494 NM_004496 NM_004502 NM_004503 NM_004504 NM_004505 NM_004513 NM_004516 NM_004520 NM_004527 NM_004529 NM_004531 NM_004535 NM_004536 NM_004549 NM_004555 NM_004560 NM_004561 NM_004562 NM_004566 NM_004567 NM_004572 NM_004573 NM_004577 NM_004582 NM_004586 NM_004595 NM_004598 NM_004600 NM_004612 NM_004614 NM_004619 NM_004620 NM_004622 NM_004627 NM_004635 NM_004641 NM_004642 NM_004645 NM_004652 NM_004657 NM_004660 NM_004661 NM_004667 NM_004668 NM_004670 NM_004671 NM_004673 NM_004675 NM_004686 NM_004690 NM_004693 NM_004702 NM_004703 NM_004705 NM_004709 NM_004717 NM_004719 NM_004722 NM_004725 NM_004727 NM_004728 NM_004731 NM_004732 NM_004734 NM_004736 NM_004737 NM_004738 NM_004741 NM_004742 NM_004744 NM_004745 NM_004747 NM_004752 NM_004758 NM_004762 NM_004763 NM_004774 NM_004778 NM_004782 NM_004795 NM_004796 NM_004797 NM_004801 NM_004804 NM_004807 NM_004815 NM_004821 NM_004823 NM_004827 NM_004830 NM_004836 NM_004840 NM_004845 NM_004849 NM_004854 NM_004863 NM_004866 NM_004871 NM_004873 NM_004887 NM_004891 NM_004892 NM_004897 NM_004898 NM_004899 NM_004904 NM_004912 NM_004921 NM_004925 NM_004929 NM_004932 NM_004934 NM_004936 NM_004939 NM_004947 NM_004949 NM_004956 NM_004958 NM_004962 NM_004965 NM_004969 NM_004975 NM_004983 NM_004985 NM_004990 NM_004991 NM_004992 NM_004993 NM_005007 NM_005011 NM_005014 NM_005036 NM_005042 NM_005045 NM_005050 NM_005053 NM_005056 NM_005057 NM_005060 NM_005063 NM_005065 NM_005066 NM_005077 NM_005079 NM_005082 NM_005086 NM_005094 NM_005102 NM_005105 NM_005108 NM_005109 NM_005116 NM_005118 NM_005125 NM_005126 NM_005128 NM_005134 NM_005146 NM_005149 NM_005153 NM_005171 NM_005181 NM_005188 NM_005190 NM_005191 NM_005207 NM_005208 NM_005225 NM_005228 NM_005233 NM_005238 NM_005239 NM_005244 NM_005245 NM_005249 NM_005252 NM_005254 NM_005256 NM_005259 NM_005271 NM_005277 NM_005282 NM_005296 NM_005302 NM_005304 NM_005308 NM_005311 NM_005316 NM_005324 NM_005327 NM_005328 NM_005329 NM_005333 NM_005335 NM_005339 NM_005342 NM_005378 NM_005385 NM_005388 NM_005397 NM_005398 NM_005399 NM_005402 NM_005414 NM_005416 NM_005431 NM_005433 NM_005436 NM_005441 NM_005442 NM_005446 NM_005455 NM_005462 NM_005467 NM_005468 NM_005472 NM_005474 NM_005475 NM_005486 NM_005487 NM_005496 NM_005499 NM_005502 NM_005503 NM_005504 NM_005506 NM_005512 NM_005517 NM_005522 NM_005529 NM_005530 NM_005536 NM_005537 NM_005540 NM_005542 NM_005546 NM_005556 NM_005562 NM_005563 NM_005573 NM_005575 NM_005578 NM_005584 NM_005586 NM_005589 NM_005590 NM_005591 NM_005593 NM_005601 NM_005604 NM_005613 NM_005626 NM_005634 NM_005637 NM_005638 NM_005639 NM_005642 NM_005643 NM_005649 NM_005655 NM_005656 NM_005658 NM_005665 NM_005668 NM_005680 NM_005694 NM_005698 NM_005711 NM_005713 NM_005715 NM_005719 NM_005721 NM_005722 NM_005723 NM_005729 NM_005732 NM_005737 NM_005739 NM_005744 NM_005763 NM_005779 NM_005788 NM_005789 NM_005798 NM_005802 NM_005808 NM_005810 NM_005813 NM_005817 NM_005819 NM_005822 NM_005828 NM_005831 NM_005832 NM_005835 NM_005840 NM_005841 NM_005843 NM_005856 NM_005857 NM_005863 NM_005870 NM_005877 NM_005885 NM_005888 NM_005894 NM_005898 NM_005899 NM_005901 NM_005902 NM_005903 NM_005906 NM_005907 NM_005909 NM_005911 NM_005915 NM_005920 NM_005930 NM_005933 NM_005935 NM_005941 NM_005944 NM_005956 NM_005964 NM_005965 NM_005966 NM_005975 NM_005977 NM_005981 NM_005995 NM_005996 NM_005998 NM_005999 NM_006016 NM_006033 NM_006035 NM_006036 NM_006037 NM_006038 NM_006045 NM_006047 NM_006054 NM_006055 NM_006056 NM_006060 NM_006061 NM_006065 NM_006070 NM_006079 NM_006085 NM_006090 NM_006092 NM_006103 NM_006106 NM_006108 NM_006122 NM_006129 NM_006134 NM_006139 NM_006141 NM_006148 NM_006151 NM_006152 NM_006154 NM_006155 NM_006162 NM_006165 NM_006167 NM_006172 NM_006174 NM_006178 NM_006186 NM_006187 NM_006190 NM_006202 NM_006203 NM_006224 NM_006235 NM_006237 NM_006239 NM_006241 NM_006242 NM_006243 NM_006255 NM_006257 NM_006259 NM_006265 NM_006267 NM_006282 NM_006283 NM_006286 NM_006291 NM_006298 NM_006299 NM_006306 NM_006313 NM_006315 NM_006317 NM_006320 NM_006321 NM_006322 NM_006330 NM_006335 NM_006336 NM_006344 NM_006346 NM_006352 NM_006353 NM_006358 NM_006359 NM_006361 NM_006363 NM_006366 NM_006371 NM_006375 NM_006378 NM_006379 NM_006385 NM_006386 NM_006391 NM_006393 NM_006404 NM_006406 NM_006409 NM_006413 NM_006419 NM_006426 NM_006449 NM_006457 NM_006459 NM_006460 NM_006464 NM_006471 NM_006472 NM_006479 NM_006481 NM_006482 NM_006488 NM_006489 NM_006496 NM_006499 NM_006504 NM_006520 NM_006526 NM_006527 NM_006529 NM_006534 NM_006536 NM_006538 NM_006544 NM_006546 NM_006547 NM_006548 NM_006554 NM_006561 NM_006566 NM_006572 NM_006587 NM_006588 NM_006595 NM_006599 NM_006603 NM_006606 NM_006608 NM_006609 NM_006611 NM_006612 NM_006613 NM_006614 NM_006620 NM_006624 NM_006625 NM_006626 NM_006628 NM_006633 NM_006640 NM_006641 NM_006644 NM_006646 NM_006661 NM_006667 NM_006669 NM_006675 NM_006691 NM_006694 NM_006697 NM_006699 NM_006713 NM_006720 NM_006722 NM_006727 NM_006729 NM_006730 NM_006731 NM_006735 NM_006738 NM_006744 NM_006746 NM_006749 NM_006752 NM_006754 NM_006758 NM_006763 NM_006775 NM_006777 NM_006783 NM_006785 NM_006788 NM_006789 NM_006794 NM_006800 NM_006802 NM_006807 NM_006811 NM_006813 NM_006818 NM_006823 NM_006827 NM_006831 NM_006836 NM_006847 NM_006855 NM_006857 NM_006861 NM_006888 NM_006890 NM_006894 NM_006908 NM_006914 NM_006922 NM_006930 NM_006931 NM_006938 NM_006947 NM_006948 NM_006955 NM_006959 NM_006961 NM_006962 NM_006963 NM_006965 NM_006974 NM_006978 NM_006981 NM_006986 NM_006989 NM_006991 NM_006995 NM_006999 NM_007007 NM_007013 NM_007014 NM_007017 NM_007034 NM_007038 NM_007041 NM_007042 NM_007043 NM_007048 NM_007049 NM_007050 NM_007055 NM_007064 NM_007067 NM_007068 NM_007070 NM_007073 NM_007078 NM_007084 NM_007085 NM_007086 NM_007106 NM_007110 NM_007123 NM_007125 NM_007130 NM_007131 NM_007136 NM_007145 NM_007146 NM_007148 NM_007149 NM_007157 NM_007159 NM_007166 NM_007168 NM_007175 NM_007176 NM_007190 NM_007193 NM_007200 NM_007203 NM_007204 NM_007208 NM_007214 NM_007218 NM_007222 NM_007229 NM_007231 NM_007236 NM_007249 NM_007271 NM_007276 NM_007277 NM_007282 NM_007284 NM_007287 NM_007288 NM_007289 NM_007306 NM_007323 NM_007328 NM_007350 NM_007351 NM_007356 NM_007357 NM_007361 NM_007362 NM_007371 NM_007373 NM_007375 NM_012062 NM_012069 NM_012072 NM_012080 NM_012081 NM_012084 NM_012091 NM_012095 NM_012096 NM_012102 NM_012104 NM_012105 NM_012124 NM_012129 NM_012133 NM_012134 NM_012137 NM_012156 NM_012157 NM_012158 NM_012164 NM_012171 NM_012173 NM_012177 NM_012190 NM_012192 NM_012193 NM_012199 NM_012201 NM_012210 NM_012214 NM_012219 NM_012223 NM_012229 NM_012234 NM_012238 NM_012241 NM_012243 NM_012252 NM_012258 NM_012261 NM_012262 NM_012266 NM_012271 NM_012279 NM_012280 NM_012281 NM_012287 NM_012290 NM_012296 NM_012297 NM_012300 NM_012306 NM_012307 NM_012309 NM_012316 NM_012323 NM_012327 NM_012328 NM_012329 NM_012341 NM_012347 NM_012382 NM_012388 NM_012395 NM_012397 NM_012400 NM_012408 NM_012409 NM_012420 NM_012425 NM_012426 NM_012430 NM_012431 NM_012432 NM_012436 NM_012448 NM_012453 NM_012464 NM_012465 NM_012479 NM_012482 NM_013231 NM_013236 NM_013243 NM_013246 NM_013255 NM_013256 NM_013261 NM_013262 NM_013267 NM_013276 NM_013277 NM_013279 NM_013280 NM_013281 NM_013286 NM_013293 NM_013302 NM_013305 NM_013325 NM_013330 NM_013336 NM_013341 NM_013343 NM_013351 NM_013371 NM_013372 NM_013374 NM_013384 NM_013385 NM_013389 NM_013390 NM_013391 NM_013393 NM_013396 NM_013410 NM_013423 NM_013427 NM_013444 NM_013448 NM_013449 NM_013451 NM_013987 NM_013988 NM_013989 NM_013999 NM_014011 NM_014015 NM_014023 NM_014028 NM_014030 NM_014034 NM_014042 NM_014048 NM_014050 NM_014057 NM_014059 NM_014066 NM_014077 NM_014080 NM_014096 NM_014112 NM_014117 NM_014141 NM_014153 NM_014154 NM_014155 NM_014157 NM_014208 NM_014210 NM_014216 NM_014217 NM_014231 NM_014235 NM_014243 NM_014250 NM_014256 NM_014263 NM_014279 NM_014283 NM_014286 NM_014289 NM_014292 NM_014299 NM_014305 NM_014306 NM_014313 NM_014319 NM_014325 NM_014326 NM_014331 NM_014333 NM_014338 NM_014342 NM_014354 NM_014358 NM_014370 NM_014372 NM_014384 NM_014388 NM_014391 NM_014395 NM_014399 NM_014410 NM_014411 NM_014412 NM_014432 NM_014444 NM_014447 NM_014452 NM_014454 NM_014456 NM_014458 NM_014459 NM_014462 NM_014468 NM_014473 NM_014479 NM_014481 NM_014485 NM_014489 NM_014494 NM_014497 NM_014517 NM_014518 NM_014548 NM_014553 NM_014569 NM_014573 NM_014575 NM_014577 NM_014584 NM_014586 NM_014587 NM_014603 NM_014607 NM_014616 NM_014629 NM_014634 NM_014636 NM_014637 NM_014644 NM_014646 NM_014647 NM_014655 NM_014656 NM_014657 NM_014659 NM_014663 NM_014670 NM_014679 NM_014682 NM_014686 NM_014689 NM_014697 NM_014699 NM_014701 NM_014702 NM_014707 NM_014711 NM_014715 NM_014719 NM_014720 NM_014721 NM_014724 NM_014726 NM_014728 NM_014729 NM_014730 NM_014732 NM_014735 NM_014739 NM_014742 NM_014743 NM_014746 NM_014747 NM_014751 NM_014758 NM_014762 NM_014766 NM_014773 NM_014774 NM_014776 NM_014777 NM_014782 NM_014787 NM_014788 NM_014789 NM_014792 NM_014797 NM_014798 NM_014802 NM_014803 NM_014805 NM_014809 NM_014810 NM_014819 NM_014821 NM_014822 NM_014824 NM_014826 NM_014828 NM_014829 NM_014832 NM_014835 NM_014839 NM_014840 NM_014841 NM_014850 NM_014854 NM_014857 NM_014859 NM_014860 NM_014862 NM_014864 NM_014867 NM_014871 NM_014872 NM_014873 NM_014876 NM_014880 NM_014883 NM_014893 NM_014897 NM_014898 NM_014899 NM_014901 NM_014903 NM_014904 NM_014905 NM_014906 NM_014909 NM_014910 NM_014911 NM_014912 NM_014917 NM_014918 NM_014919 NM_014923 NM_014924 NM_014925 NM_014926 NM_014930 NM_014934 NM_014936 NM_014937 NM_014944 NM_014945 NM_014946 NM_014947 NM_014949 NM_014951 NM_014952 NM_014955 NM_014957 NM_014961 NM_014962 NM_014964 NM_014967 NM_014969 NM_014974 NM_014988 NM_014991 NM_014997 NM_015000 NM_015002 NM_015003 NM_015008 NM_015009 NM_015011 NM_015012 NM_015017 NM_015023 NM_015025 NM_015027 NM_015032 NM_015033 NM_015035 NM_015039 NM_015040 NM_015044 NM_015049 NM_015051 NM_015054 NM_015074 NM_015075 NM_015077 NM_015079 NM_015085 NM_015088 NM_015090 NM_015092 NM_015093 NM_015094 NM_015100 NM_015101 NM_015103 NM_015115 NM_015130 NM_015132 NM_015134 NM_015144 NM_015149 NM_015150 NM_015155 NM_015158 NM_015163 NM_015169 NM_015170 NM_015172 NM_015176 NM_015191 NM_015192 NM_015200 NM_015205 NM_015206 NM_015208 NM_015224 NM_015225 NM_015226 NM_015227 NM_015229 NM_015231 NM_015247 NM_015253 NM_015254 NM_015256 NM_015257 NM_015259 NM_015261 NM_015264 NM_015265 NM_015267 NM_015269 NM_015271 NM_015272 NM_015278 NM_015282 NM_015286 NM_015288 NM_015294 NM_015303 NM_015305 NM_015310 NM_015313 NM_015314 NM_015315 NM_015317 NM_015318 NM_015323 NM_015326 NM_015327 NM_015328 NM_015330 NM_015335 NM_015336 NM_015338 NM_015344 NM_015347 NM_015349 NM_015352 NM_015353 NM_015355 NM_015358 NM_015359 NM_015369 NM_015375 NM_015378 NM_015383 NM_015384 NM_015387 NM_015394 NM_015397 NM_015421 NM_015423 NM_015428 NM_015436 NM_015438 NM_015444 NM_015453 NM_015460 NM_015463 NM_015464 NM_015470 NM_015476 NM_015493 NM_015508 NM_015509 NM_015513 NM_015515 NM_015525 NM_015527 NM_015532 NM_015533 NM_015549 NM_015553 NM_015557 NM_015558 NM_015564 NM_015565 NM_015567 NM_015568 NM_015569 NM_015570 NM_015575 NM_015576 NM_015577 NM_015595 NM_015600 NM_015604 NM_015609 NM_015613 NM_015626 NM_015633 NM_015640 NM_015646 NM_015657 NM_015666 NM_015679 NM_015686 NM_015687 NM_015691 NM_015696 NM_015698 NM_015701 NM_015719 NM_015726 NM_015836 NM_015885 NM_015886 NM_015891 NM_015892 NM_015911 NM_015928 NM_015935 NM_015939 NM_015950 NM_015955 NM_015957 NM_015975 NM_015981 NM_015984 NM_015986 NM_015995 NM_015997 NM_015999 NM_016008 NM_016019 NM_016021 NM_016028 NM_016038 NM_016039 NM_016041 NM_016042 NM_016063 NM_016071 NM_016072 NM_016076 NM_016078 NM_016080 NM_016081 NM_016086 NM_016090 NM_016096 NM_016101 NM_016114 NM_016121 NM_016127 NM_016132 NM_016138 NM_016141 NM_016146 NM_016156 NM_016185 NM_016200 NM_016205 NM_016206 NM_016210 NM_016212 NM_016217 NM_016220 NM_016221 NM_016224 NM_016227 NM_016230 NM_016233 NM_016235 NM_016242 NM_016247 NM_016249 NM_016252 NM_016255 NM_016257 NM_016258 NM_016260 NM_016264 NM_016269 NM_016271 NM_016275 NM_016277 NM_016280 NM_016281 NM_016282 NM_016289 NM_016303 NM_016304 NM_016308 NM_016322 NM_016338 NM_016340 NM_016353 NM_016369 NM_016373 NM_016376 NM_016382 NM_016389 NM_016396 NM_016406 NM_016410 NM_016422 NM_016434 NM_016442 NM_016448 NM_016449 NM_016457 NM_016463 NM_016467 NM_016468 NM_016470 NM_016472 NM_016474 NM_016488 NM_016489 NM_016516 NM_016522 NM_016530 NM_016534 NM_016536 NM_016542 NM_016544 NM_016559 NM_016563 NM_016569 NM_016575 NM_016577 NM_016578 NM_016587 NM_016590 NM_016591 NM_016592 NM_016598 NM_016599 NM_016603 NM_016604 NM_016607 NM_016611 NM_016613 NM_016618 NM_016620 NM_016621 NM_016622 NM_016643 NM_016649 NM_016651 NM_016654 NM_016655 NM_016815 NM_016824 NM_016831 NM_016929 NM_016936 NM_016937 NM_016940 NM_016950 NM_017409 NM_017410 NM_017413 NM_017420 NM_017423 NM_017429 NM_017435 NM_017436 NM_017439 NM_017447 NM_017448 NM_017449 NM_017456 NM_017460 NM_017482 NM_017483 NM_017484 NM_017485 NM_017486 NM_017487 NM_017488 NM_017493 NM_017515 NM_017516 NM_017526 NM_017540 NM_017541 NM_017542 NM_017544 NM_017548 NM_017558 NM_017563 NM_017569 NM_017573 NM_017577 NM_017582 NM_017588 NM_017594 NM_017599 NM_017602 NM_017611 NM_017619 NM_017626 NM_017628 NM_017629 NM_017632 NM_017634 NM_017635 NM_017637 NM_017643 NM_017644 NM_017645 NM_017651 NM_017661 NM_017665 NM_017667 NM_017669 NM_017672 NM_017673 NM_017676 NM_017677 NM_017681 NM_017684 NM_017694 NM_017704 NM_017705 NM_017709 NM_017714 NM_017723 NM_017730 NM_017736 NM_017737 NM_017741 NM_017742 NM_017761 NM_017769 NM_017770 NM_017771 NM_017773 NM_017776 NM_017780 NM_017784 NM_017790 NM_017801 NM_017802 NM_017810 NM_017813 NM_017820 NM_017822 NM_017828 NM_017831 NM_017837 NM_017838 NM_017843 NM_017847 NM_017853 NM_017880 NM_017881 NM_017898 NM_017919 NM_017924 NM_017928 NM_017929 NM_017936 NM_017938 NM_017939 NM_017943 NM_017945 NM_017946 NM_017953 NM_017958 NM_017975 NM_017982 NM_017988 NM_017990 NM_017991 NM_017993 NM_018003 NM_018010 NM_018011 NM_018013 NM_018017 NM_018018 NM_018019 NM_018026 NM_018027 NM_018030 NM_018036 NM_018048 NM_018055 NM_018057 NM_018058 NM_018059 NM_018066 NM_018069 NM_018077 NM_018078 NM_018086 NM_018091 NM_018099 NM_018108 NM_018117 NM_018120 NM_018122 NM_018137 NM_018146 NM_018156 NM_018157 NM_018167 NM_018169 NM_018170 NM_018172 NM_018173 NM_018176 NM_018177 NM_018178 NM_018181 NM_018189 NM_018191 NM_018194 NM_018195 NM_018196 NM_018204 NM_018205 NM_018208 NM_018211 NM_018212 NM_018214 NM_018222 NM_018223 NM_018224 NM_018226 NM_018227 NM_018230 NM_018234 NM_018235 NM_018238 NM_018239 NM_018240 NM_018242 NM_018243 NM_018244 NM_018249 NM_018257 NM_018263 NM_018266 NM_018268 NM_018269 NM_018271 NM_018279 NM_018280 NM_018284 NM_018287 NM_018290 NM_018293 NM_018298 NM_018299 NM_018303 NM_018307 NM_018314 NM_018315 NM_018325 NM_018326 NM_018327 NM_018330 NM_018332 NM_018339 NM_018351 NM_018356 NM_018357 NM_018361 NM_018362 NM_018363 NM_018364 NM_018366 NM_018369 NM_018371 NM_018372 NM_018373 NM_018374 NM_018375 NM_018376 NM_018388 NM_018389 NM_018394 NM_018396 NM_018400 NM_018401 NM_018403 NM_018409 NM_018416 NM_018423 NM_018425 NM_018427 NM_018439 NM_018440 NM_018444 NM_018452 NM_018479 NM_018482 NM_018490 NM_018491 NM_018498 NM_018553 NM_018555 NM_018557 NM_018561 NM_018590 NM_018593 NM_018638 NM_018639 NM_018641 NM_018650 NM_018652 NM_018658 NM_018662 NM_018672 NM_018682 NM_018683 NM_018684 NM_018685 NM_018689 NM_018691 NM_018695 NM_018697 NM_018700 NM_018706 NM_018708 NM_018715 NM_018717 NM_018718 NM_018724 NM_018837 NM_018841 NM_018844 NM_018846 NM_018890 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018935 NM_018936 NM_018937 NM_018938 NM_018940 NM_018941 NM_018943 NM_018945 NM_018947 NM_018951 NM_018962 NM_018963 NM_018970 NM_018987 NM_018988 NM_018994 NM_018999 NM_019001 NM_019002 NM_019007 NM_019011 NM_019014 NM_019020 NM_019022 NM_019024 NM_019027 NM_019028 NM_019035 NM_019036 NM_019041 NM_019044 NM_019045 NM_019049 NM_019051 NM_019056 NM_019061 NM_019062 NM_019071 NM_019072 NM_019079 NM_019081 NM_019084 NM_019089 NM_019092 NM_019094 NM_019095 NM_019099 NM_019103 NM_019106 NM_019109 NM_019110 NM_019114 NM_019117 NM_019119 NM_019555 NM_019590 NM_019591 NM_019594 NM_019604 NM_019606 NM_019607 NM_019610 NM_019841 NM_019845 NM_019857 NM_019859 NM_019860 NM_019896 NM_019903 NM_020062 NM_020116 NM_020119 NM_020122 NM_020124 NM_020125 NM_020128 NM_020130 NM_020131 NM_020133 NM_020135 NM_020141 NM_020143 NM_020144 NM_020147 NM_020148 NM_020150 NM_020151 NM_020161 NM_020162 NM_020167 NM_020177 NM_020180 NM_020182 NM_020188 NM_020189 NM_020194 NM_020197 NM_020199 NM_020200 NM_020205 NM_020207 NM_020208 NM_020211 NM_020215 NM_020225 NM_020227 NM_020228 NM_020236 NM_020239 NM_020243 NM_020245 NM_020248 NM_020251 NM_020311 NM_020323 NM_020324 NM_020325 NM_020326 NM_020337 NM_020340 NM_020342 NM_020347 NM_020351 NM_020353 NM_020357 NM_020367 NM_020373 NM_020375 NM_020377 NM_020381 NM_020382 NM_020390 NM_020399 NM_020403 NM_020405 NM_020416 NM_020424 NM_020425 NM_020429 NM_020431 NM_020432 NM_020438 NM_020439 NM_020443 NM_020447 NM_020448 NM_020452 NM_020453 NM_020456 NM_020462 NM_020463 NM_020467 NM_020472 NM_020473 NM_020552 NM_020553 NM_020633 NM_020642 NM_020647 NM_020648 NM_020651 NM_020654 NM_020655 NM_020665 NM_020666 NM_020673 NM_020676 NM_020696 NM_020698 NM_020699 NM_020704 NM_020708 NM_020711 NM_020714 NM_020717 NM_020726 NM_020727 NM_020728 NM_020731 NM_020739 NM_020742 NM_020748 NM_020749 NM_020752 NM_020755 NM_020760 NM_020766 NM_020768 NM_020771 NM_020772 NM_020773 NM_020774 NM_020779 NM_020781 NM_020782 NM_020783 NM_020784 NM_020787 NM_020791 NM_020792 NM_020796 NM_020800 NM_020801 NM_020802 NM_020805 NM_020810 NM_020817 NM_020821 NM_020825 NM_020826 NM_020828 NM_020844 NM_020850 NM_020857 NM_020858 NM_020859 NM_020861 NM_020863 NM_020868 NM_020870 NM_020873 NM_020886 NM_020898 NM_020903 NM_020909 NM_020918 NM_020921 NM_020925 NM_020927 NM_020935 NM_020947 NM_020948 NM_020956 NM_020960 NM_020962 NM_020970 NM_020975 NM_020980 NM_020992 NM_021005 NM_021021 NM_021030 NM_021032 NM_021033 NM_021038 NM_021049 NM_021064 NM_021067 NM_021069 NM_021083 NM_021088 NM_021089 NM_021090 NM_021096 NM_021101 NM_021102 NM_021105 NM_021111 NM_021116 NM_021127 NM_021132 NM_021135 NM_021137 NM_021141 NM_021144 NM_021148 NM_021153 NM_021154 NM_021155 NM_021156 NM_021158 NM_021160 NM_021164 NM_021167 NM_021181 NM_021183 NM_021187 NM_021189 NM_021190 NM_021205 NM_021215 NM_021216 NM_021238 NM_021242 NM_021249 NM_021255 NM_021616 NM_021622 NM_021624 NM_021627 NM_021629 NM_021635 NM_021637 NM_021645 NM_021648 NM_021706 NM_021794 NM_021795 NM_021803 NM_021804 NM_021807 NM_021813 NM_021815 NM_021818 NM_021827 NM_021870 NM_021906 NM_021912 NM_021914 NM_021916 NM_021923 NM_021925 NM_021928 NM_021931 NM_021940 NM_021942 NM_021943 NM_021945 NM_021946 NM_021949 NM_021950 NM_021960 NM_021961 NM_021963 NM_021973 NM_021977 NM_021988 NM_022002 NM_022034 NM_022049 NM_022062 NM_022063 NM_022071 NM_022074 NM_022075 NM_022080 NM_022096 NM_022098 NM_022100 NM_022106 NM_022107 NM_022111 NM_022112 NM_022116 NM_022121 NM_022124 NM_022130 NM_022131 NM_022136 NM_022150 NM_022151 NM_022152 NM_022162 NM_022166 NM_022170 NM_022308 NM_022333 NM_022334 NM_022336 NM_022346 NM_022351 NM_022354 NM_022366 NM_022368 NM_022371 NM_022372 NM_022373 NM_022374 NM_022377 NM_022405 NM_022437 NM_022442 NM_022445 NM_022449 NM_022451 NM_022454 NM_022459 NM_022461 NM_022471 NM_022473 NM_022474 NM_022482 NM_022484 NM_022492 NM_022496 NM_022552 NM_022567 NM_022570 NM_022648 NM_022663 NM_022725 NM_022731 NM_022735 NM_022736 NM_022748 NM_022756 NM_022757 NM_022766 NM_022771 NM_022772 NM_022778 NM_022781 NM_022784 NM_022810 NM_022819 NM_022820 NM_022824 NM_022826 NM_022828 NM_022831 NM_022836 NM_022837 NM_022842 NM_022843 NM_022844 NM_022894 NM_022898 NM_022909 NM_022912 NM_022915 NM_022916 NM_022969 NM_022970 NM_022971 NM_022972 NM_022975 NM_022977 NM_023011 NM_023028 NM_023029 NM_023030 NM_023031 NM_023032 NM_023033 NM_023036 NM_023071 NM_023073 NM_023074 NM_023080 NM_023107 NM_023108 NM_023927 NM_023928 NM_023938 NM_024005 NM_024007 NM_024010 NM_024017 NM_024019 NM_024021 NM_024025 NM_024027 NM_024028 NM_024037 NM_024040 NM_024048 NM_024052 NM_024056 NM_024072 NM_024092 NM_024095 NM_024102 NM_024116 NM_024300 NM_024310 NM_024317 NM_024336 NM_024342 NM_024344 NM_024408 NM_024416 NM_024423 NM_024424 NM_024425 NM_024426 NM_024490 NM_024509 NM_024511 NM_024522 NM_024523 NM_024528 NM_024539 NM_024541 NM_024544 NM_024545 NM_024551 NM_024556 NM_024557 NM_024561 NM_024563 NM_024567 NM_024569 NM_024570 NM_024581 NM_024584 NM_024592 NM_024594 NM_024602 NM_024604 NM_024611 NM_024613 NM_024614 NM_024617 NM_024620 NM_024624 NM_024627 NM_024636 NM_024641 NM_024643 NM_024645 NM_024646 NM_024647 NM_024649 NM_024654 NM_024665 NM_024666 NM_024674 NM_024678 NM_024689 NM_024691 NM_024699 NM_024702 NM_024709 NM_024713 NM_024715 NM_024721 NM_024725 NM_024727 NM_024735 NM_024743 NM_024745 NM_024746 NM_024749 NM_024758 NM_024771 NM_024774 NM_024781 NM_024784 NM_024787 NM_024789 NM_024798 NM_024807 NM_024810 NM_024812 NM_024813 NM_024817 NM_024826 NM_024830 NM_024833 NM_024834 NM_024841 NM_024843 NM_024859 NM_024864 NM_024869 NM_024875 NM_024876 NM_024887 NM_024889 NM_024891 NM_024896 NM_024899 NM_024900 NM_024906 NM_024910 NM_024915 NM_024918 NM_024921 NM_024930 NM_024933 NM_024941 NM_024942 NM_024944 NM_024945 NM_024949 NM_024955 NM_024986 NM_024989 NM_024996 NM_024997 NM_025004 NM_025009 NM_025027 NM_025030 NM_025040 NM_025052 NM_025054 NM_025074 NM_025079 NM_025087 NM_025103 NM_025115 NM_025126 NM_025133 NM_025138 NM_025145 NM_025146 NM_025155 NM_025160 NM_025161 NM_025164 NM_025168 NM_025187 NM_025188 NM_025191 NM_025194 NM_025195 NM_025203 NM_025208 NM_025214 NM_025218 NM_025222 NM_025225 NM_025235 NM_025237 NM_025238 NM_025243 NM_025251 NM_030568 NM_030576 NM_030579 NM_030581 NM_030621 NM_030625 NM_030633 NM_030636 NM_030639 NM_030640 NM_030641 NM_030643 NM_030650 NM_030653 NM_030655 NM_030660 NM_030664 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030674 NM_030755 NM_030766 NM_030777 NM_030784 NM_030786 NM_030790 NM_030791 NM_030799 NM_030805 NM_030806 NM_030809 NM_030815 NM_030881 NM_030883 NM_030884 NM_030885 NM_030899 NM_030911 NM_030912 NM_030915 NM_030918 NM_030922 NM_030925 NM_030936 NM_030937 NM_030938 NM_030945 NM_030949 NM_030964 NM_031157 NM_031200 NM_031208 NM_031211 NM_031263 NM_031265 NM_031281 NM_031284 NM_031291 NM_031292 NM_031296 NM_031305 NM_031361 NM_031409 NM_031411 NM_031417 NM_031418 NM_031426 NM_031438 NM_031442 NM_031445 NM_031446 NM_031449 NM_031453 NM_031459 NM_031462 NM_031463 NM_031465 NM_031468 NM_031469 NM_031476 NM_031479 NM_031484 NM_031490 NM_031496 NM_031849 NM_031857 NM_031858 NM_031860 NM_031862 NM_031887 NM_031888 NM_031890 NM_031891 NM_031899 NM_031900 NM_031909 NM_031911 NM_031913 NM_031933 NM_031940 NM_031947 NM_031950 NM_031954 NM_031988 NM_031992 NM_032010 NM_032012 NM_032016 NM_032017 NM_032018 NM_032029 NM_032047 NM_032088 NM_032091 NM_032092 NM_032105 NM_032119 NM_032121 NM_032124 NM_032131 NM_032136 NM_032138 NM_032143 NM_032145 NM_032152 NM_032153 NM_032154 NM_032160 NM_032169 NM_032174 NM_032178 NM_032186 NM_032189 NM_032214 NM_032217 NM_032226 NM_032228 NM_032236 NM_032239 NM_032242 NM_032264 NM_032276 NM_032280 NM_032283 NM_032287 NM_032288 NM_032290 NM_032291 NM_032294 NM_032305 NM_032311 NM_032315 NM_032316 NM_032325 NM_032338 NM_032352 NM_032354 NM_032358 NM_032372 NM_032373 NM_032390 NM_032403 NM_032409 NM_032423 NM_032427 NM_032434 NM_032436 NM_032438 NM_032440 NM_032441 NM_032446 NM_032449 NM_032454 NM_032458 NM_032466 NM_032468 NM_032478 NM_032479 NM_032491 NM_032496 NM_032499 NM_032503 NM_032505 NM_032508 NM_032509 NM_032523 NM_032538 NM_032547 NM_032551 NM_032552 NM_032557 NM_032558 NM_032562 NM_032564 NM_032566 NM_032573 NM_032578 NM_032581 NM_032582 NM_032587 NM_032594 NM_032599 NM_032606 NM_032622 NM_032632 NM_032635 NM_032679 NM_032682 NM_032706 NM_032711 NM_032717 NM_032728 NM_032735 NM_032737 NM_032744 NM_032765 NM_032772 NM_032777 NM_032779 NM_032782 NM_032783 NM_032787 NM_032788 NM_032800 NM_032801 NM_032803 NM_032810 NM_032811 NM_032813 NM_032815 NM_032819 NM_032822 NM_032823 NM_032824 NM_032826 NM_032832 NM_032833 NM_032834 NM_032837 NM_032838 NM_032842 NM_032854 NM_032859 NM_032864 NM_032866 NM_032867 NM_032869 NM_032870 NM_032871 NM_032873 NM_032884 NM_032886 NM_032892 NM_032895 NM_032900 NM_032901 NM_032905 NM_032910 NM_032916 NM_032918 NM_032927 NM_032932 NM_032965 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032978 NM_032979 NM_032980 NM_032981 NM_032985 NM_032986 NM_032988 NM_032991 NM_032998 NM_033011 NM_033013 NM_033014 NM_033017 NM_033034 NM_033035 NM_033051 NM_033052 NM_033055 NM_033060 NM_033083 NM_033088 NM_033089 NM_033091 NM_033093 NM_033100 NM_033103 NM_033107 NM_033111 NM_033127 NM_033135 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033143 NM_033150 NM_033157 NM_033161 NM_033167 NM_033168 NM_033182 NM_033195 NM_033198 NM_033207 NM_033210 NM_033211 NM_033212 NM_033221 NM_033224 NM_033238 NM_033240 NM_033245 NM_033246 NM_033261 NM_033274 NM_033281 NM_033288 NM_033316 NM_033323 NM_033326 NM_033331 NM_033332 NM_033337 NM_033343 NM_033346 NM_033355 NM_033356 NM_033357 NM_033360 NM_033389 NM_033393 NM_033394 NM_033397 NM_033405 NM_033406 NM_033409 NM_033412 NM_033425 NM_033426 NM_033428 NM_033429 NM_033430 NM_033437 NM_033446 NM_033480 NM_033481 NM_033505 NM_033515 NM_033543 NM_033548 NM_033551 NM_033624 NM_033626 NM_033631 NM_033632 NM_033637 NM_033642 NM_033644 NM_033645 NM_033656 NM_033666 NM_044472 NM_052811 NM_052816 NM_052821 NM_052822 NM_052832 NM_052837 NM_052845 NM_052848 NM_052849 NM_052864 NM_052879 NM_052885 NM_052886 NM_052896 NM_052905 NM_052910 NM_052911 NM_052917 NM_052932 NM_052934 NM_052937 NM_052953 NM_052954 NM_052956 NM_052959 NM_052962 NM_052964 NM_052965 NM_052968 NM_052970 NM_052995 NM_052996 NM_053017 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053035 NM_053042 NM_053044 NM_053045 NM_053053 NM_053056 NM_053281 NM_054016 NM_054114 NM_057090 NM_057091 NM_057095 NM_057096 NM_057158 NM_057159 NM_057160 NM_057164 NM_057165 NM_057166 NM_057167 NM_057169 NM_057170 NM_057175 NM_057177 NM_057735 NM_057749 NM_058163 NM_058167 NM_058168 NM_058169 NM_058170 NM_058172 NM_058179 NM_058183 NM_058184 NM_058217 NM_058237 NM_058241 NM_058244 NM_058246 NM_078470 NM_078473 NM_078476 NM_078483 NM_078487 NM_078628 NM_078629 NM_078630 NM_080282 NM_080387 NM_080415 NM_080417 NM_080473 NM_080491 NM_080546 NM_080588 NM_080591 NM_080597 NM_080626 NM_080628 NM_080645 NM_080657 NM_080666 NM_080668 NM_080670 NM_080676 NM_080679 NM_080680 NM_080681 NM_080687 NM_080717 NM_080723 NM_080725 NM_080733 NM_080734 NM_080735 NM_080738 NM_080748 NM_080759 NM_080760 NM_080828 NM_080829 NM_080840 NM_080841 NM_080860 NM_080867 NM_080872 NM_080876 NM_080911 NM_080915 NM_080927 NM_130387 NM_130389 NM_130391 NM_130392 NM_130393 NM_130395 NM_130435 NM_130446 NM_130459 NM_130465 NM_130781 NM_130782 NM_130783 NM_130788 NM_130792 NM_130798 NM_130809 NM_130830 NM_130838 NM_130839 NM_130844 NM_130847 NM_130848 NM_130896 NM_133170 NM_133265 NM_133268 NM_133326 NM_133332 NM_133333 NM_133334 NM_133337 NM_133338 NM_133339 NM_133340 NM_133341 NM_133342 NM_133343 NM_133344 NM_133367 NM_133371 NM_133372 NM_133378 NM_133432 NM_133437 NM_133443 NM_133448 NM_133450 NM_133459 NM_133462 NM_133463 NM_133466 NM_133468 NM_133474 NM_133477 NM_133482 NM_133494 NM_133496 NM_133509 NM_133631 NM_133640 NM_133642 NM_133645 NM_133646 NM_134264 NM_134265 NM_134433 NM_134434 NM_134442 NM_134470 NM_138270 NM_138271 NM_138280 NM_138284 NM_138287 NM_138290 NM_138293 NM_138294 NM_138300 NM_138316 NM_138319 NM_138323 NM_138324 NM_138325 NM_138333 NM_138335 NM_138344 NM_138346 NM_138362 NM_138384 NM_138395 NM_138400 NM_138402 NM_138413 NM_138415 NM_138417 NM_138423 NM_138444 NM_138459 NM_138463 NM_138467 NM_138471 NM_138473 NM_138477 NM_138479 NM_138551 NM_138554 NM_138556 NM_138557 NM_138566 NM_138571 NM_138576 NM_138578 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138638 NM_138640 NM_138694 NM_138699 NM_138713 NM_138714 NM_138715 NM_138716 NM_138722 NM_138723 NM_138724 NM_138726 NM_138733 NM_138735 NM_138771 NM_138773 NM_138774 NM_138775 NM_138778 NM_138782 NM_138788 NM_138809 NM_138814 NM_138820 NM_138925 NM_138926 NM_138927 NM_138958 NM_138959 NM_138969 NM_138970 NM_138971 NM_138972 NM_138973 NM_138983 NM_138991 NM_138992 NM_138995 NM_138999 NM_139004 NM_139012 NM_139014 NM_139015 NM_139125 NM_139136 NM_139168 NM_139169 NM_139179 NM_139201 NM_139244 NM_139249 NM_139267 NM_139275 NM_139280 NM_139283 NM_139312 NM_139319 NM_139321 NM_139323 NM_144498 NM_144578 NM_144586 NM_144599 NM_144602 NM_144607 NM_144609 NM_144632 NM_144635 NM_144636 NM_144646 NM_144649 NM_144657 NM_144658 NM_144664 NM_144669 NM_144682 NM_144690 NM_144692 NM_144693 NM_144718 NM_144721 NM_144723 NM_144724 NM_144766 NM_144767 NM_144770 NM_144778 NM_144949 NM_144966 NM_144968 NM_144970 NM_144976 NM_144977 NM_144982 NM_144991 NM_144992 NM_144995 NM_145013 NM_145015 NM_145018 NM_145021 NM_145037 NM_145048 NM_145055 NM_145060 NM_145061 NM_145063 NM_145102 NM_145117 NM_145119 NM_145159 NM_145167 NM_145177 NM_145179 NM_145187 NM_145188 NM_145189 NM_145190 NM_145212 NM_145214 NM_145234 NM_145241 NM_145250 NM_145251 NM_145257 NM_145276 NM_145278 NM_145279 NM_145282 NM_145283 NM_145284 NM_145286 NM_145295 NM_145298 NM_145307 NM_145311 NM_145314 NM_145328 NM_145330 NM_145341 NM_145342 NM_145646 NM_145648 NM_145650 NM_145660 NM_145693 NM_145719 NM_145728 NM_145735 NM_145739 NM_145753 NM_145755 NM_145756 NM_145759 NM_145794 NM_145800 NM_145802 NM_145803 NM_145805 NM_145809 NM_145818 NM_145858 NM_145861 NM_145868 NM_145869 NM_145891 NM_145892 NM_145893 NM_145906 NM_145909 NM_147129 NM_147147 NM_147152 NM_147174 NM_147175 NM_147180 NM_147187 NM_147194 NM_147780 NM_147781 NM_147782 NM_147783 NM_148842 NM_148894 NM_148920 NM_148921 NM_148957 NM_148960 NM_148975 NM_148976 NM_148977 NM_148978 NM_152133 NM_152222 NM_152233 NM_152235 NM_152259 NM_152261 NM_152262 NM_152265 NM_152267 NM_152268 NM_152272 NM_152274 NM_152278 NM_152281 NM_152282 NM_152291 NM_152292 NM_152298 NM_152301 NM_152304 NM_152316 NM_152317 NM_152322 NM_152330 NM_152332 NM_152334 NM_152336 NM_152365 NM_152367 NM_152372 NM_152373 NM_152376 NM_152380 NM_152384 NM_152387 NM_152388 NM_152390 NM_152395 NM_152400 NM_152403 NM_152405 NM_152406 NM_152407 NM_152409 NM_152418 NM_152422 NM_152423 NM_152429 NM_152437 NM_152440 NM_152443 NM_152447 NM_152450 NM_152451 NM_152454 NM_152462 NM_152470 NM_152476 NM_152480 NM_152483 NM_152484 NM_152485 NM_152487 NM_152488 NM_152506 NM_152510 NM_152517 NM_152519 NM_152527 NM_152531 NM_152548 NM_152551 NM_152554 NM_152556 NM_152562 NM_152563 NM_152578 NM_152583 NM_152588 NM_152594 NM_152595 NM_152597 NM_152607 NM_152615 NM_152624 NM_152628 NM_152636 NM_152665 NM_152667 NM_152675 NM_152677 NM_152680 NM_152682 NM_152686 NM_152689 NM_152692 NM_152704 NM_152722 NM_152724 NM_152729 NM_152731 NM_152735 NM_152737 NM_152750 NM_152753 NM_152765 NM_152774 NM_152776 NM_152785 NM_152787 NM_152789 NM_152791 NM_152793 NM_152795 NM_152827 NM_152828 NM_152831 NM_152834 NM_152838 NM_152842 NM_152851 NM_152852 NM_152866 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152878 NM_152879 NM_152891 NM_152903 NM_152933 NM_152934 NM_152939 NM_152942 NM_152943 NM_152945 NM_152990 NM_152999 NM_153000 NM_153023 NM_153025 NM_153026 NM_153027 NM_153028 NM_153029 NM_153032 NM_153034 NM_153035 NM_153041 NM_153042 NM_153050 NM_153051 NM_153182 NM_153184 NM_153186 NM_153207 NM_153208 NM_153218 NM_153229 NM_153234 NM_153235 NM_153240 NM_153246 NM_153256 NM_153257 NM_153270 NM_153292 NM_153328 NM_153332 NM_153335 NM_153337 NM_153340 NM_153342 NM_153346 NM_153347 NM_153354 NM_153355 NM_153358 NM_153362 NM_153365 NM_153367 NM_153380 NM_153381 NM_153442 NM_153456 NM_153464 NM_153487 NM_153499 NM_153500 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153620 NM_153646 NM_153647 NM_153648 NM_153683 NM_153689 NM_153693 NM_153705 NM_153708 NM_153711 NM_153712 NM_153714 NM_153715 NM_153748 NM_153756 NM_153758 NM_153759 NM_153764 NM_153765 NM_153766 NM_153767 NM_153810 NM_153826 NM_153836 NM_156036 NM_170601 NM_170607 NM_170679 NM_170686 NM_170696 NM_170697 NM_170706 NM_170716 NM_170717 NM_170719 NM_170721 NM_170726 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170781 NM_171825 NM_172003 NM_172020 NM_172024 NM_172037 NM_172069 NM_172070 NM_172098 NM_172110 NM_172111 NM_172112 NM_172113 NM_172127 NM_172128 NM_172130 NM_172159 NM_172160 NM_172164 NM_172177 NM_172178 NM_172193 NM_172201 NM_172206 NM_172217 NM_172226 NM_172232 NM_172239 NM_172240 NM_172241 NM_172318 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172364 NM_172376 NM_172387 NM_172388 NM_172389 NM_173054 NM_173060 NM_173076 NM_173078 NM_173080 NM_173082 NM_173087 NM_173088 NM_173089 NM_173090 NM_173163 NM_173165 NM_173171 NM_173172 NM_173173 NM_173198 NM_173200 NM_173213 NM_173214 NM_173355 NM_173362 NM_173463 NM_173465 NM_173468 NM_173470 NM_173476 NM_173477 NM_173478 NM_173484 NM_173491 NM_173500 NM_173509 NM_173510 NM_173511 NM_173523 NM_173528 NM_173531 NM_173532 NM_173536 NM_173537 NM_173538 NM_173545 NM_173551 NM_173552 NM_173553 NM_173559 NM_173561 NM_173570 NM_173579 NM_173580 NM_173582 NM_173599 NM_173607 NM_173609 NM_173610 NM_173611 NM_173622 NM_173625 NM_173630 NM_173631 NM_173632 NM_173638 NM_173639 NM_173640 NM_173643 NM_173644 NM_173646 NM_173651 NM_173652 NM_173654 NM_173657 NM_173659 NM_173667 NM_173669 NM_173673 NM_173675 NM_173677 NM_173694 NM_173700 NM_173701 NM_173798 NM_173799 NM_173805 NM_173807 NM_173808 NM_173812 NM_173822 NM_173826 NM_173827 NM_173830 NM_173833 NM_173841 NM_173842 NM_173843 NM_173844 NM_173851 NM_173854 NM_174871 NM_174878 NM_174890 NM_174901 NM_174911 NM_174917 NM_174929 NM_174938 NM_174950 NM_175056 NM_175077 NM_175078 NM_175085 NM_175569 NM_175571 NM_175619 NM_175629 NM_175630 NM_175733 NM_175736 NM_175744 NM_175745 NM_175859 NM_175873 NM_175876 NM_175892 NM_175907 NM_175920 NM_175921 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176787 NM_176806 NM_176814 NM_176825 NM_176863 NM_176871 NM_176874 NM_177401 NM_177434 NM_177438 NM_177439 NM_177442 NM_177452 NM_177453 NM_177454 NM_177524 NM_177525 NM_177532 NM_177550 NM_177553 NM_177947 NM_177948 NM_177949 NM_177951 NM_177972 NM_177974 NM_177995 NM_177996 NM_178026 NM_178034 NM_178136 NM_178151 NM_178152 NM_178153 NM_178172 NM_178173 NM_178326 NM_178338 NM_178342 NM_178424 NM_178426 NM_178427 NM_178454 NM_178466 NM_178470 NM_178496 NM_178505 NM_178509 NM_178514 NM_178516 NM_178518 NM_178520 NM_178539 NM_178549 NM_178550 NM_178558 NM_178566 NM_178582 NM_178585 NM_178586 NM_178812 NM_178815 NM_178816 NM_178818 NM_178820 NM_178830 NM_178831 NM_178832 NM_178839 NM_178842 NM_180989 NM_180991 NM_181041 NM_181054 NM_181076 NM_181077 NM_181291 NM_181309 NM_181310 NM_181314 NM_181332 NM_181340 NM_181341 NM_181349 NM_181354 NM_181356 NM_181359 NM_181361 NM_181427 NM_181435 NM_181443 NM_181457 NM_181458 NM_181459 NM_181460 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181491 NM_181501 NM_181504 NM_181510 NM_181519 NM_181523 NM_181524 NM_181531 NM_181533 NM_181552 NM_181571 NM_181659 NM_181701 NM_181705 NM_181706 NM_181713 NM_181714 NM_181717 NM_181720 NM_181723 NM_181725 NM_181740 NM_181746 NM_181762 NM_181774 NM_181776 NM_181777 NM_181782 NM_181784 NM_181787 NM_181789 NM_181807 NM_181814 NM_181836 NM_181838 NM_181839 NM_181844 NM_181847 NM_181870 NM_181871 NM_181874 NM_181876 NM_181877 NM_181897 NM_182314 NM_182485 NM_182487 NM_182493 NM_182502 NM_182503 NM_182511 NM_182518 NM_182526 NM_182533 NM_182537 NM_182540 NM_182562 NM_182568 NM_182578 NM_182580 NM_182583 NM_182597 NM_182606 NM_182610 NM_182612 NM_182615 NM_182626 NM_182631 NM_182637 NM_182638 NM_182646 NM_182647 NM_182648 NM_182661 NM_182688 NM_182701 NM_182703 NM_182715 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182734 NM_182752 NM_182757 NM_182759 NM_182760 NM_182763 NM_182769 NM_182770 NM_182771 NM_182772 NM_182775 NM_182779 NM_182797 NM_182798 NM_182799 NM_182801 NM_182810 NM_182812 NM_182832 NM_182850 NM_182853 NM_182898 NM_182899 NM_182906 NM_182915 NM_182916 NM_182918 NM_182920 NM_182922 NM_182931 NM_182943 NM_182948 NM_182964 NM_182970 NM_182975 NM_183004 NM_183011 NM_183012 NM_183013 NM_183043 NM_183044 NM_183047 NM_183048 NM_183050 NM_183059 NM_183060 NM_183063 NM_183065 NM_183075 NM_183078 NM_183227 NM_183238 NM_183372 NM_183376 NM_183377 NM_183381 NM_183382 NM_183383 NM_183384 NM_183387 NM_183412 NM_183413 NM_183416 NM_183418 NM_183420 NM_183421 NM_184042 NM_194259 NM_194260 NM_194261 NM_194271 NM_194277 NM_194278 NM_194283 NM_194284 NM_194285 NM_194286 NM_194287 NM_194289 NM_194292 NM_194294 NM_194298 NM_194299 NM_194309 NM_194310 NM_194315 NM_194316 NM_194317 NM_194318 NM_194327 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194428 NM_194430 NM_194431 NM_194434 NM_194435 NM_194442 NM_194454 NM_194455 NM_194456 NM_194457 NM_194458 NM_194463 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197954 NM_197966 NM_197967 NM_197968 NM_197972 NM_197977 NM_198057 NM_198061 NM_198066 NM_198074 NM_198080 NM_198081 NM_198087 NM_198088 NM_198098 NM_198120 NM_198128 NM_198151 NM_198154 NM_198156 NM_198158 NM_198159 NM_198177 NM_198178 NM_198181 NM_198194 NM_198204 NM_198205 NM_198212 NM_198215 NM_198217 NM_198218 NM_198219 NM_198256 NM_198257 NM_198258 NM_198266 NM_198270 NM_198271 NM_198275 NM_198279 NM_198281 NM_198312 NM_198320 NM_198321 NM_198324 NM_198325 NM_198330 NM_198336 NM_198337 NM_198353 NM_198381 NM_198391 NM_198392 NM_198394 NM_198400 NM_198431 NM_198433 NM_198434 NM_198435 NM_198436 NM_198437 NM_198441 NM_198442 NM_198449 NM_198451 NM_198459 NM_198461 NM_198465 NM_198474 NM_198477 NM_198480 NM_198484 NM_198485 NM_198488 NM_198490 NM_198491 NM_198496 NM_198499 NM_198502 NM_198506 NM_198511 NM_198530 NM_198531 NM_198542 NM_198555 NM_198576 NM_198581 NM_198589 NM_198590 NM_198591 NM_198596 NM_198686 NM_198715 NM_198795 NM_198798 NM_198799 NM_198829 NM_198833 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198841 NM_198845 NM_198846 NM_198847 NM_198853 NM_198855 NM_198859 NM_198880 NM_198881 NM_198887 NM_198889 NM_198893 NM_198896 NM_198900 NM_198901 NM_198920 NM_198924 NM_198926 NM_198935 NM_198945 NM_198965 NM_198966 NM_198968 NM_198974 NM_198989 NM_198991 NM_198993 NM_199000 NM_199040 NM_199044 NM_199050 NM_199053 NM_199072 NM_199138 NM_199144 NM_199167 NM_199169 NM_199170 NM_199171 NM_199176 NM_199177 NM_199182 NM_199186 NM_199188 NM_199190 NM_199191 NM_199192 NM_199193 NM_199194 NM_199203 NM_199206 NM_199235 NM_199245 NM_199294 NM_199295 NM_199324 NM_199327 NM_199328 NM_199329 NM_199335 NM_199343 NM_199348 NM_199421 NM_199423 NM_199424 NM_199436 NM_199437 NM_199438 NM_199439 NM_199443 NM_199451 NM_199452 NM_199453 NM_199462 NM_199478 NM_199482 NM_199487 NM_199511 NM_199512 NM_199513 NM_201252 NM_201263 NM_201269 NM_201274 NM_201277 NM_201278 NM_201281 NM_201348 NM_201399 NM_201403 NM_201428 NM_201429 NM_201430 NM_201431 NM_201432 NM_201433 NM_201444 NM_201445 NM_201453 NM_201520 NM_201543 NM_201544 NM_201545 NM_201548 NM_201554 NM_201555 NM_201556 NM_201557 NM_201570 NM_201571 NM_201572 NM_201590 NM_201591 NM_201592 NM_201593 NM_201596 NM_201597 NM_201613 NM_201624 NM_201632 NM_201634 NM_201648 NM_203281 NM_203282 NM_203287 NM_203288 NM_203305 NM_203306 NM_203307 NM_203308 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203342 NM_203343 NM_203350 NM_203354 NM_203355 NM_203356 NM_203357 NM_203364 NM_203381 NM_203382 NM_203394 NM_203395 NM_203399 NM_203401 NM_203403 NM_203406 NM_203413 NM_203428 NM_203429 NM_203436 NM_203438 NM_203439 NM_203440 NM_203441 NM_203446 NM_203448 NM_203451 NM_203452 NM_203453 NM_203454 NM_203459 NM_203462 NM_203463 NM_203464 NM_203487 NM_203497 NM_203504 NM_203505 NM_203506 NM_205768 NM_205833 NM_205855 NM_205857 NM_205860 NM_205861 NM_206594 NM_206595 NM_206834 NM_206853 NM_206854 NM_206855 NM_206866 NM_206876 NM_206877 NM_206887 NM_206909 NM_206910 NM_206911 NM_206933 NM_206937 NM_206962 NM_206963 NM_206966 NM_207003 NM_207006 NM_207009 NM_207012 NM_207032 NM_207033 NM_207034 NM_207043 NM_207044 NM_207047 NM_207106 NM_207111 NM_207116 NM_207119 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207318 NM_207320 NM_207330 NM_207332 NM_207333 NM_207334 NM_207343 NM_207344 NM_207357 NM_207359 NM_207366 NM_207371 NM_207373 NM_207380 NM_207383 NM_207388 NM_207390 NM_207404 NM_207411 NM_207412 NM_207418 NM_207419 NM_207422 NM_207428 NM_207430 NM_207438 NM_207440 NM_207446 NM_207448 NM_207451 NM_207453 NM_207454 NM_207460 NM_207467 NM_207469 NM_207481 NM_207482 NM_207483 NM_207485 NM_207491 NM_207498 NM_207499 NM_207500 NM_207503 NM_207504 NM_207505 NM_207506 NM_207507 NM_207513 NM_207517 NM_207577 NM_207578 NM_207581 NM_207645 NM_207646 NM_207647 NM_212464 NM_212465 NM_212467 NM_212471 NM_212472 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212540 NM_212555 NM_212556 NM_212559 NM_213568 NM_213589 NM_213590 NM_213593 NM_213594 NM_213604 NM_213609 NM_213611 NM_213612 NM_213645 NM_213646 NM_213648 NM_213654 NM_213657 NM_213658 XM_017374 XM_027236 XM_027307 XM_028217 XM_028810 XM_029101 XM_031553 XM_032571 XM_032901 XM_032945 XM_032996 XM_034274 XM_034872 XM_035299 XM_036936 XM_036942 XM_037523 XM_037557 XM_039515 XM_039570 XM_039627 XM_039676 XM_039908 XM_042301 XM_042698 XM_042833 XM_042936 XM_043493 XM_044062 XM_044178 XM_044434 XM_045290 XM_046264 XM_046581 XM_047355 XM_047550 XM_047554 XM_048128 XM_049078 XM_051081 XM_051200 XM_051264 XM_055636 XM_057107 XM_057296 XM_058720 XM_059929 XM_064190 XM_067585 XM_085831 XM_086360 XM_087225 XM_087490 XM_091331 XM_095991 XM_096688 XM_097792 XM_113743 XM_113763 XM_113947 XM_114303 XM_114415 XM_117030 XM_117117 XM_117294 XM_166132 XM_167044 XM_167152 XM_167275 XM_168530 XM_172889 XM_173120 XM_208200 XM_208204 XM_208319 XM_208320 XM_208333 XM_208373 XM_208438 XM_208835 XM_208990 XM_209155 XM_209163 XM_209227 XM_209363 XM_209569 XM_209607 XM_209668 XM_209824 XM_210860 XM_211529 XM_290401 XM_290546 XM_290597 XM_290615 XM_290629 XM_290737 XM_290811 XM_290835 XM_290948 XM_291019 XM_291028 XM_291075 XM_291095 XM_291128 XM_291204 XM_291262 XM_291625 XM_291729 XM_292029 XM_292357 XM_292717 XM_292785 XM_293398 XM_293828 XM_294521 XM_294765 XM_294775 XM_295155 XM_298151 XM_350880 XM_351723 XM_353628 XM_370649 XM_370654 XM_370664 XM_370692 XM_370756 XM_370837 XM_370838 XM_370839 XM_370840 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_370982 XM_371009 XM_371074 XM_371082 XM_371116 XM_371117 XM_371132 XM_371184 XM_371204 XM_371230 XM_371302 XM_371304 XM_371312 XM_371359 XM_371369 XM_371374 XM_371399 XM_371429 XM_371461 XM_371486 XM_371488 XM_371501 XM_371575 XM_371592 XM_371664 XM_371754 XM_371760 XM_371770 XM_371783 XM_371801 XM_371820 XM_371891 XM_372004 XM_372039 XM_372040 XM_372042 XM_372050 XM_372090 XM_372117 XM_372118 XM_372198 XM_372205 XM_372227 XM_372584 XM_373030 XM_373451 XM_373509 XM_373513 XM_373561 XM_373600 XM_373616 XM_373633 XM_373682 XM_373684 XM_373690 XM_373742 XM_373744 XM_373748 XM_373765 XM_373786 XM_373802 XM_373850 XM_373883 XM_373886 XM_373906 XM_373950 XM_373952 XM_373970 XM_374013 XM_374091 XM_374101 XM_374162 XM_374249 XM_374260 XM_374270 XM_374297 XM_374317 XM_374326 XM_374341 XM_374399 XM_374414 XM_374422 XM_374437 XM_374484 XM_374529 XM_374589 XM_374765 XM_374766 XM_374803 XM_374983 XM_375018 XM_375065 XM_375099 XM_375152 XM_375272 XM_375292 XM_375307 XM_375353 XM_375357 XM_375430 XM_375443 XM_375449 XM_375491 XM_375558 XM_375602 XM_375629 XM_375646 XM_375669 XM_375697 XM_375698 XM_375713 XM_375747 XM_375821 XM_375853 XM_375912 XM_375928 XM_376018 XM_376049 XM_376062 XM_376148 XM_376212 XM_376241 XM_376278 XM_376318 XM_376386 XM_376412 XM_376423 XM_376454 XM_376550 XM_376586 XM_376587 XM_376602 XM_376607 XM_376679 XM_376680 XM_376720 XM_376727 XM_376783 XM_376784 XM_376822 XM_376843 XM_376902 XM_376905 XM_377002 XM_377028 XM_377076 XM_377476 XM_377742 XM_378202 XM_378238 XM_378250 XM_378259 XM_378273 XM_378309 XM_378316 XM_378321 XM_378327 XM_378329 XM_378350 XM_378362 XM_378372 XM_378379 XM_378389 XM_378390 XM_378394 XM_378399 XM_378434 XM_378453 XM_378456 XM_378460 XM_378487 XM_378507 XM_378511 XM_378512 XM_378516 XM_378517 XM_378523 XM_378545 XM_378567 XM_378573 XM_378589 XM_378590 XM_378650 XM_378653 XM_378678 XM_378684 XM_378700 XM_378705 XM_378746 XM_378747 XM_378750 XM_378753 XM_378757 XM_378760 XM_378763 XM_378786 XM_378787 XM_378793 XM_378807 XM_378842 XM_378843 XM_378874 XM_378876 XM_378886 XM_378914 XM_378925 XM_378946 XM_378947 XM_378964 XM_378973 XM_378993 XM_379030 XM_379060 XM_379068 XM_379069 XM_379074 XM_379079 XM_379108 XM_379114 XM_379121 XM_379123 XM_379135 XM_379136 XM_379141 XM_379156 XM_379207 XM_379210 XM_379214 XM_379215 XM_379231 XM_379234 XM_379260 XM_379263 XM_379267 XM_379276 XM_379288 XM_379309 XM_379318 XM_379320 XM_379321 XM_379324 XM_379371 XM_379373 XM_379381 XM_379398 XM_379402 XM_379403 XM_379406 XM_379409 XM_379417 XM_379424 XM_379432 XM_379434 XM_379454 XM_379456 XM_379458 XM_379474 XM_379476 XM_379482 XM_379483 XM_379485 XM_379498 XM_379507 XM_379510 XM_379530 XM_379547 XM_379584 XM_379594 XM_379595 XM_379597 XM_379608 XM_379619 XM_379623 XM_379632 XM_379634 XM_379635 XM_379643 XM_379651 XM_379660 XM_379664 XM_379665 XM_379696 XM_379705 XM_379717 XM_379798 XM_379809 XM_379820 XM_379827 XM_379877 XM_379885 XM_379933 XM_379934 XM_379967 XM_379979 XM_380089 XM_380091 XM_380098 XM_380099 XM_380104 XM_380117 XM_380128 XM_380131 XM_380154 XM_495795 XM_495798 XM_495807 XM_495814 XM_495844 XM_495868 XM_495881 XM_495886 XM_495902 XM_495908 XM_495909 XM_495950 XM_495961 XM_495982 XM_496041 XM_496044 XM_496048 XM_496050 XM_496054 XM_496056 XM_496061 XM_496070 XM_496076 XM_496081 XM_496088 XM_496093 XM_496096 XM_496103 XM_496145 XM_496156 XM_496158 XM_496273 XM_496328 XM_496341 XM_496343 XM_496346 XM_496351 XM_496358 XM_496394 XM_496401 XM_496408 XM_496434 XM_496436 XM_496467 XM_496515 XM_496547 XM_496549 XM_496584 XM_496603 XM_496608 XM_496610 XM_496622 XM_496637 XM_496661 XM_496664 XM_496688 XM_496701 XM_496713 XM_496777 XM_496826 XM_496879 XM_496895 XM_496907 XM_496959 XM_496966 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497012 XM_497134 XM_497209 XM_498436 XM_498437 XM_498440 XM_498442 XM_498449 XM_498454 XM_498463 XM_498464 XM_498465 XM_498467 XM_498469 XM_498473 XM_498481 XM_498507 XM_498508 XM_498513 XM_498532 XM_498535 XM_498540 XM_498545 XM_498554 XM_498557 XM_498563 XM_498569 XM_498572 XM_498578 XM_498587 XM_498596 XM_498597 XM_498601 XM_498614 XM_498620 XM_498623 XM_498629 XM_498646 XM_498651 XM_498660 XM_498671 XM_498724 XM_498736 XM_498737 XM_498750 XM_498759 XM_498777 XM_498782 XM_498825 XM_498826 XM_498828 XM_498856 XM_498878 XM_498883 XM_498884 XM_498901 XM_498905 XM_498912 XM_498924 XM_498925 XM_498928 XM_498929 XM_498946 XM_498948 XM_498954 XM_498957 XM_498961 XM_498981 XM_498989 XM_498991 XM_499008 XM_499014 XM_499038 XM_499047 XM_499051 XM_499070 XM_499072 XM_499074 XM_499101 XM_499107 XM_499117 XM_499121 XM_499123 XM_499125 XM_499131 XM_499147 XM_499148 XM_499149 XM_499152 XM_499164 XM_499170 XM_499272 XM_499276 XM_499298 XM_499309 XM_499323 XM_499343 XM_499366 XM_499502 XM_499523 XM_499525 XM_499528 XM_499566 XM_499570 XM_499572 XM_499579 XM_499583 XM_499590 XM_499593 XM_499594 XM_499595 XM_499597 XM_499602 XR_000192 XR_000195 XR_000216 XR_000227 XR_000261 XR_000292 XR_000293
Genes with multiple seed matches:
NM_000043 NM_000046 NM_000071 NM_000104 NM_000110 NM_000112 NM_000114 NM_000125 NM_000139 NM_000176 NM_000220 NM_000233 NM_000246 NM_000248 NM_000266 NM_000272 NM_000297 NM_000298 NM_000299 NM_000322 NM_000330 NM_000332 NM_000337 NM_000351 NM_000368 NM_000370 NM_000411 NM_000439 NM_000462 NM_000510 NM_000533 NM_000551 NM_000555 NM_000579 NM_000600 NM_000611 NM_000618 NM_000629 NM_000690 NM_000693 NM_000720 NM_000724 NM_000775 NM_000800 NM_000809 NM_000860 NM_000861 NM_000868 NM_000885 NM_000899 NM_000917 NM_000945 NM_000962 NM_000963 NM_000997 NM_001001394 NM_001001419 NM_001001420 NM_001001481 NM_001001482 NM_001001557 NM_001001662 NM_001001688 NM_001001698 NM_001001709 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001001974 NM_001002026 NM_001002260 NM_001002269 NM_001002762 NM_001002811 NM_001002812 NM_001002881 NM_001002924 NM_001003406 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003807 NM_001004054 NM_001004306 NM_001004322 NM_001004328 NM_001004349 NM_001005337 NM_001005353 NM_001005359 NM_001005364 NM_001005388 NM_001005473 NM_001005502 NM_001005737 NM_001005739 NM_001005766 NM_001005845 NM_001006656 NM_001007088 NM_001007097 NM_001007102 NM_001007237 NM_001007278 NM_001007559 NM_001007565 NM_001008215 NM_001008224 NM_001008396 NM_001008405 NM_001008411 NM_001008491 NM_001008492 NM_001008493 NM_001008529 NM_001008726 NM_001008745 NM_001008781 NM_001008925 NM_001009185 NM_001009883 NM_001009909 NM_001009913 NM_001009922 NM_001009954 NM_001010846 NM_001010861 NM_001010864 NM_001010867 NM_001010879 NM_001010883 NM_001010888 NM_001010891 NM_001010913 NM_001010984 NM_001010986 NM_001011514 NM_001011539 NM_001011708 NM_001011713 NM_001011885 NM_001012270 NM_001012271 NM_001012279 NM_001012339 NM_001012393 NM_001012511 NM_001012651 NM_001012729 NM_001012733 NM_001012734 NM_001012754 NM_001012761 NM_001012968 NM_001012981 NM_001013649 NM_001013666 NM_001013688 NM_001013690 NM_001013717 NM_001013719 NM_001013726 NM_001014373 NM_001014797 NM_001015045 NM_001015048 NM_001015049 NM_001015880 NM_001017370 NM_001017396 NM_001017408 NM_001017423 NM_001017962 NM_001017972 NM_001017975 NM_001017980 NM_001017995 NM_001018058 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018080 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018111 NM_001023563 NM_001024094 NM_001024372 NM_001024596 NM_001024631 NM_001024649 NM_001024657 NM_001024680 NM_001024843 NM_001024912 NM_001025076 NM_001025077 NM_001025108 NM_001025247 NM_001049 NM_001066 NM_001080 NM_001083 NM_001114 NM_001128 NM_001144 NM_001167 NM_001168 NM_001174 NM_001186 NM_001191 NM_001204 NM_001245 NM_001259 NM_001271 NM_001304 NM_001315 NM_001340 NM_001349 NM_001351 NM_001356 NM_001376 NM_001387 NM_001394 NM_001427 NM_001431 NM_001438 NM_001457 NM_001463 NM_001542 NM_001543 NM_001556 NM_001609 NM_001624 NM_001627 NM_001664 NM_001690 NM_001712 NM_001731 NM_001746 NM_001759 NM_001791 NM_001806 NM_001821 NM_001838 NM_001874 NM_001885 NM_001941 NM_001966 NM_001969 NM_002009 NM_002015 NM_002024 NM_002025 NM_002033 NM_002076 NM_002077 NM_002130 NM_002158 NM_002182 NM_002210 NM_002243 NM_002251 NM_002285 NM_002296 NM_002313 NM_002340 NM_002351 NM_002358 NM_002359 NM_002375 NM_002386 NM_002389 NM_002406 NM_002451 NM_002460 NM_002481 NM_002482 NM_002500 NM_002526 NM_002545 NM_002547 NM_002577 NM_002604 NM_002640 NM_002655 NM_002664 NM_002703 NM_002731 NM_002734 NM_002736 NM_002737 NM_002758 NM_002806 NM_002816 NM_002834 NM_002848 NM_002860 NM_002874 NM_002886 NM_002948 NM_002959 NM_002990 NM_003012 NM_003015 NM_003024 NM_003048 NM_003060 NM_003103 NM_003118 NM_003123 NM_003133 NM_003189 NM_003211 NM_003215 NM_003222 NM_003246 NM_003262 NM_003270 NM_003274 NM_003336 NM_003339 NM_003387 NM_003392 NM_003405 NM_003411 NM_003441 NM_003454 NM_003455 NM_003463 NM_003471 NM_003472 NM_003507 NM_003574 NM_003583 NM_003590 NM_003600 NM_003617 NM_003629 NM_003644 NM_003672 NM_003679 NM_003722 NM_003724 NM_003772 NM_003774 NM_003781 NM_003804 NM_003810 NM_003825 NM_003842 NM_003882 NM_003913 NM_003958 NM_003966 NM_003994 NM_004024 NM_004077 NM_004090 NM_004093 NM_004094 NM_004124 NM_004171 NM_004184 NM_004264 NM_004272 NM_004274 NM_004287 NM_004311 NM_004319 NM_004331 NM_004338 NM_004342 NM_004346 NM_004350 NM_004385 NM_004392 NM_004404 NM_004437 NM_004438 NM_004454 NM_004464 NM_004481 NM_004505 NM_004513 NM_004516 NM_004527 NM_004535 NM_004562 NM_004567 NM_004582 NM_004586 NM_004612 NM_004614 NM_004620 NM_004622 NM_004627 NM_004661 NM_004670 NM_004673 NM_004709 NM_004719 NM_004731 NM_004737 NM_004742 NM_004744 NM_004745 NM_004762 NM_004849 NM_004866 NM_004873 NM_004892 NM_004897 NM_004898 NM_004921 NM_004932 NM_004936 NM_004956 NM_004983 NM_004985 NM_004993 NM_005036 NM_005042 NM_005050 NM_005065 NM_005086 NM_005108 NM_005116 NM_005188 NM_005277 NM_005302 NM_005308 NM_005378 NM_005385 NM_005397 NM_005433 NM_005436 NM_005441 NM_005455 NM_005462 NM_005502 NM_005504 NM_005517 NM_005562 NM_005575 NM_005584 NM_005590 NM_005591 NM_005604 NM_005637 NM_005655 NM_005665 NM_005668 NM_005721 NM_005737 NM_005779 NM_005789 NM_005798 NM_005822 NM_005828 NM_005898 NM_005901 NM_005903 NM_005907 NM_005935 NM_005966 NM_005975 NM_005981 NM_005999 NM_006038 NM_006047 NM_006054 NM_006056 NM_006061 NM_006070 NM_006122 NM_006134 NM_006141 NM_006154 NM_006155 NM_006167 NM_006172 NM_006187 NM_006202 NM_006241 NM_006242 NM_006282 NM_006283 NM_006286 NM_006298 NM_006306 NM_006315 NM_006361 NM_006371 NM_006375 NM_006393 NM_006449 NM_006460 NM_006482 NM_006496 NM_006499 NM_006504 NM_006520 NM_006538 NM_006544 NM_006547 NM_006561 NM_006566 NM_006572 NM_006599 NM_006603 NM_006614 NM_006620 NM_006626 NM_006628 NM_006646 NM_006661 NM_006667 NM_006699 NM_006720 NM_006722 NM_006729 NM_006731 NM_006749 NM_006754 NM_006775 NM_006777 NM_006783 NM_006785 NM_006813 NM_006823 NM_006827 NM_006831 NM_006914 NM_006955 NM_006959 NM_006962 NM_006981 NM_006989 NM_006991 NM_007017 NM_007038 NM_007043 NM_007050 NM_007070 NM_007073 NM_007078 NM_007086 NM_007130 NM_007131 NM_007145 NM_007159 NM_007190 NM_007218 NM_007236 NM_007249 NM_007271 NM_007282 NM_007306 NM_007351 NM_007361 NM_007362 NM_007373 NM_007375 NM_012072 NM_012095 NM_012137 NM_012157 NM_012158 NM_012173 NM_012199 NM_012219 NM_012243 NM_012252 NM_012262 NM_012279 NM_012297 NM_012382 NM_012395 NM_012397 NM_012409 NM_012420 NM_012431 NM_012464 NM_012465 NM_013243 NM_013255 NM_013256 NM_013261 NM_013262 NM_013281 NM_013293 NM_013341 NM_013372 NM_013374 NM_013410 NM_013444 NM_013987 NM_013988 NM_013999 NM_014028 NM_014048 NM_014117 NM_014141 NM_014231 NM_014235 NM_014243 NM_014279 NM_014286 NM_014305 NM_014319 NM_014331 NM_014342 NM_014354 NM_014388 NM_014399 NM_014459 NM_014577 NM_014616 NM_014636 NM_014646 NM_014655 NM_014686 NM_014697 NM_014701 NM_014707 NM_014721 NM_014732 NM_014743 NM_014762 NM_014766 NM_014774 NM_014776 NM_014792 NM_014803 NM_014809 NM_014819 NM_014821 NM_014832 NM_014835 NM_014840 NM_014859 NM_014862 NM_014876 NM_014883 NM_014897 NM_014905 NM_014906 NM_014910 NM_014912 NM_014924 NM_014937 NM_014945 NM_014949 NM_014951 NM_014962 NM_014997 NM_015003 NM_015027 NM_015033 NM_015039 NM_015040 NM_015049 NM_015074 NM_015088 NM_015090 NM_015093 NM_015101 NM_015130 NM_015144 NM_015192 NM_015200 NM_015205 NM_015225 NM_015254 NM_015256 NM_015257 NM_015259 NM_015265 NM_015267 NM_015271 NM_015272 NM_015310 NM_015315 NM_015317 NM_015318 NM_015323 NM_015326 NM_015353 NM_015369 NM_015378 NM_015397 NM_015423 NM_015428 NM_015436 NM_015508 NM_015509 NM_015515 NM_015532 NM_015553 NM_015558 NM_015565 NM_015568 NM_015569 NM_015575 NM_015577 NM_015640 NM_015679 NM_015691 NM_015696 NM_015701 NM_015886 NM_015975 NM_015984 NM_016028 NM_016078 NM_016101 NM_016114 NM_016127 NM_016156 NM_016206 NM_016212 NM_016217 NM_016221 NM_016224 NM_016255 NM_016264 NM_016275 NM_016322 NM_016338 NM_016340 NM_016369 NM_016376 NM_016396 NM_016422 NM_016474 NM_016516 NM_016591 NM_016599 NM_016604 NM_016607 NM_016618 NM_016621 NM_016831 NM_016929 NM_017413 NM_017420 NM_017456 NM_017488 NM_017493 NM_017548 NM_017563 NM_017577 NM_017599 NM_017626 NM_017628 NM_017635 NM_017645 NM_017651 NM_017669 NM_017672 NM_017676 NM_017705 NM_017709 NM_017736 NM_017742 NM_017769 NM_017770 NM_017801 NM_017847 NM_017853 NM_017898 NM_017990 NM_018003 NM_018011 NM_018030 NM_018036 NM_018057 NM_018066 NM_018069 NM_018086 NM_018091 NM_018099 NM_018137 NM_018156 NM_018167 NM_018170 NM_018176 NM_018191 NM_018212 NM_018224 NM_018242 NM_018243 NM_018263 NM_018290 NM_018293 NM_018299 NM_018327 NM_018330 NM_018356 NM_018369 NM_018374 NM_018375 NM_018389 NM_018416 NM_018427 NM_018440 NM_018444 NM_018479 NM_018482 NM_018555 NM_018639 NM_018672 NM_018689 NM_018691 NM_018706 NM_018718 NM_018844 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018935 NM_018936 NM_018937 NM_018945 NM_018963 NM_018999 NM_019002 NM_019027 NM_019061 NM_019072 NM_019084 NM_019094 NM_019099 NM_019117 NM_019591 NM_019606 NM_019610 NM_019845 NM_020119 NM_020133 NM_020144 NM_020148 NM_020150 NM_020177 NM_020182 NM_020194 NM_020228 NM_020323 NM_020324 NM_020325 NM_020326 NM_020337 NM_020340 NM_020347 NM_020353 NM_020377 NM_020382 NM_020390 NM_020399 NM_020403 NM_020405 NM_020416 NM_020429 NM_020431 NM_020447 NM_020452 NM_020453 NM_020456 NM_020462 NM_020647 NM_020648 NM_020666 NM_020673 NM_020696 NM_020698 NM_020714 NM_020726 NM_020728 NM_020739 NM_020742 NM_020755 NM_020766 NM_020768 NM_020771 NM_020772 NM_020773 NM_020774 NM_020781 NM_020782 NM_020787 NM_020792 NM_020810 NM_020825 NM_020828 NM_020861 NM_020870 NM_020909 NM_020921 NM_020925 NM_020935 NM_020947 NM_020956 NM_020980 NM_021005 NM_021030 NM_021033 NM_021038 NM_021083 NM_021088 NM_021096 NM_021105 NM_021137 NM_021141 NM_021164 NM_021183 NM_021205 NM_021622 NM_021795 NM_021807 NM_021813 NM_021916 NM_021942 NM_021945 NM_021946 NM_021960 NM_021961 NM_021977 NM_022049 NM_022071 NM_022074 NM_022080 NM_022096 NM_022116 NM_022131 NM_022336 NM_022351 NM_022373 NM_022473 NM_022482 NM_022648 NM_022725 NM_022756 NM_022766 NM_022771 NM_022781 NM_022819 NM_022894 NM_023011 NM_024017 NM_024021 NM_024028 NM_024095 NM_024102 NM_024317 NM_024336 NM_024408 NM_024423 NM_024557 NM_024611 NM_024613 NM_024614 NM_024627 NM_024641 NM_024646 NM_024665 NM_024674 NM_024691 NM_024699 NM_024713 NM_024715 NM_024743 NM_024774 NM_024787 NM_024812 NM_024889 NM_024910 NM_024921 NM_024989 NM_025030 NM_025040 NM_025054 NM_025074 NM_025133 NM_025138 NM_025164 NM_025188 NM_025203 NM_025214 NM_025218 NM_025237 NM_025238 NM_030579 NM_030621 NM_030633 NM_030650 NM_030660 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030806 NM_030884 NM_030911 NM_030918 NM_030937 NM_030964 NM_031281 NM_031296 NM_031305 NM_031411 NM_031418 NM_031426 NM_031438 NM_031445 NM_031463 NM_031465 NM_031476 NM_031496 NM_031849 NM_031857 NM_031860 NM_031887 NM_031888 NM_031911 NM_031988 NM_032012 NM_032016 NM_032017 NM_032018 NM_032029 NM_032105 NM_032153 NM_032189 NM_032217 NM_032226 NM_032228 NM_032276 NM_032287 NM_032290 NM_032372 NM_032373 NM_032427 NM_032434 NM_032438 NM_032440 NM_032446 NM_032449 NM_032547 NM_032558 NM_032587 NM_032599 NM_032711 NM_032765 NM_032783 NM_032788 NM_032801 NM_032824 NM_032826 NM_032833 NM_032842 NM_032866 NM_032869 NM_032871 NM_032873 NM_032886 NM_032905 NM_032916 NM_032932 NM_032968 NM_032969 NM_032973 NM_032976 NM_032991 NM_032998 NM_033035 NM_033100 NM_033103 NM_033107 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033198 NM_033211 NM_033238 NM_033331 NM_033346 NM_033360 NM_033389 NM_033397 NM_033409 NM_033412 NM_033425 NM_033430 NM_033437 NM_033505 NM_033548 NM_033551 NM_033631 NM_052811 NM_052822 NM_052848 NM_052864 NM_052886 NM_052896 NM_052917 NM_052932 NM_052937 NM_052954 NM_052996 NM_053044 NM_053056 NM_054114 NM_057158 NM_057169 NM_057170 NM_057175 NM_057177 NM_058183 NM_078487 NM_078628 NM_080417 NM_080591 NM_080597 NM_080666 NM_080668 NM_080687 NM_080725 NM_080733 NM_080759 NM_080760 NM_080867 NM_130435 NM_130446 NM_130798 NM_130838 NM_130839 NM_133170 NM_133268 NM_133332 NM_133333 NM_133334 NM_133367 NM_133371 NM_133443 NM_133477 NM_133496 NM_133642 NM_133646 NM_134434 NM_138362 NM_138444 NM_138473 NM_138551 NM_138578 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138694 NM_138713 NM_138714 NM_138925 NM_138926 NM_138927 NM_138958 NM_138995 NM_138999 NM_139012 NM_139014 NM_139244 NM_139275 NM_139283 NM_139319 NM_139321 NM_144498 NM_144664 NM_144682 NM_144692 NM_144718 NM_144778 NM_145015 NM_145061 NM_145179 NM_145307 NM_145342 NM_145646 NM_145648 NM_145693 NM_145794 NM_145800 NM_145802 NM_145803 NM_145818 NM_145858 NM_147147 NM_147152 NM_147175 NM_147180 NM_147187 NM_148975 NM_152133 NM_152222 NM_152261 NM_152262 NM_152282 NM_152291 NM_152292 NM_152298 NM_152317 NM_152409 NM_152418 NM_152422 NM_152423 NM_152470 NM_152488 NM_152556 NM_152583 NM_152588 NM_152594 NM_152595 NM_152607 NM_152624 NM_152686 NM_152737 NM_152765 NM_152793 NM_152838 NM_152851 NM_152852 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152934 NM_152999 NM_153029 NM_153034 NM_153041 NM_153042 NM_153207 NM_153234 NM_153367 NM_153380 NM_153381 NM_153442 NM_153464 NM_153620 NM_153646 NM_153647 NM_153648 NM_153683 NM_153689 NM_153708 NM_153764 NM_153765 NM_153766 NM_153767 NM_153810 NM_153826 NM_153836 NM_170686 NM_170706 NM_170719 NM_170736 NM_170737 NM_170740 NM_172098 NM_172127 NM_172128 NM_172159 NM_172160 NM_172164 NM_172217 NM_172232 NM_172239 NM_172241 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172364 NM_173198 NM_173200 NM_173213 NM_173214 NM_173463 NM_173468 NM_173477 NM_173510 NM_173511 NM_173531 NM_173532 NM_173536 NM_173538 NM_173545 NM_173551 NM_173552 NM_173580 NM_173582 NM_173610 NM_173611 NM_173631 NM_173632 NM_173639 NM_173643 NM_173651 NM_173654 NM_173667 NM_173694 NM_173701 NM_173808 NM_173844 NM_174871 NM_174878 NM_174950 NM_175873 NM_175876 NM_175907 NM_175920 NM_176863 NM_177438 NM_177442 NM_177453 NM_177532 NM_177947 NM_177948 NM_177951 NM_177995 NM_178151 NM_178152 NM_178153 NM_178424 NM_178505 NM_178509 NM_178514 NM_178566 NM_178582 NM_178812 NM_178816 NM_178818 NM_178831 NM_180989 NM_180991 NM_181076 NM_181077 NM_181332 NM_181349 NM_181354 NM_181443 NM_181481 NM_181482 NM_181483 NM_181489 NM_181504 NM_181523 NM_181524 NM_181571 NM_181705 NM_181706 NM_181714 NM_181717 NM_181723 NM_181762 NM_181777 NM_181789 NM_181838 NM_181839 NM_181844 NM_181871 NM_181876 NM_181877 NM_182314 NM_182485 NM_182503 NM_182540 NM_182568 NM_182580 NM_182597 NM_182631 NM_182646 NM_182703 NM_182715 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182734 NM_182763 NM_182769 NM_182770 NM_182771 NM_182772 NM_182812 NM_182850 NM_182853 NM_182948 NM_182970 NM_183004 NM_183011 NM_183012 NM_183013 NM_183060 NM_183078 NM_183376 NM_183381 NM_183382 NM_183383 NM_183384 NM_183420 NM_183421 NM_194278 NM_194283 NM_194285 NM_194286 NM_194292 NM_194298 NM_194299 NM_194317 NM_194318 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194428 NM_194434 NM_194442 NM_198087 NM_198088 NM_198156 NM_198158 NM_198159 NM_198177 NM_198178 NM_198181 NM_198270 NM_198275 NM_198281 NM_198320 NM_198324 NM_198330 NM_198391 NM_198392 NM_198400 NM_198433 NM_198434 NM_198435 NM_198436 NM_198437 NM_198451 NM_198459 NM_198465 NM_198484 NM_198506 NM_198530 NM_198542 NM_198555 NM_198798 NM_198833 NM_198845 NM_198846 NM_198847 NM_198859 NM_198887 NM_198889 NM_198926 NM_198935 NM_198989 NM_199040 NM_199050 NM_199053 NM_199169 NM_199170 NM_199171 NM_199176 NM_199245 NM_199294 NM_199295 NM_199328 NM_199343 NM_199421 NM_199437 NM_199438 NM_199439 NM_199478 NM_201278 NM_201281 NM_201428 NM_201429 NM_201430 NM_201431 NM_201432 NM_201433 NM_201543 NM_201544 NM_201545 NM_201570 NM_201571 NM_201572 NM_201590 NM_201591 NM_201592 NM_201593 NM_201596 NM_201597 NM_203327 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_203350 NM_203381 NM_203394 NM_203395 NM_203429 NM_203453 NM_203463 NM_203464 NM_203487 NM_203504 NM_203505 NM_206594 NM_206595 NM_206834 NM_206853 NM_206854 NM_206855 NM_206866 NM_206909 NM_206910 NM_206911 NM_206933 NM_207003 NM_207012 NM_207032 NM_207033 NM_207034 NM_207043 NM_207044 NM_207047 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207333 NM_207371 NM_207383 NM_207419 NM_207430 NM_207438 NM_207440 NM_207446 NM_207453 NM_207469 NM_207482 NM_207499 NM_207503 NM_207505 NM_207506 NM_207517 NM_207581 NM_207645 NM_212464 NM_212467 NM_212471 NM_212472 NM_213589 NM_213590 NM_213645 NM_213646 XM_017374 XM_027307 XM_028217 XM_031553 XM_032571 XM_034872 XM_035299 XM_036936 XM_036942 XM_039627 XM_043493 XM_044062 XM_046264 XM_047550 XM_048128 XM_067585 XM_086360 XM_113947 XM_114303 XM_114415 XM_117117 XM_117294 XM_168530 XM_208319 XM_208835 XM_209155 XM_209607 XM_290597 XM_290629 XM_290737 XM_291019 XM_291095 XM_292717 XM_294521 XM_294765 XM_295155 XM_298151 XM_370654 XM_370878 XM_370899 XM_371074 XM_371082 XM_371184 XM_371369 XM_371429 XM_371461 XM_371488 XM_371754 XM_371801 XM_371891 XM_372090 XM_372118 XM_372205 XM_372227 XM_373451 XM_373509 XM_373682 XM_373765 XM_374013 XM_374260 XM_374317 XM_374422 XM_374484 XM_374803 XM_375272 XM_375443 XM_375558 XM_375629 XM_375713 XM_375853 XM_375928 XM_376062 XM_376212 XM_376386 XM_376550 XM_376586 XM_376602 XM_376607 XM_376679 XM_376680 XM_376784 XM_376822 XM_376902 XM_376905 XM_377476 XM_378259 XM_378327 XM_378372 XM_378389 XM_378394 XM_378507 XM_378545 XM_378567 XM_378590 XM_378678 XM_378684 XM_378746 XM_378747 XM_378946 XM_378993 XM_379121 XM_379260 XM_379276 XM_379318 XM_379320 XM_379371 XM_379417 XM_379454 XM_379474 XM_379595 XM_379623 XM_379634 XM_379664 XM_379665 XM_379798 XM_379820 XM_379827 XM_379933 XM_379934 XM_380089 XM_495807 XM_495881 XM_495886 XM_495902 XM_495909 XM_495950 XM_495961 XM_496041 XM_496044 XM_496081 XM_496088 XM_496103 XM_496394 XM_496408 XM_496436 XM_496467 XM_496547 XM_496549 XM_496584 XM_496661 XM_496688 XM_496879 XM_496907 XM_496959 XM_496966 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_498437 XM_498442 XM_498481 XM_498508 XM_498540 XM_498545 XM_498569 XM_498614 XM_498646 XM_498825 XM_498901 XM_498948 XM_498961 XM_499074 XM_499123 XM_499147 XM_499298 XM_499309 XM_499343 XM_499528 XM_499572 XM_499602 XR_000192 XR_000195 XR_000216 XR_000227
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)