VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"uauuguaggcuugauguggcu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6794
.
Total Genes with multiple seed matches:
2015
.
Genes with at least one seed match:
NM_000022 NM_000025 NM_000027 NM_000031 NM_000037 NM_000038 NM_000044 NM_000046 NM_000052 NM_000053 NM_000054 NM_000060 NM_000067 NM_000082 NM_000089 NM_000091 NM_000094 NM_000097 NM_000102 NM_000103 NM_000110 NM_000112 NM_000113 NM_000115 NM_000125 NM_000129 NM_000136 NM_000144 NM_000149 NM_000151 NM_000153 NM_000160 NM_000161 NM_000162 NM_000165 NM_000167 NM_000170 NM_000183 NM_000188 NM_000194 NM_000199 NM_000206 NM_000209 NM_000212 NM_000214 NM_000215 NM_000219 NM_000222 NM_000230 NM_000232 NM_000233 NM_000234 NM_000237 NM_000242 NM_000243 NM_000246 NM_000250 NM_000252 NM_000253 NM_000254 NM_000260 NM_000262 NM_000264 NM_000266 NM_000268 NM_000271 NM_000283 NM_000287 NM_000296 NM_000297 NM_000303 NM_000304 NM_000311 NM_000313 NM_000314 NM_000319 NM_000320 NM_000322 NM_000328 NM_000329 NM_000332 NM_000334 NM_000335 NM_000337 NM_000344 NM_000345 NM_000346 NM_000348 NM_000351 NM_000355 NM_000361 NM_000362 NM_000365 NM_000368 NM_000369 NM_000376 NM_000382 NM_000387 NM_000389 NM_000396 NM_000397 NM_000399 NM_000401 NM_000402 NM_000405 NM_000406 NM_000411 NM_000416 NM_000428 NM_000429 NM_000431 NM_000432 NM_000434 NM_000436 NM_000439 NM_000448 NM_000449 NM_000450 NM_000451 NM_000455 NM_000457 NM_000462 NM_000476 NM_000480 NM_000486 NM_000494 NM_000495 NM_000496 NM_000497 NM_000520 NM_000522 NM_000525 NM_000527 NM_000530 NM_000539 NM_000544 NM_000555 NM_000557 NM_000572 NM_000577 NM_000579 NM_000582 NM_000593 NM_000594 NM_000598 NM_000599 NM_000602 NM_000604 NM_000610 NM_000611 NM_000618 NM_000620 NM_000621 NM_000627 NM_000629 NM_000632 NM_000633 NM_000635 NM_000637 NM_000663 NM_000664 NM_000667 NM_000668 NM_000682 NM_000683 NM_000687 NM_000693 NM_000695 NM_000706 NM_000715 NM_000718 NM_000721 NM_000723 NM_000725 NM_000727 NM_000744 NM_000745 NM_000749 NM_000750 NM_000774 NM_000778 NM_000785 NM_000787 NM_000790 NM_000791 NM_000793 NM_000801 NM_000809 NM_000817 NM_000818 NM_000824 NM_000837 NM_000838 NM_000841 NM_000843 NM_000849 NM_000859 NM_000864 NM_000869 NM_000875 NM_000883 NM_000885 NM_000891 NM_000896 NM_000898 NM_000899 NM_000904 NM_000909 NM_000910 NM_000911 NM_000913 NM_000918 NM_000919 NM_000921 NM_000923 NM_000925 NM_000926 NM_000934 NM_000935 NM_000937 NM_000938 NM_000944 NM_000953 NM_000961 NM_000962 NM_000983 NM_000991 NM_000994 NM_000997 NM_000998 NM_001001132 NM_001001188 NM_001001317 NM_001001329 NM_001001330 NM_001001336 NM_001001342 NM_001001344 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001411 NM_001001412 NM_001001418 NM_001001433 NM_001001434 NM_001001479 NM_001001502 NM_001001549 NM_001001550 NM_001001555 NM_001001557 NM_001001561 NM_001001563 NM_001001651 NM_001001653 NM_001001654 NM_001001662 NM_001001666 NM_001001669 NM_001001671 NM_001001675 NM_001001678 NM_001001679 NM_001001680 NM_001001681 NM_001001685 NM_001001686 NM_001001689 NM_001001691 NM_001001692 NM_001001693 NM_001001694 NM_001001695 NM_001001696 NM_001001698 NM_001001699 NM_001001702 NM_001001703 NM_001001789 NM_001001870 NM_001001871 NM_001001873 NM_001001874 NM_001001878 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001976 NM_001001995 NM_001002026 NM_001002034 NM_001002231 NM_001002232 NM_001002233 NM_001002254 NM_001002260 NM_001002261 NM_001002262 NM_001002296 NM_001002762 NM_001002814 NM_001002847 NM_001002857 NM_001002858 NM_001002860 NM_001002862 NM_001002876 NM_001002880 NM_001002881 NM_001002909 NM_001002914 NM_001002926 NM_001003399 NM_001003406 NM_001003652 NM_001003656 NM_001003674 NM_001003675 NM_001003676 NM_001003677 NM_001003682 NM_001003683 NM_001003690 NM_001003702 NM_001003712 NM_001003715 NM_001003716 NM_001003722 NM_001003789 NM_001003794 NM_001003796 NM_001003807 NM_001003818 NM_001003927 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001004019 NM_001004067 NM_001004125 NM_001004127 NM_001004300 NM_001004301 NM_001004302 NM_001004304 NM_001004305 NM_001004307 NM_001004313 NM_001004314 NM_001004317 NM_001004325 NM_001004328 NM_001004338 NM_001004345 NM_001004349 NM_001004439 NM_001004440 NM_001004441 NM_001004720 NM_001004722 NM_001005158 NM_001005159 NM_001005209 NM_001005210 NM_001005336 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005409 NM_001005412 NM_001005415 NM_001005416 NM_001005417 NM_001005474 NM_001005609 NM_001005751 NM_001005752 NM_001005861 NM_001005912 NM_001005913 NM_001005918 NM_001005920 NM_001006113 NM_001006115 NM_001006608 NM_001006616 NM_001006623 NM_001006636 NM_001006639 NM_001006640 NM_001006641 NM_001006642 NM_001006643 NM_001006655 NM_001006657 NM_001006932 NM_001006939 NM_001006943 NM_001006944 NM_001006946 NM_001007 NM_001007023 NM_001007024 NM_001007025 NM_001007026 NM_001007073 NM_001007074 NM_001007088 NM_001007094 NM_001007097 NM_001007156 NM_001007224 NM_001007225 NM_001007226 NM_001007227 NM_001007228 NM_001007229 NM_001007230 NM_001007233 NM_001007240 NM_001007241 NM_001007242 NM_001007246 NM_001007254 NM_001007258 NM_001007262 NM_001007277 NM_001007278 NM_001007464 NM_001007466 NM_001007529 NM_001007536 NM_001007542 NM_001007560 NM_001007563 NM_001008220 NM_001008222 NM_001008226 NM_001008234 NM_001008239 NM_001008388 NM_001008389 NM_001008392 NM_001008396 NM_001008397 NM_001008401 NM_001008404 NM_001008405 NM_001008406 NM_001008407 NM_001008408 NM_001008410 NM_001008411 NM_001008487 NM_001008493 NM_001008529 NM_001008534 NM_001008537 NM_001008540 NM_001008541 NM_001008568 NM_001008569 NM_001008570 NM_001008571 NM_001008657 NM_001008697 NM_001008701 NM_001008703 NM_001008704 NM_001008736 NM_001008742 NM_001008744 NM_001008745 NM_001008801 NM_001008925 NM_001008938 NM_001009184 NM_001009553 NM_001009566 NM_001009610 NM_001009811 NM_001009877 NM_001009880 NM_001009905 NM_001009913 NM_001009922 NM_001009931 NM_001009937 NM_001009938 NM_001009944 NM_001009956 NM_001009957 NM_001009958 NM_001009959 NM_001009960 NM_001010000 NM_001010846 NM_001010850 NM_001010851 NM_001010853 NM_001010861 NM_001010864 NM_001010866 NM_001010867 NM_001010870 NM_001010888 NM_001010891 NM_001010897 NM_001010898 NM_001010909 NM_001010910 NM_001010924 NM_001010934 NM_001010938 NM_001010980 NM_001010983 NM_001010987 NM_001011513 NM_001011514 NM_001011537 NM_001011554 NM_001011645 NM_001011655 NM_001011664 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011708 NM_001011713 NM_001011718 NM_001011880 NM_001012267 NM_001012274 NM_001012278 NM_001012329 NM_001012339 NM_001012393 NM_001012418 NM_001012420 NM_001012423 NM_001012452 NM_001012478 NM_001012479 NM_001012508 NM_001012509 NM_001012511 NM_001012514 NM_001012516 NM_001012626 NM_001012642 NM_001012651 NM_001012659 NM_001012711 NM_001012713 NM_001012715 NM_001012727 NM_001012729 NM_001012732 NM_001012733 NM_001012734 NM_001012755 NM_001012761 NM_001012763 NM_001012957 NM_001012960 NM_001012981 NM_001012982 NM_001013031 NM_001013398 NM_001013615 NM_001013629 NM_001013634 NM_001013635 NM_001013637 NM_001013642 NM_001013644 NM_001013648 NM_001013652 NM_001013667 NM_001013669 NM_001013673 NM_001013675 NM_001013676 NM_001013677 NM_001013678 NM_001013679 NM_001013681 NM_001013682 NM_001013685 NM_001013687 NM_001013688 NM_001013693 NM_001013695 NM_001013697 NM_001013704 NM_001013708 NM_001013713 NM_001013720 NM_001013723 NM_001013729 NM_001013746 NM_001013839 NM_001013842 NM_001014374 NM_001014380 NM_001014431 NM_001014432 NM_001014436 NM_001014439 NM_001014445 NM_001014764 NM_001014794 NM_001014795 NM_001014797 NM_001014809 NM_001014831 NM_001014832 NM_001014833 NM_001014834 NM_001014835 NM_001015045 NM_001015048 NM_001015049 NM_001015051 NM_001015053 NM_001015880 NM_001015882 NM_001015886 NM_001017388 NM_001017395 NM_001017421 NM_001017437 NM_001017440 NM_001017524 NM_001017528 NM_001017529 NM_001017530 NM_001017535 NM_001017915 NM_001017916 NM_001017917 NM_001017918 NM_001017919 NM_001017923 NM_001017929 NM_001017956 NM_001017957 NM_001017958 NM_001017964 NM_001017965 NM_001017972 NM_001017973 NM_001017974 NM_001017975 NM_001017981 NM_001017995 NM_001017998 NM_001018000 NM_001018009 NM_001018029 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018054 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018071 NM_001018078 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018100 NM_001018101 NM_001018108 NM_001018116 NM_001018122 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001023560 NM_001023563 NM_001023565 NM_001023566 NM_001023567 NM_001023570 NM_001023571 NM_001023582 NM_001024226 NM_001024227 NM_001024228 NM_001024372 NM_001024380 NM_001024381 NM_001024401 NM_001024455 NM_001024596 NM_001024630 NM_001024631 NM_001024644 NM_001024649 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024676 NM_001024677 NM_001024688 NM_001024733 NM_001024736 NM_001024808 NM_001024843 NM_001024847 NM_001024858 NM_001024933 NM_001024948 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025081 NM_001025090 NM_001025091 NM_001025092 NM_001025094 NM_001025096 NM_001025097 NM_001025098 NM_001025100 NM_001025101 NM_001025107 NM_001025108 NM_001025160 NM_001025193 NM_001025205 NM_001025233 NM_001025234 NM_001025235 NM_001025236 NM_001025237 NM_001025238 NM_001025239 NM_001025242 NM_001025243 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001025290 NM_001026 NM_001031 NM_001034 NM_001037 NM_001043 NM_001045 NM_001066 NM_001074 NM_001078 NM_001080 NM_001083 NM_001085 NM_001090 NM_001092 NM_001094 NM_001099 NM_001101 NM_001104 NM_001111 NM_001114 NM_001119 NM_001122 NM_001127 NM_001132 NM_001148 NM_001156 NM_001157 NM_001158 NM_001167 NM_001174 NM_001183 NM_001187 NM_001188 NM_001191 NM_001197 NM_001198 NM_001204 NM_001206 NM_001219 NM_001224 NM_001230 NM_001237 NM_001243 NM_001247 NM_001250 NM_001251 NM_001254 NM_001257 NM_001264 NM_001268 NM_001275 NM_001277 NM_001280 NM_001283 NM_001286 NM_001289 NM_001292 NM_001298 NM_001303 NM_001305 NM_001313 NM_001331 NM_001332 NM_001337 NM_001346 NM_001347 NM_001348 NM_001352 NM_001356 NM_001360 NM_001361 NM_001365 NM_001379 NM_001384 NM_001387 NM_001388 NM_001390 NM_001395 NM_001396 NM_001399 NM_001402 NM_001406 NM_001407 NM_001408 NM_001409 NM_001410 NM_001412 NM_001415 NM_001417 NM_001421 NM_001422 NM_001427 NM_001430 NM_001439 NM_001440 NM_001441 NM_001447 NM_001448 NM_001449 NM_001457 NM_001460 NM_001468 NM_001469 NM_001470 NM_001478 NM_001482 NM_001485 NM_001491 NM_001493 NM_001495 NM_001497 NM_001498 NM_001502 NM_001504 NM_001505 NM_001515 NM_001516 NM_001518 NM_001519 NM_001520 NM_001525 NM_001530 NM_001543 NM_001560 NM_001569 NM_001570 NM_001585 NM_001609 NM_001610 NM_001611 NM_001614 NM_001632 NM_001633 NM_001635 NM_001645 NM_001646 NM_001649 NM_001650 NM_001654 NM_001656 NM_001658 NM_001659 NM_001661 NM_001662 NM_001664 NM_001667 NM_001678 NM_001687 NM_001690 NM_001693 NM_001695 NM_001696 NM_001707 NM_001709 NM_001716 NM_001718 NM_001724 NM_001728 NM_001731 NM_001732 NM_001736 NM_001741 NM_001743 NM_001746 NM_001754 NM_001759 NM_001760 NM_001781 NM_001784 NM_001789 NM_001795 NM_001796 NM_001800 NM_001804 NM_001806 NM_001815 NM_001817 NM_001821 NM_001829 NM_001831 NM_001847 NM_001853 NM_001854 NM_001858 NM_001870 NM_001883 NM_001895 NM_001896 NM_001901 NM_001905 NM_001908 NM_001910 NM_001915 NM_001921 NM_001931 NM_001937 NM_001938 NM_001940 NM_001946 NM_001948 NM_001949 NM_001950 NM_001955 NM_001964 NM_001966 NM_001969 NM_001970 NM_001975 NM_001980 NM_001982 NM_001986 NM_001987 NM_001991 NM_001992 NM_001998 NM_002002 NM_002006 NM_002014 NM_002015 NM_002017 NM_002025 NM_002031 NM_002032 NM_002033 NM_002035 NM_002045 NM_002048 NM_002052 NM_002060 NM_002065 NM_002073 NM_002074 NM_002079 NM_002085 NM_002086 NM_002087 NM_002092 NM_002100 NM_002102 NM_002103 NM_002106 NM_002111 NM_002119 NM_002122 NM_002124 NM_002125 NM_002131 NM_002133 NM_002141 NM_002147 NM_002149 NM_002155 NM_002158 NM_002163 NM_002180 NM_002182 NM_002188 NM_002193 NM_002196 NM_002199 NM_002203 NM_002206 NM_002207 NM_002209 NM_002211 NM_002212 NM_002218 NM_002223 NM_002225 NM_002226 NM_002230 NM_002235 NM_002236 NM_002237 NM_002240 NM_002241 NM_002242 NM_002243 NM_002248 NM_002251 NM_002252 NM_002254 NM_002264 NM_002265 NM_002271 NM_002282 NM_002285 NM_002298 NM_002304 NM_002309 NM_002314 NM_002318 NM_002319 NM_002334 NM_002347 NM_002348 NM_002351 NM_002353 NM_002357 NM_002359 NM_002363 NM_002364 NM_002373 NM_002375 NM_002376 NM_002379 NM_002384 NM_002385 NM_002389 NM_002390 NM_002397 NM_002401 NM_002403 NM_002404 NM_002406 NM_002409 NM_002416 NM_002421 NM_002424 NM_002427 NM_002428 NM_002441 NM_002442 NM_002444 NM_002451 NM_002460 NM_002461 NM_002466 NM_002480 NM_002482 NM_002485 NM_002500 NM_002501 NM_002505 NM_002507 NM_002508 NM_002509 NM_002519 NM_002521 NM_002522 NM_002528 NM_002531 NM_002535 NM_002543 NM_002545 NM_002547 NM_002558 NM_002560 NM_002562 NM_002566 NM_002569 NM_002570 NM_002576 NM_002577 NM_002581 NM_002582 NM_002595 NM_002596 NM_002599 NM_002602 NM_002604 NM_002608 NM_002610 NM_002611 NM_002613 NM_002616 NM_002629 NM_002633 NM_002634 NM_002640 NM_002641 NM_002643 NM_002649 NM_002650 NM_002654 NM_002655 NM_002656 NM_002660 NM_002665 NM_002666 NM_002668 NM_002686 NM_002695 NM_002698 NM_002702 NM_002703 NM_002706 NM_002711 NM_002716 NM_002717 NM_002719 NM_002731 NM_002733 NM_002734 NM_002736 NM_002737 NM_002743 NM_002745 NM_002748 NM_002751 NM_002754 NM_002756 NM_002757 NM_002760 NM_002766 NM_002768 NM_002778 NM_002780 NM_002783 NM_002799 NM_002812 NM_002813 NM_002814 NM_002815 NM_002816 NM_002819 NM_002820 NM_002829 NM_002833 NM_002834 NM_002840 NM_002844 NM_002845 NM_002848 NM_002854 NM_002857 NM_002861 NM_002862 NM_002867 NM_002868 NM_002872 NM_002874 NM_002881 NM_002883 NM_002885 NM_002886 NM_002895 NM_002911 NM_002914 NM_002918 NM_002923 NM_002924 NM_002926 NM_002928 NM_002936 NM_002938 NM_002941 NM_002946 NM_002949 NM_002950 NM_002956 NM_002957 NM_002958 NM_002959 NM_002960 NM_002978 NM_002990 NM_002996 NM_002997 NM_002998 NM_002999 NM_003001 NM_003003 NM_003006 NM_003009 NM_003011 NM_003012 NM_003013 NM_003016 NM_003021 NM_003023 NM_003027 NM_003032 NM_003038 NM_003039 NM_003042 NM_003044 NM_003045 NM_003048 NM_003053 NM_003056 NM_003071 NM_003076 NM_003085 NM_003086 NM_003091 NM_003100 NM_003108 NM_003110 NM_003119 NM_003120 NM_003124 NM_003139 NM_003144 NM_003150 NM_003152 NM_003153 NM_003155 NM_003161 NM_003165 NM_003170 NM_003173 NM_003178 NM_003179 NM_003188 NM_003189 NM_003190 NM_003194 NM_003200 NM_003203 NM_003205 NM_003211 NM_003214 NM_003215 NM_003216 NM_003217 NM_003224 NM_003234 NM_003236 NM_003239 NM_003242 NM_003247 NM_003248 NM_003255 NM_003258 NM_003262 NM_003264 NM_003271 NM_003275 NM_003288 NM_003291 NM_003295 NM_003307 NM_003311 NM_003318 NM_003320 NM_003324 NM_003326 NM_003336 NM_003338 NM_003339 NM_003340 NM_003343 NM_003344 NM_003345 NM_003347 NM_003361 NM_003367 NM_003369 NM_003370 NM_003371 NM_003373 NM_003379 NM_003382 NM_003387 NM_003388 NM_003391 NM_003392 NM_003396 NM_003400 NM_003404 NM_003406 NM_003408 NM_003412 NM_003414 NM_003420 NM_003421 NM_003423 NM_003426 NM_003427 NM_003429 NM_003434 NM_003435 NM_003437 NM_003439 NM_003441 NM_003449 NM_003451 NM_003453 NM_003458 NM_003459 NM_003462 NM_003467 NM_003469 NM_003474 NM_003478 NM_003483 NM_003484 NM_003486 NM_003488 NM_003496 NM_003498 NM_003559 NM_003562 NM_003563 NM_003564 NM_003565 NM_003581 NM_003583 NM_003585 NM_003590 NM_003597 NM_003602 NM_003605 NM_003615 NM_003618 NM_003622 NM_003626 NM_003629 NM_003633 NM_003635 NM_003643 NM_003644 NM_003648 NM_003660 NM_003664 NM_003669 NM_003670 NM_003681 NM_003682 NM_003683 NM_003684 NM_003686 NM_003687 NM_003705 NM_003710 NM_003713 NM_003716 NM_003722 NM_003724 NM_003728 NM_003731 NM_003734 NM_003737 NM_003748 NM_003749 NM_003751 NM_003761 NM_003763 NM_003780 NM_003781 NM_003800 NM_003819 NM_003820 NM_003822 NM_003824 NM_003830 NM_003831 NM_003835 NM_003839 NM_003842 NM_003846 NM_003848 NM_003855 NM_003861 NM_003869 NM_003870 NM_003873 NM_003874 NM_003885 NM_003887 NM_003893 NM_003895 NM_003899 NM_003900 NM_003901 NM_003908 NM_003909 NM_003913 NM_003915 NM_003916 NM_003924 NM_003926 NM_003933 NM_003938 NM_003939 NM_003941 NM_003942 NM_003943 NM_003944 NM_003949 NM_003950 NM_003955 NM_003956 NM_003959 NM_003966 NM_003968 NM_003970 NM_003972 NM_003979 NM_003981 NM_003983 NM_003994 NM_004024 NM_004028 NM_004034 NM_004035 NM_004037 NM_004039 NM_004040 NM_004050 NM_004051 NM_004052 NM_004053 NM_004061 NM_004064 NM_004068 NM_004073 NM_004074 NM_004090 NM_004091 NM_004093 NM_004098 NM_004101 NM_004113 NM_004114 NM_004118 NM_004124 NM_004125 NM_004127 NM_004129 NM_004136 NM_004142 NM_004145 NM_004161 NM_004171 NM_004172 NM_004173 NM_004175 NM_004177 NM_004186 NM_004197 NM_004199 NM_004200 NM_004203 NM_004204 NM_004205 NM_004209 NM_004210 NM_004213 NM_004216 NM_004220 NM_004223 NM_004227 NM_004238 NM_004242 NM_004247 NM_004256 NM_004259 NM_004262 NM_004263 NM_004264 NM_004269 NM_004271 NM_004275 NM_004286 NM_004287 NM_004288 NM_004291 NM_004296 NM_004302 NM_004309 NM_004311 NM_004319 NM_004320 NM_004321 NM_004327 NM_004337 NM_004338 NM_004339 NM_004348 NM_004350 NM_004360 NM_004367 NM_004370 NM_004373 NM_004377 NM_004382 NM_004387 NM_004389 NM_004391 NM_004392 NM_004393 NM_004394 NM_004397 NM_004399 NM_004401 NM_004408 NM_004414 NM_004422 NM_004423 NM_004426 NM_004431 NM_004437 NM_004438 NM_004441 NM_004443 NM_004449 NM_004459 NM_004462 NM_004464 NM_004468 NM_004474 NM_004481 NM_004485 NM_004488 NM_004496 NM_004505 NM_004513 NM_004514 NM_004516 NM_004517 NM_004518 NM_004521 NM_004529 NM_004530 NM_004532 NM_004535 NM_004537 NM_004540 NM_004548 NM_004553 NM_004554 NM_004556 NM_004558 NM_004566 NM_004567 NM_004571 NM_004573 NM_004578 NM_004584 NM_004586 NM_004591 NM_004600 NM_004602 NM_004610 NM_004612 NM_004614 NM_004618 NM_004619 NM_004620 NM_004621 NM_004624 NM_004631 NM_004635 NM_004649 NM_004650 NM_004656 NM_004660 NM_004663 NM_004666 NM_004670 NM_004681 NM_004685 NM_004686 NM_004687 NM_004691 NM_004702 NM_004703 NM_004707 NM_004709 NM_004711 NM_004712 NM_004718 NM_004720 NM_004731 NM_004734 NM_004738 NM_004744 NM_004745 NM_004747 NM_004755 NM_004758 NM_004759 NM_004767 NM_004768 NM_004771 NM_004772 NM_004773 NM_004775 NM_004780 NM_004781 NM_004785 NM_004788 NM_004793 NM_004795 NM_004797 NM_004798 NM_004804 NM_004809 NM_004811 NM_004814 NM_004817 NM_004834 NM_004844 NM_004845 NM_004850 NM_004863 NM_004870 NM_004871 NM_004873 NM_004879 NM_004885 NM_004896 NM_004911 NM_004913 NM_004915 NM_004917 NM_004923 NM_004929 NM_004938 NM_004942 NM_004943 NM_004947 NM_004952 NM_004956 NM_004957 NM_004959 NM_004973 NM_004979 NM_004981 NM_004983 NM_004992 NM_004993 NM_004998 NM_005006 NM_005008 NM_005011 NM_005018 NM_005036 NM_005041 NM_005045 NM_005048 NM_005050 NM_005051 NM_005052 NM_005056 NM_005057 NM_005063 NM_005065 NM_005072 NM_005076 NM_005079 NM_005082 NM_005086 NM_005093 NM_005095 NM_005096 NM_005097 NM_005098 NM_005105 NM_005110 NM_005112 NM_005116 NM_005120 NM_005126 NM_005134 NM_005137 NM_005146 NM_005149 NM_005155 NM_005163 NM_005177 NM_005184 NM_005185 NM_005186 NM_005187 NM_005188 NM_005189 NM_005191 NM_005197 NM_005202 NM_005207 NM_005211 NM_005213 NM_005219 NM_005220 NM_005226 NM_005231 NM_005234 NM_005238 NM_005239 NM_005244 NM_005247 NM_005253 NM_005255 NM_005257 NM_005262 NM_005268 NM_005271 NM_005276 NM_005277 NM_005279 NM_005283 NM_005291 NM_005297 NM_005309 NM_005311 NM_005313 NM_005318 NM_005324 NM_005328 NM_005336 NM_005338 NM_005341 NM_005349 NM_005358 NM_005370 NM_005374 NM_005376 NM_005379 NM_005385 NM_005386 NM_005392 NM_005399 NM_005400 NM_005407 NM_005417 NM_005418 NM_005431 NM_005432 NM_005436 NM_005446 NM_005452 NM_005453 NM_005456 NM_005458 NM_005465 NM_005466 NM_005467 NM_005471 NM_005472 NM_005474 NM_005475 NM_005479 NM_005488 NM_005491 NM_005493 NM_005504 NM_005508 NM_005523 NM_005530 NM_005538 NM_005541 NM_005546 NM_005550 NM_005551 NM_005562 NM_005569 NM_005578 NM_005598 NM_005607 NM_005650 NM_005655 NM_005658 NM_005664 NM_005668 NM_005670 NM_005677 NM_005682 NM_005687 NM_005688 NM_005699 NM_005700 NM_005704 NM_005705 NM_005707 NM_005715 NM_005722 NM_005729 NM_005730 NM_005735 NM_005736 NM_005737 NM_005739 NM_005746 NM_005764 NM_005769 NM_005779 NM_005781 NM_005783 NM_005785 NM_005795 NM_005798 NM_005801 NM_005806 NM_005808 NM_005816 NM_005819 NM_005824 NM_005828 NM_005832 NM_005834 NM_005835 NM_005840 NM_005841 NM_005851 NM_005856 NM_005858 NM_005866 NM_005868 NM_005877 NM_005879 NM_005883 NM_005884 NM_005886 NM_005889 NM_005892 NM_005895 NM_005897 NM_005901 NM_005902 NM_005905 NM_005909 NM_005915 NM_005922 NM_005928 NM_005933 NM_005935 NM_005938 NM_005940 NM_005941 NM_005943 NM_005954 NM_005955 NM_005957 NM_005962 NM_005965 NM_005966 NM_005968 NM_005969 NM_005971 NM_005981 NM_005984 NM_005989 NM_005990 NM_005993 NM_005999 NM_006005 NM_006013 NM_006016 NM_006018 NM_006032 NM_006035 NM_006036 NM_006037 NM_006040 NM_006045 NM_006048 NM_006052 NM_006055 NM_006058 NM_006059 NM_006060 NM_006062 NM_006065 NM_006073 NM_006085 NM_006088 NM_006092 NM_006100 NM_006107 NM_006112 NM_006116 NM_006122 NM_006131 NM_006132 NM_006141 NM_006142 NM_006144 NM_006151 NM_006154 NM_006162 NM_006176 NM_006177 NM_006178 NM_006184 NM_006187 NM_006193 NM_006195 NM_006201 NM_006206 NM_006212 NM_006215 NM_006224 NM_006226 NM_006231 NM_006234 NM_006237 NM_006241 NM_006245 NM_006251 NM_006255 NM_006268 NM_006272 NM_006275 NM_006278 NM_006279 NM_006282 NM_006283 NM_006286 NM_006288 NM_006290 NM_006291 NM_006293 NM_006298 NM_006301 NM_006306 NM_006310 NM_006312 NM_006313 NM_006315 NM_006321 NM_006325 NM_006333 NM_006335 NM_006338 NM_006346 NM_006352 NM_006353 NM_006354 NM_006361 NM_006366 NM_006371 NM_006373 NM_006375 NM_006377 NM_006379 NM_006383 NM_006384 NM_006390 NM_006399 NM_006400 NM_006401 NM_006403 NM_006408 NM_006409 NM_006412 NM_006418 NM_006419 NM_006421 NM_006430 NM_006432 NM_006454 NM_006457 NM_006459 NM_006464 NM_006465 NM_006469 NM_006472 NM_006476 NM_006478 NM_006481 NM_006482 NM_006485 NM_006493 NM_006499 NM_006501 NM_006505 NM_006508 NM_006517 NM_006519 NM_006524 NM_006534 NM_006537 NM_006538 NM_006540 NM_006541 NM_006546 NM_006548 NM_006549 NM_006553 NM_006555 NM_006557 NM_006560 NM_006561 NM_006563 NM_006572 NM_006576 NM_006587 NM_006590 NM_006596 NM_006597 NM_006598 NM_006599 NM_006617 NM_006620 NM_006622 NM_006624 NM_006626 NM_006628 NM_006632 NM_006640 NM_006641 NM_006643 NM_006650 NM_006651 NM_006661 NM_006665 NM_006672 NM_006675 NM_006677 NM_006690 NM_006693 NM_006695 NM_006697 NM_006699 NM_006706 NM_006713 NM_006716 NM_006718 NM_006724 NM_006729 NM_006732 NM_006736 NM_006742 NM_006748 NM_006749 NM_006753 NM_006760 NM_006761 NM_006762 NM_006763 NM_006764 NM_006767 NM_006769 NM_006771 NM_006772 NM_006773 NM_006777 NM_006778 NM_006782 NM_006788 NM_006795 NM_006796 NM_006801 NM_006805 NM_006809 NM_006812 NM_006813 NM_006816 NM_006821 NM_006823 NM_006826 NM_006827 NM_006830 NM_006834 NM_006835 NM_006841 NM_006843 NM_006852 NM_006856 NM_006857 NM_006858 NM_006868 NM_006869 NM_006873 NM_006876 NM_006888 NM_006890 NM_006892 NM_006907 NM_006914 NM_006924 NM_006925 NM_006926 NM_006936 NM_006938 NM_006943 NM_006945 NM_006947 NM_006948 NM_006955 NM_006959 NM_006962 NM_006969 NM_006974 NM_006984 NM_006987 NM_006989 NM_006990 NM_006995 NM_006996 NM_006998 NM_007005 NM_007010 NM_007011 NM_007013 NM_007014 NM_007018 NM_007021 NM_007023 NM_007024 NM_007030 NM_007041 NM_007042 NM_007043 NM_007045 NM_007049 NM_007050 NM_007055 NM_007063 NM_007066 NM_007073 NM_007081 NM_007082 NM_007086 NM_007107 NM_007118 NM_007122 NM_007127 NM_007137 NM_007139 NM_007144 NM_007145 NM_007147 NM_007148 NM_007151 NM_007156 NM_007157 NM_007159 NM_007161 NM_007171 NM_007172 NM_007173 NM_007174 NM_007175 NM_007177 NM_007183 NM_007197 NM_007203 NM_007216 NM_007220 NM_007223 NM_007224 NM_007225 NM_007229 NM_007232 NM_007236 NM_007238 NM_007249 NM_007250 NM_007256 NM_007259 NM_007260 NM_007261 NM_007270 NM_007271 NM_007275 NM_007278 NM_007279 NM_007283 NM_007292 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007308 NM_007315 NM_007321 NM_007332 NM_007335 NM_007336 NM_007338 NM_007345 NM_007353 NM_007356 NM_007359 NM_007364 NM_007368 NM_007373 NM_007375 NM_009590 NM_012068 NM_012069 NM_012072 NM_012075 NM_012076 NM_012080 NM_012081 NM_012084 NM_012088 NM_012095 NM_012096 NM_012101 NM_012104 NM_012109 NM_012121 NM_012124 NM_012130 NM_012134 NM_012137 NM_012141 NM_012143 NM_012146 NM_012158 NM_012171 NM_012184 NM_012191 NM_012193 NM_012199 NM_012200 NM_012202 NM_012211 NM_012215 NM_012218 NM_012219 NM_012225 NM_012229 NM_012231 NM_012233 NM_012236 NM_012237 NM_012238 NM_012239 NM_012242 NM_012244 NM_012262 NM_012264 NM_012268 NM_012269 NM_012271 NM_012275 NM_012278 NM_012281 NM_012287 NM_012288 NM_012292 NM_012296 NM_012300 NM_012305 NM_012306 NM_012307 NM_012308 NM_012309 NM_012315 NM_012318 NM_012320 NM_012323 NM_012325 NM_012327 NM_012329 NM_012333 NM_012338 NM_012342 NM_012343 NM_012346 NM_012384 NM_012387 NM_012388 NM_012393 NM_012397 NM_012398 NM_012400 NM_012409 NM_012419 NM_012420 NM_012426 NM_012434 NM_012436 NM_012447 NM_012448 NM_012453 NM_012455 NM_012465 NM_012470 NM_012473 NM_013230 NM_013236 NM_013252 NM_013255 NM_013262 NM_013265 NM_013279 NM_013280 NM_013283 NM_013284 NM_013286 NM_013301 NM_013302 NM_013309 NM_013313 NM_013323 NM_013325 NM_013332 NM_013341 NM_013345 NM_013348 NM_013373 NM_013377 NM_013388 NM_013392 NM_013393 NM_013399 NM_013401 NM_013402 NM_013411 NM_013412 NM_013434 NM_013437 NM_013441 NM_013446 NM_013447 NM_013448 NM_013449 NM_013450 NM_013989 NM_013995 NM_014000 NM_014001 NM_014002 NM_014003 NM_014007 NM_014014 NM_014016 NM_014021 NM_014023 NM_014046 NM_014063 NM_014067 NM_014071 NM_014112 NM_014141 NM_014149 NM_014154 NM_014155 NM_014157 NM_014187 NM_014189 NM_014190 NM_014203 NM_014210 NM_014212 NM_014228 NM_014231 NM_014232 NM_014235 NM_014240 NM_014242 NM_014246 NM_014249 NM_014252 NM_014256 NM_014262 NM_014268 NM_014272 NM_014275 NM_014279 NM_014280 NM_014285 NM_014286 NM_014287 NM_014292 NM_014293 NM_014296 NM_014303 NM_014309 NM_014310 NM_014319 NM_014326 NM_014333 NM_014338 NM_014339 NM_014342 NM_014347 NM_014351 NM_014352 NM_014353 NM_014358 NM_014359 NM_014362 NM_014368 NM_014370 NM_014388 NM_014394 NM_014395 NM_014396 NM_014399 NM_014409 NM_014415 NM_014431 NM_014437 NM_014444 NM_014448 NM_014459 NM_014460 NM_014462 NM_014485 NM_014488 NM_014489 NM_014494 NM_014496 NM_014498 NM_014506 NM_014517 NM_014518 NM_014522 NM_014553 NM_014554 NM_014555 NM_014556 NM_014574 NM_014580 NM_014586 NM_014592 NM_014594 NM_014600 NM_014601 NM_014610 NM_014613 NM_014615 NM_014616 NM_014628 NM_014630 NM_014631 NM_014633 NM_014634 NM_014636 NM_014637 NM_014642 NM_014647 NM_014653 NM_014656 NM_014661 NM_014663 NM_014665 NM_014667 NM_014670 NM_014671 NM_014674 NM_014677 NM_014678 NM_014690 NM_014694 NM_014696 NM_014698 NM_014700 NM_014702 NM_014704 NM_014707 NM_014711 NM_014714 NM_014721 NM_014723 NM_014726 NM_014728 NM_014730 NM_014731 NM_014732 NM_014734 NM_014737 NM_014738 NM_014741 NM_014743 NM_014744 NM_014746 NM_014747 NM_014756 NM_014757 NM_014758 NM_014759 NM_014761 NM_014762 NM_014766 NM_014767 NM_014772 NM_014777 NM_014781 NM_014787 NM_014788 NM_014789 NM_014792 NM_014795 NM_014797 NM_014798 NM_014799 NM_014801 NM_014804 NM_014806 NM_014807 NM_014809 NM_014810 NM_014812 NM_014819 NM_014820 NM_014824 NM_014829 NM_014830 NM_014832 NM_014835 NM_014836 NM_014838 NM_014840 NM_014841 NM_014844 NM_014848 NM_014849 NM_014850 NM_014853 NM_014854 NM_014858 NM_014859 NM_014861 NM_014862 NM_014865 NM_014867 NM_014869 NM_014870 NM_014872 NM_014873 NM_014874 NM_014876 NM_014883 NM_014891 NM_014893 NM_014898 NM_014900 NM_014902 NM_014903 NM_014904 NM_014909 NM_014910 NM_014912 NM_014918 NM_014919 NM_014920 NM_014921 NM_014924 NM_014926 NM_014930 NM_014934 NM_014935 NM_014936 NM_014940 NM_014944 NM_014947 NM_014948 NM_014952 NM_014956 NM_014957 NM_014965 NM_014984 NM_014990 NM_014992 NM_014994 NM_015000 NM_015002 NM_015003 NM_015005 NM_015008 NM_015011 NM_015015 NM_015018 NM_015020 NM_015025 NM_015027 NM_015032 NM_015033 NM_015035 NM_015037 NM_015040 NM_015043 NM_015044 NM_015045 NM_015051 NM_015052 NM_015053 NM_015057 NM_015059 NM_015066 NM_015070 NM_015071 NM_015074 NM_015075 NM_015077 NM_015080 NM_015082 NM_015085 NM_015088 NM_015090 NM_015092 NM_015100 NM_015101 NM_015103 NM_015107 NM_015111 NM_015113 NM_015115 NM_015116 NM_015124 NM_015129 NM_015133 NM_015137 NM_015140 NM_015141 NM_015144 NM_015155 NM_015157 NM_015161 NM_015166 NM_015171 NM_015173 NM_015178 NM_015179 NM_015180 NM_015191 NM_015192 NM_015193 NM_015194 NM_015198 NM_015202 NM_015205 NM_015206 NM_015208 NM_015213 NM_015219 NM_015226 NM_015227 NM_015229 NM_015236 NM_015238 NM_015245 NM_015246 NM_015251 NM_015253 NM_015254 NM_015257 NM_015262 NM_015264 NM_015265 NM_015266 NM_015267 NM_015270 NM_015271 NM_015278 NM_015285 NM_015286 NM_015288 NM_015289 NM_015293 NM_015296 NM_015299 NM_015305 NM_015308 NM_015310 NM_015313 NM_015315 NM_015316 NM_015318 NM_015320 NM_015326 NM_015327 NM_015328 NM_015329 NM_015330 NM_015332 NM_015338 NM_015339 NM_015340 NM_015344 NM_015345 NM_015347 NM_015352 NM_015359 NM_015366 NM_015373 NM_015374 NM_015375 NM_015378 NM_015379 NM_015385 NM_015387 NM_015393 NM_015394 NM_015395 NM_015398 NM_015399 NM_015401 NM_015409 NM_015411 NM_015416 NM_015421 NM_015426 NM_015432 NM_015435 NM_015436 NM_015438 NM_015439 NM_015441 NM_015443 NM_015447 NM_015455 NM_015456 NM_015458 NM_015460 NM_015461 NM_015466 NM_015470 NM_015476 NM_015477 NM_015488 NM_015490 NM_015492 NM_015506 NM_015508 NM_015511 NM_015516 NM_015530 NM_015534 NM_015535 NM_015537 NM_015541 NM_015544 NM_015545 NM_015549 NM_015550 NM_015553 NM_015554 NM_015555 NM_015557 NM_015560 NM_015564 NM_015565 NM_015568 NM_015577 NM_015596 NM_015603 NM_015605 NM_015608 NM_015621 NM_015630 NM_015640 NM_015641 NM_015649 NM_015651 NM_015654 NM_015655 NM_015657 NM_015658 NM_015670 NM_015695 NM_015696 NM_015711 NM_015715 NM_015840 NM_015841 NM_015844 NM_015846 NM_015847 NM_015850 NM_015852 NM_015853 NM_015874 NM_015886 NM_015909 NM_015910 NM_015917 NM_015937 NM_015938 NM_015946 NM_015947 NM_015949 NM_015952 NM_015955 NM_015959 NM_015963 NM_015974 NM_015980 NM_015981 NM_015983 NM_015994 NM_015995 NM_016001 NM_016008 NM_016018 NM_016023 NM_016026 NM_016032 NM_016055 NM_016060 NM_016065 NM_016068 NM_016071 NM_016083 NM_016096 NM_016099 NM_016104 NM_016107 NM_016109 NM_016111 NM_016114 NM_016118 NM_016120 NM_016122 NM_016124 NM_016129 NM_016131 NM_016133 NM_016139 NM_016143 NM_016147 NM_016156 NM_016169 NM_016173 NM_016174 NM_016176 NM_016179 NM_016196 NM_016201 NM_016205 NM_016219 NM_016220 NM_016223 NM_016224 NM_016225 NM_016235 NM_016239 NM_016240 NM_016243 NM_016245 NM_016248 NM_016263 NM_016264 NM_016272 NM_016275 NM_016276 NM_016280 NM_016282 NM_016289 NM_016301 NM_016305 NM_016308 NM_016315 NM_016320 NM_016322 NM_016327 NM_016329 NM_016331 NM_016338 NM_016348 NM_016360 NM_016369 NM_016372 NM_016374 NM_016376 NM_016389 NM_016391 NM_016396 NM_016400 NM_016412 NM_016418 NM_016422 NM_016424 NM_016442 NM_016456 NM_016458 NM_016464 NM_016466 NM_016470 NM_016479 NM_016481 NM_016484 NM_016485 NM_016496 NM_016499 NM_016512 NM_016513 NM_016522 NM_016526 NM_016529 NM_016530 NM_016531 NM_016532 NM_016534 NM_016540 NM_016544 NM_016545 NM_016547 NM_016553 NM_016562 NM_016563 NM_016564 NM_016575 NM_016577 NM_016580 NM_016581 NM_016584 NM_016592 NM_016596 NM_016598 NM_016604 NM_016605 NM_016607 NM_016611 NM_016612 NM_016641 NM_016642 NM_016647 NM_016651 NM_016733 NM_016735 NM_016818 NM_016821 NM_016826 NM_016827 NM_016828 NM_016829 NM_016830 NM_016848 NM_016930 NM_016931 NM_016936 NM_016946 NM_017409 NM_017411 NM_017414 NM_017415 NM_017420 NM_017431 NM_017432 NM_017433 NM_017435 NM_017437 NM_017438 NM_017443 NM_017450 NM_017452 NM_017453 NM_017454 NM_017459 NM_017491 NM_017495 NM_017506 NM_017510 NM_017514 NM_017515 NM_017518 NM_017519 NM_017522 NM_017523 NM_017526 NM_017530 NM_017540 NM_017549 NM_017554 NM_017582 NM_017583 NM_017586 NM_017588 NM_017590 NM_017592 NM_017594 NM_017599 NM_017617 NM_017622 NM_017623 NM_017626 NM_017628 NM_017635 NM_017637 NM_017638 NM_017641 NM_017646 NM_017647 NM_017655 NM_017656 NM_017666 NM_017668 NM_017673 NM_017679 NM_017688 NM_017692 NM_017701 NM_017703 NM_017705 NM_017707 NM_017709 NM_017712 NM_017713 NM_017715 NM_017717 NM_017719 NM_017723 NM_017728 NM_017730 NM_017740 NM_017751 NM_017753 NM_017755 NM_017759 NM_017763 NM_017765 NM_017766 NM_017772 NM_017775 NM_017776 NM_017777 NM_017785 NM_017787 NM_017789 NM_017791 NM_017797 NM_017799 NM_017801 NM_017802 NM_017804 NM_017811 NM_017812 NM_017825 NM_017828 NM_017829 NM_017836 NM_017848 NM_017849 NM_017851 NM_017855 NM_017856 NM_017857 NM_017861 NM_017873 NM_017876 NM_017882 NM_017884 NM_017890 NM_017891 NM_017893 NM_017896 NM_017902 NM_017911 NM_017913 NM_017921 NM_017931 NM_017938 NM_017939 NM_017943 NM_017951 NM_017953 NM_017957 NM_017958 NM_017966 NM_017974 NM_017980 NM_017982 NM_017983 NM_017986 NM_017987 NM_017990 NM_017991 NM_017993 NM_017994 NM_017999 NM_018013 NM_018022 NM_018024 NM_018026 NM_018031 NM_018035 NM_018038 NM_018043 NM_018048 NM_018051 NM_018053 NM_018057 NM_018059 NM_018068 NM_018075 NM_018076 NM_018077 NM_018079 NM_018088 NM_018091 NM_018096 NM_018107 NM_018108 NM_018109 NM_018110 NM_018113 NM_018115 NM_018117 NM_018119 NM_018121 NM_018126 NM_018129 NM_018134 NM_018149 NM_018150 NM_018156 NM_018159 NM_018184 NM_018188 NM_018191 NM_018200 NM_018203 NM_018205 NM_018207 NM_018208 NM_018209 NM_018211 NM_018212 NM_018214 NM_018222 NM_018224 NM_018227 NM_018229 NM_018233 NM_018234 NM_018239 NM_018240 NM_018242 NM_018243 NM_018244 NM_018245 NM_018246 NM_018254 NM_018256 NM_018260 NM_018263 NM_018264 NM_018265 NM_018266 NM_018270 NM_018276 NM_018279 NM_018281 NM_018293 NM_018300 NM_018306 NM_018308 NM_018312 NM_018319 NM_018322 NM_018330 NM_018334 NM_018342 NM_018348 NM_018355 NM_018356 NM_018364 NM_018366 NM_018370 NM_018373 NM_018381 NM_018383 NM_018388 NM_018389 NM_018404 NM_018406 NM_018409 NM_018416 NM_018420 NM_018424 NM_018427 NM_018438 NM_018439 NM_018440 NM_018446 NM_018451 NM_018452 NM_018461 NM_018462 NM_018463 NM_018469 NM_018482 NM_018484 NM_018490 NM_018492 NM_018498 NM_018509 NM_018553 NM_018569 NM_018579 NM_018644 NM_018646 NM_018655 NM_018658 NM_018660 NM_018662 NM_018664 NM_018667 NM_018671 NM_018672 NM_018688 NM_018689 NM_018697 NM_018700 NM_018704 NM_018706 NM_018712 NM_018715 NM_018717 NM_018719 NM_018728 NM_018837 NM_018839 NM_018844 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018933 NM_018937 NM_018941 NM_018945 NM_018947 NM_018948 NM_018960 NM_018963 NM_018964 NM_018970 NM_018976 NM_018981 NM_018984 NM_018987 NM_018990 NM_018993 NM_018994 NM_018995 NM_018998 NM_018999 NM_019006 NM_019008 NM_019009 NM_019035 NM_019036 NM_019040 NM_019061 NM_019063 NM_019064 NM_019074 NM_019080 NM_019081 NM_019083 NM_019084 NM_019089 NM_019094 NM_019096 NM_019099 NM_019106 NM_019109 NM_019117 NM_019118 NM_019555 NM_019590 NM_019594 NM_019607 NM_019618 NM_019841 NM_019854 NM_019857 NM_019885 NM_019887 NM_019892 NM_020037 NM_020038 NM_020064 NM_020119 NM_020122 NM_020123 NM_020124 NM_020125 NM_020126 NM_020127 NM_020130 NM_020131 NM_020132 NM_020133 NM_020141 NM_020142 NM_020144 NM_020145 NM_020148 NM_020150 NM_020162 NM_020167 NM_020170 NM_020178 NM_020182 NM_020184 NM_020185 NM_020190 NM_020193 NM_020200 NM_020208 NM_020210 NM_020211 NM_020219 NM_020227 NM_020228 NM_020230 NM_020231 NM_020245 NM_020246 NM_020248 NM_020314 NM_020315 NM_020323 NM_020324 NM_020325 NM_020326 NM_020335 NM_020337 NM_020338 NM_020340 NM_020341 NM_020342 NM_020345 NM_020347 NM_020361 NM_020362 NM_020381 NM_020385 NM_020395 NM_020398 NM_020416 NM_020421 NM_020422 NM_020424 NM_020427 NM_020429 NM_020431 NM_020432 NM_020433 NM_020435 NM_020438 NM_020440 NM_020443 NM_020448 NM_020451 NM_020453 NM_020462 NM_020465 NM_020467 NM_020472 NM_020473 NM_020475 NM_020476 NM_020477 NM_020478 NM_020479 NM_020480 NM_020481 NM_020526 NM_020638 NM_020639 NM_020645 NM_020647 NM_020649 NM_020655 NM_020657 NM_020663 NM_020682 NM_020684 NM_020686 NM_020697 NM_020698 NM_020699 NM_020701 NM_020702 NM_020708 NM_020711 NM_020713 NM_020714 NM_020717 NM_020724 NM_020727 NM_020732 NM_020742 NM_020746 NM_020749 NM_020754 NM_020761 NM_020762 NM_020766 NM_020768 NM_020770 NM_020773 NM_020775 NM_020776 NM_020778 NM_020779 NM_020781 NM_020782 NM_020783 NM_020784 NM_020786 NM_020792 NM_020795 NM_020802 NM_020805 NM_020807 NM_020810 NM_020813 NM_020814 NM_020816 NM_020819 NM_020825 NM_020826 NM_020828 NM_020830 NM_020834 NM_020836 NM_020839 NM_020841 NM_020850 NM_020851 NM_020853 NM_020858 NM_020863 NM_020870 NM_020871 NM_020873 NM_020880 NM_020896 NM_020899 NM_020909 NM_020917 NM_020918 NM_020919 NM_020921 NM_020924 NM_020925 NM_020926 NM_020927 NM_020932 NM_020933 NM_020935 NM_020940 NM_020954 NM_020956 NM_020958 NM_020960 NM_020962 NM_020971 NM_020977 NM_020980 NM_020983 NM_020993 NM_021004 NM_021020 NM_021032 NM_021047 NM_021064 NM_021067 NM_021070 NM_021071 NM_021096 NM_021101 NM_021104 NM_021115 NM_021116 NM_021117 NM_021127 NM_021128 NM_021132 NM_021134 NM_021135 NM_021143 NM_021149 NM_021151 NM_021155 NM_021156 NM_021158 NM_021160 NM_021164 NM_021168 NM_021170 NM_021183 NM_021189 NM_021190 NM_021201 NM_021202 NM_021204 NM_021205 NM_021213 NM_021224 NM_021240 NM_021248 NM_021249 NM_021252 NM_021253 NM_021255 NM_021258 NM_021267 NM_021269 NM_021574 NM_021612 NM_021615 NM_021619 NM_021624 NM_021632 NM_021633 NM_021638 NM_021641 NM_021643 NM_021645 NM_021646 NM_021648 NM_021649 NM_021705 NM_021735 NM_021736 NM_021737 NM_021783 NM_021805 NM_021808 NM_021812 NM_021813 NM_021823 NM_021825 NM_021903 NM_021904 NM_021905 NM_021910 NM_021914 NM_021916 NM_021943 NM_021946 NM_021947 NM_021949 NM_021950 NM_021956 NM_021959 NM_021961 NM_021962 NM_021963 NM_021966 NM_021977 NM_021983 NM_021991 NM_021998 NM_022003 NM_022039 NM_022041 NM_022042 NM_022050 NM_022054 NM_022060 NM_022066 NM_022080 NM_022081 NM_022082 NM_022085 NM_022087 NM_022093 NM_022099 NM_022112 NM_022114 NM_022117 NM_022131 NM_022132 NM_022133 NM_022135 NM_022139 NM_022150 NM_022152 NM_022153 NM_022166 NM_022171 NM_022336 NM_022337 NM_022343 NM_022344 NM_022351 NM_022357 NM_022358 NM_022362 NM_022372 NM_022405 NM_022444 NM_022445 NM_022450 NM_022452 NM_022459 NM_022464 NM_022465 NM_022468 NM_022469 NM_022474 NM_022479 NM_022480 NM_022482 NM_022483 NM_022484 NM_022489 NM_022490 NM_022491 NM_022497 NM_022549 NM_022555 NM_022557 NM_022562 NM_022571 NM_022572 NM_022640 NM_022644 NM_022648 NM_022652 NM_022718 NM_022720 NM_022727 NM_022742 NM_022744 NM_022745 NM_022749 NM_022750 NM_022755 NM_022757 NM_022758 NM_022759 NM_022766 NM_022767 NM_022768 NM_022769 NM_022770 NM_022773 NM_022777 NM_022780 NM_022781 NM_022783 NM_022786 NM_022791 NM_022803 NM_022817 NM_022821 NM_022824 NM_022827 NM_022829 NM_022832 NM_022833 NM_022836 NM_022837 NM_022874 NM_022875 NM_022876 NM_022877 NM_022895 NM_022898 NM_022900 NM_022903 NM_022905 NM_022910 NM_022912 NM_022917 NM_022971 NM_023005 NM_023007 NM_023008 NM_023032 NM_023037 NM_023038 NM_023067 NM_023071 NM_023075 NM_023105 NM_023106 NM_023109 NM_023111 NM_023112 NM_023914 NM_023923 NM_023924 NM_023928 NM_023931 NM_023934 NM_023935 NM_023938 NM_023943 NM_023947 NM_024009 NM_024032 NM_024033 NM_024046 NM_024050 NM_024052 NM_024053 NM_024061 NM_024067 NM_024082 NM_024085 NM_024086 NM_024092 NM_024100 NM_024113 NM_024294 NM_024295 NM_024300 NM_024301 NM_024308 NM_024312 NM_024319 NM_024321 NM_024324 NM_024327 NM_024330 NM_024334 NM_024336 NM_024342 NM_024408 NM_024419 NM_024492 NM_024498 NM_024501 NM_024511 NM_024512 NM_024513 NM_024517 NM_024535 NM_024536 NM_024539 NM_024551 NM_024552 NM_024554 NM_024556 NM_024567 NM_024585 NM_024586 NM_024587 NM_024588 NM_024590 NM_024591 NM_024605 NM_024607 NM_024613 NM_024614 NM_024617 NM_024618 NM_024623 NM_024627 NM_024630 NM_024636 NM_024638 NM_024647 NM_024659 NM_024661 NM_024665 NM_024666 NM_024667 NM_024669 NM_024676 NM_024681 NM_024683 NM_024692 NM_024699 NM_024700 NM_024701 NM_024704 NM_024709 NM_024710 NM_024711 NM_024712 NM_024719 NM_024733 NM_024735 NM_024736 NM_024738 NM_024740 NM_024742 NM_024751 NM_024754 NM_024757 NM_024760 NM_024761 NM_024771 NM_024779 NM_024782 NM_024789 NM_024791 NM_024792 NM_024793 NM_024796 NM_024805 NM_024812 NM_024813 NM_024819 NM_024828 NM_024832 NM_024834 NM_024836 NM_024843 NM_024845 NM_024847 NM_024854 NM_024855 NM_024859 NM_024861 NM_024864 NM_024866 NM_024874 NM_024881 NM_024882 NM_024889 NM_024893 NM_024896 NM_024900 NM_024901 NM_024911 NM_024913 NM_024915 NM_024924 NM_024930 NM_024935 NM_024938 NM_024939 NM_024940 NM_024946 NM_024954 NM_024955 NM_024959 NM_024969 NM_024974 NM_024989 NM_025010 NM_025019 NM_025040 NM_025047 NM_025049 NM_025057 NM_025058 NM_025061 NM_025072 NM_025074 NM_025078 NM_025079 NM_025082 NM_025083 NM_025084 NM_025090 NM_025097 NM_025099 NM_025104 NM_025106 NM_025112 NM_025130 NM_025138 NM_025140 NM_025146 NM_025151 NM_025154 NM_025160 NM_025161 NM_025169 NM_025187 NM_025189 NM_025191 NM_025194 NM_025201 NM_025203 NM_025204 NM_025209 NM_025213 NM_025219 NM_025222 NM_025224 NM_025225 NM_025230 NM_025235 NM_025236 NM_025240 NM_025243 NM_025247 NM_025250 NM_025251 NM_025259 NM_025264 NM_030568 NM_030569 NM_030576 NM_030579 NM_030593 NM_030594 NM_030621 NM_030626 NM_030627 NM_030630 NM_030637 NM_030639 NM_030643 NM_030648 NM_030651 NM_030653 NM_030655 NM_030660 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030674 NM_030753 NM_030756 NM_030760 NM_030761 NM_030762 NM_030770 NM_030776 NM_030777 NM_030781 NM_030789 NM_030792 NM_030798 NM_030803 NM_030806 NM_030807 NM_030809 NM_030810 NM_030813 NM_030814 NM_030815 NM_030877 NM_030883 NM_030884 NM_030907 NM_030914 NM_030915 NM_030916 NM_030918 NM_030919 NM_030925 NM_030926 NM_030927 NM_030928 NM_030940 NM_030945 NM_030956 NM_030959 NM_030961 NM_030962 NM_030968 NM_030972 NM_030981 NM_031200 NM_031203 NM_031211 NM_031218 NM_031226 NM_031227 NM_031228 NM_031244 NM_031265 NM_031268 NM_031271 NM_031281 NM_031295 NM_031298 NM_031305 NM_031310 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031409 NM_031411 NM_031412 NM_031417 NM_031419 NM_031422 NM_031426 NM_031430 NM_031432 NM_031433 NM_031436 NM_031437 NM_031444 NM_031445 NM_031459 NM_031462 NM_031463 NM_031468 NM_031469 NM_031474 NM_031475 NM_031476 NM_031477 NM_031485 NM_031498 NM_031849 NM_031857 NM_031860 NM_031886 NM_031887 NM_031890 NM_031897 NM_031904 NM_031911 NM_031912 NM_031913 NM_031917 NM_031921 NM_031933 NM_031940 NM_031941 NM_031949 NM_031954 NM_031966 NM_031990 NM_031991 NM_032010 NM_032012 NM_032015 NM_032016 NM_032023 NM_032042 NM_032046 NM_032047 NM_032048 NM_032102 NM_032107 NM_032116 NM_032129 NM_032136 NM_032139 NM_032174 NM_032175 NM_032189 NM_032207 NM_032208 NM_032211 NM_032213 NM_032214 NM_032226 NM_032227 NM_032229 NM_032242 NM_032251 NM_032262 NM_032271 NM_032272 NM_032276 NM_032280 NM_032283 NM_032284 NM_032286 NM_032287 NM_032288 NM_032289 NM_032293 NM_032294 NM_032296 NM_032310 NM_032311 NM_032316 NM_032317 NM_032323 NM_032324 NM_032329 NM_032349 NM_032350 NM_032353 NM_032361 NM_032367 NM_032373 NM_032377 NM_032382 NM_032385 NM_032408 NM_032414 NM_032415 NM_032421 NM_032431 NM_032432 NM_032433 NM_032434 NM_032435 NM_032446 NM_032447 NM_032448 NM_032449 NM_032452 NM_032454 NM_032456 NM_032486 NM_032492 NM_032493 NM_032495 NM_032501 NM_032505 NM_032509 NM_032524 NM_032529 NM_032536 NM_032538 NM_032547 NM_032548 NM_032552 NM_032561 NM_032578 NM_032582 NM_032584 NM_032622 NM_032626 NM_032638 NM_032646 NM_032647 NM_032656 NM_032689 NM_032711 NM_032714 NM_032717 NM_032732 NM_032737 NM_032750 NM_032770 NM_032778 NM_032780 NM_032782 NM_032783 NM_032784 NM_032788 NM_032789 NM_032793 NM_032800 NM_032801 NM_032808 NM_032809 NM_032815 NM_032817 NM_032818 NM_032822 NM_032823 NM_032825 NM_032829 NM_032831 NM_032832 NM_032834 NM_032836 NM_032837 NM_032845 NM_032846 NM_032849 NM_032853 NM_032856 NM_032861 NM_032862 NM_032863 NM_032864 NM_032865 NM_032866 NM_032869 NM_032871 NM_032873 NM_032876 NM_032881 NM_032885 NM_032886 NM_032895 NM_032900 NM_032905 NM_032928 NM_032932 NM_032957 NM_032960 NM_032966 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032980 NM_032982 NM_032983 NM_032984 NM_032988 NM_032995 NM_032998 NM_032999 NM_033000 NM_033001 NM_033016 NM_033017 NM_033018 NM_033022 NM_033027 NM_033030 NM_033049 NM_033052 NM_033058 NM_033070 NM_033071 NM_033083 NM_033084 NM_033085 NM_033086 NM_033089 NM_033091 NM_033100 NM_033102 NM_033114 NM_033115 NM_033118 NM_033119 NM_033121 NM_033127 NM_033131 NM_033141 NM_033143 NM_033161 NM_033181 NM_033188 NM_033198 NM_033199 NM_033206 NM_033212 NM_033221 NM_033222 NM_033224 NM_033238 NM_033239 NM_033240 NM_033242 NM_033244 NM_033245 NM_033247 NM_033250 NM_033257 NM_033259 NM_033260 NM_033262 NM_033266 NM_033274 NM_033282 NM_033285 NM_033288 NM_033300 NM_033303 NM_033309 NM_033316 NM_033326 NM_033331 NM_033332 NM_033346 NM_033380 NM_033381 NM_033387 NM_033392 NM_033393 NM_033397 NM_033400 NM_033415 NM_033416 NM_033419 NM_033420 NM_033421 NM_033425 NM_033426 NM_033428 NM_033429 NM_033430 NM_033437 NM_033446 NM_033449 NM_033468 NM_033484 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033505 NM_033507 NM_033508 NM_033512 NM_033542 NM_033543 NM_033544 NM_033550 NM_033551 NM_033557 NM_033624 NM_033631 NM_033633 NM_033634 NM_033635 NM_033636 NM_033637 NM_033640 NM_033641 NM_033642 NM_033644 NM_033645 NM_033655 NM_033656 NM_033666 NM_052811 NM_052818 NM_052821 NM_052832 NM_052834 NM_052839 NM_052843 NM_052846 NM_052849 NM_052851 NM_052859 NM_052864 NM_052869 NM_052874 NM_052876 NM_052877 NM_052878 NM_052879 NM_052880 NM_052896 NM_052898 NM_052901 NM_052906 NM_052909 NM_052910 NM_052911 NM_052916 NM_052918 NM_052919 NM_052926 NM_052934 NM_052935 NM_052936 NM_052937 NM_052939 NM_052941 NM_052949 NM_052954 NM_052957 NM_052960 NM_052962 NM_052978 NM_053005 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053035 NM_053036 NM_053039 NM_053042 NM_053052 NM_053055 NM_053277 NM_053282 NM_053286 NM_054013 NM_054025 NM_054026 NM_054030 NM_054033 NM_054114 NM_057088 NM_057162 NM_057174 NM_057175 NM_057179 NM_057735 NM_057749 NM_058004 NM_058163 NM_058164 NM_058166 NM_058172 NM_058178 NM_058180 NM_058182 NM_058200 NM_058201 NM_058202 NM_058206 NM_058207 NM_058240 NM_058244 NM_058246 NM_078467 NM_078471 NM_078473 NM_078476 NM_078481 NM_078483 NM_078628 NM_079421 NM_079834 NM_080385 NM_080417 NM_080476 NM_080491 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080591 NM_080605 NM_080607 NM_080616 NM_080621 NM_080629 NM_080630 NM_080645 NM_080652 NM_080654 NM_080660 NM_080668 NM_080671 NM_080679 NM_080680 NM_080681 NM_080682 NM_080723 NM_080725 NM_080730 NM_080731 NM_080740 NM_080749 NM_080759 NM_080760 NM_080792 NM_080819 NM_080821 NM_080836 NM_080867 NM_080872 NM_080876 NM_080927 NM_101395 NM_130386 NM_130436 NM_130437 NM_130438 NM_130439 NM_130440 NM_130443 NM_130446 NM_130459 NM_130465 NM_130466 NM_130468 NM_130470 NM_130471 NM_130472 NM_130473 NM_130474 NM_130475 NM_130476 NM_130766 NM_130781 NM_130783 NM_130787 NM_130806 NM_130807 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130847 NM_133170 NM_133175 NM_133176 NM_133178 NM_133259 NM_133274 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133367 NM_133369 NM_133443 NM_133445 NM_133448 NM_133451 NM_133456 NM_133460 NM_133463 NM_133464 NM_133465 NM_133468 NM_133474 NM_133476 NM_133480 NM_133481 NM_133484 NM_133496 NM_133497 NM_133509 NM_133627 NM_133628 NM_133630 NM_133631 NM_133650 NM_134268 NM_134325 NM_134421 NM_134422 NM_134433 NM_134444 NM_138286 NM_138293 NM_138294 NM_138297 NM_138298 NM_138299 NM_138300 NM_138319 NM_138338 NM_138344 NM_138347 NM_138348 NM_138349 NM_138356 NM_138357 NM_138358 NM_138368 NM_138372 NM_138373 NM_138375 NM_138384 NM_138385 NM_138393 NM_138399 NM_138400 NM_138409 NM_138423 NM_138440 NM_138441 NM_138444 NM_138450 NM_138453 NM_138454 NM_138456 NM_138460 NM_138494 NM_138565 NM_138572 NM_138576 NM_138578 NM_138608 NM_138614 NM_138619 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138638 NM_138640 NM_138694 NM_138707 NM_138713 NM_138714 NM_138717 NM_138726 NM_138730 NM_138732 NM_138734 NM_138737 NM_138764 NM_138766 NM_138782 NM_138793 NM_138797 NM_138802 NM_138805 NM_138809 NM_138813 NM_138821 NM_138822 NM_138929 NM_138930 NM_138934 NM_138959 NM_138967 NM_138971 NM_138972 NM_138973 NM_138993 NM_138998 NM_139015 NM_139016 NM_139018 NM_139022 NM_139024 NM_139028 NM_139057 NM_139071 NM_139072 NM_139075 NM_139132 NM_139136 NM_139156 NM_139157 NM_139168 NM_139170 NM_139178 NM_139179 NM_139202 NM_139207 NM_139211 NM_139212 NM_139235 NM_139238 NM_139244 NM_139245 NM_139246 NM_139264 NM_139265 NM_139275 NM_139276 NM_139278 NM_139279 NM_139280 NM_139283 NM_139314 NM_139316 NM_139319 NM_139323 NM_144492 NM_144498 NM_144499 NM_144502 NM_144503 NM_144504 NM_144564 NM_144566 NM_144570 NM_144573 NM_144575 NM_144579 NM_144581 NM_144582 NM_144583 NM_144588 NM_144591 NM_144593 NM_144599 NM_144600 NM_144607 NM_144609 NM_144611 NM_144613 NM_144633 NM_144635 NM_144636 NM_144642 NM_144647 NM_144661 NM_144662 NM_144664 NM_144667 NM_144670 NM_144671 NM_144678 NM_144682 NM_144684 NM_144690 NM_144692 NM_144693 NM_144707 NM_144713 NM_144716 NM_144718 NM_144721 NM_144723 NM_144765 NM_144962 NM_144968 NM_144973 NM_144974 NM_144984 NM_144990 NM_144991 NM_144994 NM_145003 NM_145006 NM_145010 NM_145011 NM_145015 NM_145025 NM_145033 NM_145039 NM_145044 NM_145051 NM_145052 NM_145055 NM_145060 NM_145065 NM_145071 NM_145109 NM_145110 NM_145114 NM_145115 NM_145117 NM_145159 NM_145160 NM_145162 NM_145166 NM_145173 NM_145175 NM_145179 NM_145187 NM_145188 NM_145189 NM_145190 NM_145207 NM_145214 NM_145230 NM_145231 NM_145234 NM_145245 NM_145250 NM_145257 NM_145263 NM_145278 NM_145279 NM_145297 NM_145301 NM_145304 NM_145310 NM_145312 NM_145316 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145325 NM_145331 NM_145332 NM_145333 NM_145349 NM_145350 NM_145351 NM_145638 NM_145649 NM_145652 NM_145655 NM_145660 NM_145685 NM_145686 NM_145687 NM_145690 NM_145693 NM_145727 NM_145728 NM_145730 NM_145733 NM_145734 NM_145735 NM_145759 NM_145762 NM_145763 NM_145799 NM_145803 NM_145806 NM_145807 NM_145808 NM_145814 NM_145815 NM_145818 NM_145868 NM_145869 NM_145891 NM_145892 NM_145893 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145906 NM_145912 NM_147129 NM_147131 NM_147132 NM_147147 NM_147152 NM_147157 NM_147158 NM_147159 NM_147160 NM_147161 NM_147180 NM_147187 NM_147189 NM_147192 NM_147193 NM_147195 NM_147196 NM_147197 NM_147200 NM_147202 NM_147686 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_148175 NM_148176 NM_148571 NM_148842 NM_148904 NM_148905 NM_148906 NM_148907 NM_148908 NM_148909 NM_148915 NM_148920 NM_148957 NM_148960 NM_148964 NM_152133 NM_152222 NM_152233 NM_152236 NM_152237 NM_152244 NM_152245 NM_152247 NM_152253 NM_152260 NM_152262 NM_152264 NM_152267 NM_152270 NM_152272 NM_152288 NM_152289 NM_152296 NM_152298 NM_152300 NM_152301 NM_152305 NM_152314 NM_152330 NM_152332 NM_152333 NM_152335 NM_152340 NM_152341 NM_152346 NM_152354 NM_152356 NM_152357 NM_152361 NM_152367 NM_152374 NM_152375 NM_152376 NM_152377 NM_152380 NM_152389 NM_152399 NM_152404 NM_152414 NM_152416 NM_152418 NM_152424 NM_152428 NM_152433 NM_152439 NM_152446 NM_152449 NM_152451 NM_152456 NM_152470 NM_152472 NM_152473 NM_152477 NM_152482 NM_152496 NM_152507 NM_152520 NM_152533 NM_152536 NM_152547 NM_152550 NM_152551 NM_152553 NM_152554 NM_152559 NM_152562 NM_152564 NM_152569 NM_152597 NM_152603 NM_152610 NM_152622 NM_152624 NM_152626 NM_152635 NM_152636 NM_152643 NM_152653 NM_152665 NM_152673 NM_152675 NM_152680 NM_152681 NM_152684 NM_152686 NM_152689 NM_152693 NM_152695 NM_152701 NM_152702 NM_152716 NM_152717 NM_152721 NM_152736 NM_152737 NM_152749 NM_152754 NM_152765 NM_152776 NM_152778 NM_152780 NM_152783 NM_152793 NM_152829 NM_152831 NM_152834 NM_152835 NM_152836 NM_152837 NM_152840 NM_152841 NM_152842 NM_152843 NM_152854 NM_152857 NM_152858 NM_152864 NM_152866 NM_152868 NM_152878 NM_152879 NM_152889 NM_152903 NM_152906 NM_152910 NM_152913 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152925 NM_152926 NM_152927 NM_152928 NM_152929 NM_152930 NM_152931 NM_152932 NM_152939 NM_152942 NM_152995 NM_153022 NM_153023 NM_153029 NM_153031 NM_153032 NM_153033 NM_153034 NM_153035 NM_153040 NM_153044 NM_153045 NM_153183 NM_153201 NM_153208 NM_153213 NM_153214 NM_153215 NM_153220 NM_153229 NM_153231 NM_153235 NM_153237 NM_153238 NM_153239 NM_153246 NM_153254 NM_153256 NM_153260 NM_153263 NM_153271 NM_153273 NM_153320 NM_153321 NM_153322 NM_153334 NM_153340 NM_153343 NM_153347 NM_153354 NM_153355 NM_153360 NM_153364 NM_153367 NM_153442 NM_153451 NM_153456 NM_153460 NM_153461 NM_153462 NM_153463 NM_153464 NM_153487 NM_153497 NM_153499 NM_153500 NM_153607 NM_153611 NM_153613 NM_153616 NM_153617 NM_153618 NM_153619 NM_153639 NM_153645 NM_153649 NM_153683 NM_153684 NM_153687 NM_153691 NM_153701 NM_153703 NM_153712 NM_153714 NM_153717 NM_153718 NM_153719 NM_153746 NM_153748 NM_153810 NM_153812 NM_153823 NM_153824 NM_153826 NM_153831 NM_153832 NM_170662 NM_170672 NM_170686 NM_170693 NM_170707 NM_170708 NM_170710 NM_170719 NM_170720 NM_170726 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170743 NM_170750 NM_170769 NM_170770 NM_170773 NM_170774 NM_170776 NM_170781 NM_171825 NM_171982 NM_171998 NM_172005 NM_172016 NM_172027 NM_172028 NM_172069 NM_172097 NM_172098 NM_172101 NM_172102 NM_172106 NM_172107 NM_172108 NM_172110 NM_172111 NM_172112 NM_172113 NM_172159 NM_172164 NM_172165 NM_172166 NM_172206 NM_172207 NM_172213 NM_172216 NM_172217 NM_172225 NM_172226 NM_172230 NM_172232 NM_172234 NM_172241 NM_172248 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172387 NM_172388 NM_172389 NM_173042 NM_173043 NM_173044 NM_173054 NM_173060 NM_173064 NM_173065 NM_173074 NM_173075 NM_173076 NM_173078 NM_173170 NM_173177 NM_173201 NM_173214 NM_173215 NM_173216 NM_173217 NM_173342 NM_173352 NM_173354 NM_173355 NM_173459 NM_173464 NM_173465 NM_173468 NM_173470 NM_173471 NM_173477 NM_173487 NM_173491 NM_173494 NM_173501 NM_173502 NM_173507 NM_173509 NM_173510 NM_173518 NM_173524 NM_173528 NM_173530 NM_173531 NM_173532 NM_173535 NM_173536 NM_173542 NM_173543 NM_173546 NM_173551 NM_173555 NM_173558 NM_173561 NM_173562 NM_173564 NM_173579 NM_173580 NM_173591 NM_173602 NM_173607 NM_173608 NM_173610 NM_173611 NM_173614 NM_173617 NM_173619 NM_173621 NM_173630 NM_173631 NM_173632 NM_173640 NM_173641 NM_173652 NM_173659 NM_173660 NM_173661 NM_173664 NM_173667 NM_173669 NM_173673 NM_173675 NM_173680 NM_173681 NM_173698 NM_173700 NM_173728 NM_173795 NM_173800 NM_173808 NM_173809 NM_173841 NM_173842 NM_173843 NM_173872 NM_174869 NM_174871 NM_174880 NM_174891 NM_174902 NM_174911 NM_174917 NM_174918 NM_174921 NM_174934 NM_174940 NM_174950 NM_174963 NM_174964 NM_174965 NM_174966 NM_174967 NM_174968 NM_174969 NM_174970 NM_174971 NM_174972 NM_174975 NM_175062 NM_175063 NM_175069 NM_175071 NM_175072 NM_175073 NM_175077 NM_175567 NM_175568 NM_175569 NM_175571 NM_175609 NM_175616 NM_175630 NM_175709 NM_175736 NM_175768 NM_175847 NM_175848 NM_175849 NM_175850 NM_175859 NM_175863 NM_175864 NM_175866 NM_175872 NM_175873 NM_175875 NM_175876 NM_175884 NM_175900 NM_175907 NM_175908 NM_175910 NM_175921 NM_175924 NM_175931 NM_176084 NM_176085 NM_176095 NM_176677 NM_176786 NM_176787 NM_176792 NM_176799 NM_176801 NM_176815 NM_176823 NM_176853 NM_176871 NM_176874 NM_176891 NM_176894 NM_177404 NM_177414 NM_177415 NM_177427 NM_177436 NM_177438 NM_177442 NM_177532 NM_177550 NM_177555 NM_177558 NM_177559 NM_177560 NM_177947 NM_177948 NM_177963 NM_177967 NM_177968 NM_177969 NM_177972 NM_177974 NM_177977 NM_177978 NM_177979 NM_177990 NM_177999 NM_178004 NM_178006 NM_178007 NM_178009 NM_178013 NM_178120 NM_178122 NM_178126 NM_178128 NM_178136 NM_178145 NM_178151 NM_178152 NM_178153 NM_178159 NM_178170 NM_178177 NM_178181 NM_178225 NM_178226 NM_178229 NM_178270 NM_178271 NM_178276 NM_178326 NM_178351 NM_178493 NM_178507 NM_178508 NM_178509 NM_178514 NM_178516 NM_178519 NM_178520 NM_178526 NM_178532 NM_178542 NM_178545 NM_178546 NM_178554 NM_178557 NM_178569 NM_178580 NM_178581 NM_178582 NM_178586 NM_178812 NM_178813 NM_178823 NM_178830 NM_178831 NM_178832 NM_178834 NM_178836 NM_178837 NM_178838 NM_178841 NM_178849 NM_180976 NM_180977 NM_180991 NM_181041 NM_181054 NM_181076 NM_181077 NM_181265 NM_181309 NM_181310 NM_181314 NM_181332 NM_181333 NM_181349 NM_181354 NM_181355 NM_181357 NM_181358 NM_181361 NM_181425 NM_181430 NM_181431 NM_181435 NM_181442 NM_181466 NM_181467 NM_181468 NM_181469 NM_181471 NM_181481 NM_181482 NM_181483 NM_181484 NM_181489 NM_181491 NM_181492 NM_181501 NM_181502 NM_181507 NM_181508 NM_181531 NM_181618 NM_181642 NM_181643 NM_181659 NM_181689 NM_181690 NM_181701 NM_181704 NM_181705 NM_181706 NM_181709 NM_181713 NM_181716 NM_181722 NM_181740 NM_181762 NM_181777 NM_181782 NM_181786 NM_181787 NM_181789 NM_181804 NM_181805 NM_181808 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181838 NM_181839 NM_181844 NM_181846 NM_181876 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_182314 NM_182470 NM_182471 NM_182481 NM_182482 NM_182483 NM_182484 NM_182485 NM_182492 NM_182494 NM_182501 NM_182502 NM_182503 NM_182507 NM_182508 NM_182510 NM_182511 NM_182516 NM_182520 NM_182526 NM_182527 NM_182531 NM_182533 NM_182534 NM_182535 NM_182537 NM_182538 NM_182554 NM_182557 NM_182558 NM_182562 NM_182565 NM_182568 NM_182578 NM_182583 NM_182584 NM_182587 NM_182597 NM_182598 NM_182603 NM_182605 NM_182609 NM_182612 NM_182613 NM_182616 NM_182619 NM_182620 NM_182631 NM_182637 NM_182638 NM_182640 NM_182641 NM_182646 NM_182647 NM_182648 NM_182661 NM_182663 NM_182664 NM_182665 NM_182686 NM_182687 NM_182688 NM_182691 NM_182692 NM_182697 NM_182712 NM_182728 NM_182734 NM_182740 NM_182752 NM_182759 NM_182761 NM_182775 NM_182791 NM_182796 NM_182811 NM_182812 NM_182827 NM_182830 NM_182848 NM_182894 NM_182895 NM_182904 NM_182907 NM_182909 NM_182910 NM_182912 NM_182913 NM_182914 NM_182915 NM_182918 NM_182932 NM_182933 NM_182934 NM_182935 NM_182936 NM_182943 NM_182948 NM_182961 NM_182964 NM_182970 NM_182984 NM_183002 NM_183004 NM_183006 NM_183040 NM_183059 NM_183061 NM_183075 NM_183079 NM_183243 NM_183353 NM_183373 NM_183377 NM_183385 NM_183393 NM_183394 NM_183397 NM_183414 NM_183415 NM_183419 NM_183425 NM_184042 NM_184085 NM_184086 NM_184087 NM_194252 NM_194255 NM_194259 NM_194260 NM_194261 NM_194277 NM_194278 NM_194280 NM_194283 NM_194285 NM_194286 NM_194287 NM_194288 NM_194291 NM_194294 NM_194295 NM_194301 NM_194309 NM_194310 NM_194312 NM_194313 NM_194314 NM_194318 NM_194324 NM_194325 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194356 NM_194358 NM_194359 NM_194428 NM_194429 NM_194439 NM_194460 NM_194463 NM_197941 NM_197956 NM_197968 NM_197970 NM_198047 NM_198056 NM_198061 NM_198066 NM_198074 NM_198076 NM_198079 NM_198080 NM_198081 NM_198083 NM_198086 NM_198138 NM_198147 NM_198155 NM_198157 NM_198181 NM_198183 NM_198195 NM_198196 NM_198197 NM_198207 NM_198216 NM_198225 NM_198240 NM_198268 NM_198269 NM_198274 NM_198278 NM_198291 NM_198321 NM_198381 NM_198392 NM_198399 NM_198400 NM_198401 NM_198427 NM_198439 NM_198440 NM_198442 NM_198450 NM_198452 NM_198457 NM_198458 NM_198459 NM_198465 NM_198466 NM_198469 NM_198471 NM_198474 NM_198480 NM_198484 NM_198488 NM_198490 NM_198501 NM_198503 NM_198508 NM_198511 NM_198530 NM_198545 NM_198546 NM_198547 NM_198549 NM_198553 NM_198557 NM_198560 NM_198562 NM_198580 NM_198582 NM_198584 NM_198585 NM_198587 NM_198589 NM_198590 NM_198591 NM_198593 NM_198594 NM_198595 NM_198596 NM_198681 NM_198686 NM_198700 NM_198722 NM_198797 NM_198833 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198843 NM_198844 NM_198849 NM_198851 NM_198859 NM_198868 NM_198880 NM_198887 NM_198890 NM_198893 NM_198900 NM_198904 NM_198925 NM_198926 NM_198938 NM_198939 NM_198940 NM_198945 NM_198964 NM_198968 NM_198990 NM_198992 NM_199001 NM_199040 NM_199044 NM_199050 NM_199071 NM_199072 NM_199078 NM_199124 NM_199129 NM_199132 NM_199135 NM_199139 NM_199160 NM_199168 NM_199169 NM_199170 NM_199171 NM_199182 NM_199186 NM_199188 NM_199190 NM_199245 NM_199280 NM_199282 NM_199283 NM_199327 NM_199343 NM_199345 NM_199355 NM_199358 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199413 NM_199414 NM_199415 NM_199420 NM_199421 NM_199424 NM_199437 NM_199438 NM_199439 NM_199451 NM_199452 NM_199454 NM_199459 NM_199461 NM_199462 NM_199482 NM_199487 NM_199511 NM_199512 NM_199513 NM_201252 NM_201253 NM_201278 NM_201280 NM_201281 NM_201399 NM_201403 NM_201431 NM_201432 NM_201433 NM_201524 NM_201525 NM_201542 NM_201543 NM_201544 NM_201545 NM_201548 NM_201567 NM_201591 NM_201592 NM_201599 NM_201628 NM_201629 NM_201630 NM_201633 NM_203283 NM_203284 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203301 NM_203305 NM_203306 NM_203307 NM_203308 NM_203314 NM_203315 NM_203318 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203342 NM_203343 NM_203346 NM_203348 NM_203351 NM_203391 NM_203394 NM_203395 NM_203404 NM_203406 NM_203412 NM_203417 NM_203418 NM_203425 NM_203446 NM_203447 NM_203451 NM_203452 NM_203457 NM_203506 NM_203510 NM_205768 NM_205837 NM_205838 NM_205839 NM_205840 NM_205860 NM_206538 NM_206824 NM_206835 NM_206891 NM_206907 NM_206909 NM_206910 NM_206911 NM_206918 NM_206926 NM_206933 NM_206938 NM_206939 NM_206940 NM_206943 NM_206965 NM_206966 NM_207003 NM_207005 NM_207012 NM_207035 NM_207036 NM_207037 NM_207038 NM_207040 NM_207106 NM_207107 NM_207117 NM_207119 NM_207122 NM_207171 NM_207174 NM_207291 NM_207299 NM_207305 NM_207306 NM_207309 NM_207316 NM_207326 NM_207329 NM_207333 NM_207334 NM_207335 NM_207348 NM_207349 NM_207357 NM_207359 NM_207362 NM_207367 NM_207368 NM_207372 NM_207380 NM_207383 NM_207387 NM_207391 NM_207394 NM_207395 NM_207397 NM_207400 NM_207401 NM_207404 NM_207405 NM_207406 NM_207411 NM_207419 NM_207422 NM_207426 NM_207428 NM_207430 NM_207432 NM_207436 NM_207438 NM_207439 NM_207444 NM_207446 NM_207451 NM_207454 NM_207458 NM_207459 NM_207460 NM_207461 NM_207462 NM_207463 NM_207471 NM_207472 NM_207473 NM_207478 NM_207480 NM_207483 NM_207484 NM_207488 NM_207489 NM_207495 NM_207498 NM_207502 NM_207503 NM_207505 NM_207510 NM_207511 NM_207514 NM_207577 NM_207581 NM_207627 NM_207628 NM_207629 NM_207630 NM_207644 NM_207672 NM_212461 NM_212464 NM_212469 NM_212471 NM_212472 NM_212479 NM_212492 NM_212502 NM_212503 NM_212555 NM_212556 NM_212558 NM_212559 NM_213566 NM_213568 NM_213590 NM_213596 NM_213612 NM_213613 NM_213618 NM_213621 NM_213633 NM_213654 NM_213662 XM_016532 XM_027236 XM_028810 XM_031104 XM_031553 XM_031689 XM_032571 XM_032901 XM_032945 XM_032996 XM_034872 XM_035299 XM_035601 XM_036729 XM_036936 XM_036942 XM_037523 XM_037557 XM_038150 XM_039393 XM_039515 XM_039570 XM_039733 XM_039877 XM_039908 XM_040592 XM_041126 XM_042066 XM_042698 XM_042833 XM_042936 XM_043272 XM_043493 XM_044062 XM_044434 XM_045290 XM_045421 XM_046581 XM_046600 XM_047355 XM_047357 XM_047550 XM_047554 XM_047610 XM_048592 XM_048898 XM_051017 XM_051200 XM_052561 XM_058720 XM_059037 XM_059482 XM_059689 XM_059929 XM_064856 XM_065166 XM_084529 XM_084852 XM_085151 XM_085831 XM_086287 XM_086761 XM_087386 XM_088459 XM_089384 XM_091331 XM_113743 XM_113763 XM_113947 XM_114222 XM_114415 XM_116980 XM_117117 XM_117294 XM_165401 XM_166132 XM_166203 XM_166320 XM_166527 XM_167044 XM_167152 XM_170708 XM_170842 XM_171855 XM_172968 XM_173068 XM_173120 XM_208204 XM_208319 XM_208356 XM_208835 XM_208847 XM_208930 XM_209569 XM_209700 XM_209824 XM_210048 XM_210856 XM_211557 XM_211871 XM_212061 XM_290342 XM_290351 XM_290482 XM_290502 XM_290546 XM_290579 XM_290597 XM_290615 XM_290629 XM_290734 XM_290737 XM_290811 XM_290922 XM_291128 XM_291154 XM_291161 XM_291170 XM_291253 XM_291262 XM_291729 XM_291947 XM_292021 XM_292160 XM_292717 XM_293380 XM_294521 XM_294751 XM_294765 XM_294775 XM_294960 XM_296817 XM_350880 XM_351854 XM_370557 XM_370575 XM_370634 XM_370654 XM_370756 XM_370837 XM_370838 XM_370839 XM_370840 XM_370843 XM_370878 XM_370899 XM_370917 XM_370928 XM_370965 XM_370995 XM_371074 XM_371116 XM_371117 XM_371139 XM_371176 XM_371184 XM_371204 XM_371214 XM_371254 XM_371261 XM_371359 XM_371374 XM_371384 XM_371399 XM_371423 XM_371429 XM_371466 XM_371474 XM_371488 XM_371558 XM_371590 XM_371592 XM_371680 XM_371706 XM_371717 XM_371769 XM_371783 XM_371801 XM_371838 XM_371843 XM_371891 XM_371933 XM_372013 XM_372019 XM_372028 XM_372030 XM_372039 XM_372045 XM_372097 XM_372118 XM_372193 XM_372194 XM_372267 XM_372579 XM_372584 XM_373030 XM_373451 XM_373468 XM_373518 XM_373531 XM_373539 XM_373571 XM_373616 XM_373636 XM_373690 XM_373693 XM_373704 XM_373726 XM_373742 XM_373744 XM_373765 XM_373775 XM_373821 XM_373854 XM_373865 XM_373894 XM_373906 XM_373922 XM_373925 XM_373970 XM_374004 XM_374013 XM_374025 XM_374047 XM_374066 XM_374078 XM_374112 XM_374115 XM_374141 XM_374227 XM_374236 XM_374248 XM_374270 XM_374295 XM_374296 XM_374343 XM_374399 XM_374422 XM_374491 XM_374529 XM_374766 XM_374767 XM_374803 XM_374842 XM_374880 XM_374915 XM_374973 XM_375033 XM_375065 XM_375090 XM_375152 XM_375153 XM_375163 XM_375272 XM_375275 XM_375292 XM_375359 XM_375373 XM_375424 XM_375430 XM_375449 XM_375456 XM_375491 XM_375558 XM_375602 XM_375608 XM_375619 XM_375646 XM_375669 XM_375697 XM_375698 XM_375713 XM_375853 XM_375912 XM_375928 XM_376018 XM_376062 XM_376111 XM_376179 XM_376241 XM_376278 XM_376303 XM_376318 XM_376334 XM_376350 XM_376372 XM_376386 XM_376419 XM_376423 XM_376463 XM_376469 XM_376522 XM_376550 XM_376558 XM_376560 XM_376588 XM_376602 XM_376652 XM_376658 XM_376677 XM_376680 XM_376727 XM_376795 XM_376869 XM_376902 XM_376905 XM_377002 XM_377476 XM_377506 XM_377742 XM_378202 XM_378203 XM_378236 XM_378238 XM_378239 XM_378259 XM_378273 XM_378279 XM_378299 XM_378300 XM_378312 XM_378316 XM_378346 XM_378355 XM_378367 XM_378374 XM_378388 XM_378389 XM_378394 XM_378411 XM_378413 XM_378419 XM_378421 XM_378434 XM_378453 XM_378472 XM_378473 XM_378487 XM_378491 XM_378494 XM_378507 XM_378511 XM_378512 XM_378535 XM_378546 XM_378617 XM_378620 XM_378623 XM_378625 XM_378631 XM_378655 XM_378661 XM_378678 XM_378684 XM_378686 XM_378692 XM_378698 XM_378700 XM_378706 XM_378708 XM_378712 XM_378735 XM_378743 XM_378747 XM_378756 XM_378758 XM_378760 XM_378763 XM_378777 XM_378783 XM_378786 XM_378787 XM_378822 XM_378823 XM_378843 XM_378855 XM_378858 XM_378861 XM_378908 XM_378941 XM_378947 XM_378949 XM_378964 XM_378971 XM_378973 XM_378982 XM_379030 XM_379044 XM_379060 XM_379065 XM_379069 XM_379075 XM_379078 XM_379096 XM_379100 XM_379106 XM_379108 XM_379114 XM_379121 XM_379123 XM_379145 XM_379146 XM_379154 XM_379173 XM_379206 XM_379214 XM_379230 XM_379249 XM_379258 XM_379273 XM_379276 XM_379280 XM_379309 XM_379320 XM_379327 XM_379355 XM_379386 XM_379391 XM_379402 XM_379403 XM_379406 XM_379409 XM_379417 XM_379432 XM_379434 XM_379452 XM_379454 XM_379456 XM_379459 XM_379482 XM_379484 XM_379485 XM_379498 XM_379520 XM_379530 XM_379535 XM_379547 XM_379595 XM_379608 XM_379622 XM_379628 XM_379637 XM_379664 XM_379665 XM_379667 XM_379668 XM_379704 XM_379705 XM_379716 XM_379717 XM_379722 XM_379730 XM_379786 XM_379800 XM_379820 XM_379892 XM_379897 XM_379927 XM_379931 XM_379934 XM_379979 XM_380098 XM_380100 XM_380104 XM_380117 XM_380146 XM_380154 XM_380160 XM_495795 XM_495798 XM_495844 XM_495867 XM_495886 XM_495890 XM_495902 XM_495908 XM_495909 XM_495926 XM_495937 XM_495950 XM_496037 XM_496041 XM_496044 XM_496048 XM_496054 XM_496077 XM_496081 XM_496088 XM_496092 XM_496096 XM_496103 XM_496134 XM_496145 XM_496158 XM_496163 XM_496191 XM_496227 XM_496231 XM_496251 XM_496328 XM_496335 XM_496426 XM_496549 XM_496575 XM_496584 XM_496603 XM_496637 XM_496689 XM_496690 XM_496692 XM_496695 XM_496701 XM_496711 XM_496724 XM_496725 XM_496726 XM_496766 XM_496784 XM_496826 XM_496844 XM_496849 XM_496877 XM_496879 XM_496882 XM_496889 XM_496907 XM_496943 XM_496945 XM_496946 XM_496947 XM_496948 XM_496949 XM_496951 XM_496952 XM_496953 XM_496954 XM_496955 XM_496956 XM_496957 XM_496959 XM_496960 XM_496961 XM_496966 XM_496976 XM_497021 XM_497029 XM_497039 XM_497067 XM_497089 XM_497098 XM_497185 XM_498421 XM_498424 XM_498434 XM_498435 XM_498437 XM_498446 XM_498451 XM_498452 XM_498457 XM_498473 XM_498477 XM_498481 XM_498486 XM_498489 XM_498490 XM_498507 XM_498511 XM_498532 XM_498534 XM_498546 XM_498552 XM_498553 XM_498555 XM_498557 XM_498560 XM_498561 XM_498563 XM_498567 XM_498569 XM_498571 XM_498572 XM_498581 XM_498611 XM_498612 XM_498614 XM_498620 XM_498636 XM_498647 XM_498649 XM_498650 XM_498655 XM_498660 XM_498675 XM_498681 XM_498683 XM_498691 XM_498735 XM_498738 XM_498751 XM_498823 XM_498828 XM_498831 XM_498841 XM_498849 XM_498850 XM_498853 XM_498855 XM_498857 XM_498859 XM_498865 XM_498872 XM_498876 XM_498883 XM_498884 XM_498886 XM_498902 XM_498907 XM_498928 XM_498946 XM_498949 XM_498955 XM_498957 XM_498960 XM_498961 XM_498968 XM_498981 XM_498986 XM_498989 XM_498998 XM_499002 XM_499008 XM_499020 XM_499022 XM_499023 XM_499027 XM_499041 XM_499047 XM_499051 XM_499057 XM_499061 XM_499070 XM_499085 XM_499093 XM_499105 XM_499111 XM_499114 XM_499118 XM_499123 XM_499125 XM_499130 XM_499131 XM_499139 XM_499146 XM_499147 XM_499151 XM_499164 XM_499170 XM_499251 XM_499257 XM_499295 XM_499298 XM_499309 XM_499312 XM_499343 XM_499366 XM_499392 XM_499496 XM_499502 XM_499505 XM_499510 XM_499523 XM_499530 XM_499554 XM_499563 XM_499564 XM_499572 XM_499576 XM_499581 XM_499586 XM_499602 XR_000182 XR_000190 XR_000192 XR_000194 XR_000195 XR_000217 XR_000227 XR_000256 XR_000263 XR_000272 XR_000273
Genes with multiple seed matches:
NM_000025 NM_000031 NM_000037 NM_000046 NM_000054 NM_000097 NM_000102 NM_000103 NM_000110 NM_000125 NM_000136 NM_000149 NM_000165 NM_000167 NM_000237 NM_000264 NM_000268 NM_000297 NM_000332 NM_000334 NM_000335 NM_000337 NM_000346 NM_000351 NM_000368 NM_000376 NM_000382 NM_000411 NM_000539 NM_000555 NM_000579 NM_000599 NM_000602 NM_000604 NM_000611 NM_000618 NM_000633 NM_000664 NM_000790 NM_000791 NM_000809 NM_000849 NM_000899 NM_000913 NM_000934 NM_000961 NM_000991 NM_000994 NM_000997 NM_001001188 NM_001001329 NM_001001411 NM_001001412 NM_001001669 NM_001001671 NM_001001680 NM_001001681 NM_001001685 NM_001001686 NM_001001870 NM_001001873 NM_001001928 NM_001001929 NM_001001930 NM_001002233 NM_001002260 NM_001002261 NM_001002262 NM_001002762 NM_001002814 NM_001002847 NM_001002862 NM_001002926 NM_001003399 NM_001003406 NM_001003656 NM_001003674 NM_001003675 NM_001003690 NM_001003715 NM_001003716 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001004019 NM_001004300 NM_001004301 NM_001004302 NM_001004304 NM_001004314 NM_001004328 NM_001005210 NM_001005336 NM_001005386 NM_001005388 NM_001005409 NM_001005609 NM_001005751 NM_001005912 NM_001005913 NM_001006113 NM_001006115 NM_001006636 NM_001006657 NM_001006932 NM_001006946 NM_001007026 NM_001007073 NM_001007074 NM_001007094 NM_001007225 NM_001007246 NM_001007258 NM_001007262 NM_001007466 NM_001008220 NM_001008222 NM_001008239 NM_001008392 NM_001008401 NM_001008408 NM_001008541 NM_001008701 NM_001008745 NM_001008801 NM_001009610 NM_001009877 NM_001009880 NM_001009913 NM_001009938 NM_001009956 NM_001009957 NM_001009958 NM_001009959 NM_001010846 NM_001010866 NM_001010867 NM_001010888 NM_001010898 NM_001010910 NM_001010980 NM_001010987 NM_001011513 NM_001011514 NM_001011554 NM_001011655 NM_001012329 NM_001012339 NM_001012393 NM_001012418 NM_001012479 NM_001012511 NM_001012651 NM_001012711 NM_001012729 NM_001012733 NM_001012734 NM_001012755 NM_001012960 NM_001012981 NM_001013615 NM_001013635 NM_001013644 NM_001013648 NM_001013673 NM_001013675 NM_001013677 NM_001013682 NM_001013693 NM_001013697 NM_001013708 NM_001013713 NM_001013746 NM_001014374 NM_001014431 NM_001014432 NM_001014445 NM_001014797 NM_001015045 NM_001015048 NM_001015049 NM_001015053 NM_001015880 NM_001017395 NM_001017535 NM_001017915 NM_001017916 NM_001017917 NM_001017918 NM_001017919 NM_001017995 NM_001017998 NM_001018000 NM_001018029 NM_001018050 NM_001018051 NM_001018052 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001023563 NM_001023565 NM_001023566 NM_001024226 NM_001024227 NM_001024228 NM_001024372 NM_001024649 NM_001024676 NM_001024843 NM_001024847 NM_001024933 NM_001025076 NM_001025077 NM_001025091 NM_001025100 NM_001025160 NM_001025193 NM_001025233 NM_001025242 NM_001025243 NM_001025247 NM_001090 NM_001092 NM_001148 NM_001183 NM_001191 NM_001198 NM_001206 NM_001247 NM_001250 NM_001298 NM_001337 NM_001346 NM_001347 NM_001356 NM_001361 NM_001390 NM_001396 NM_001399 NM_001412 NM_001421 NM_001427 NM_001440 NM_001447 NM_001457 NM_001460 NM_001478 NM_001493 NM_001505 NM_001519 NM_001569 NM_001609 NM_001611 NM_001614 NM_001649 NM_001650 NM_001658 NM_001678 NM_001709 NM_001716 NM_001746 NM_001759 NM_001784 NM_001806 NM_001847 NM_001901 NM_001915 NM_001940 NM_001948 NM_001949 NM_001975 NM_001980 NM_001987 NM_001991 NM_001998 NM_002006 NM_002014 NM_002015 NM_002025 NM_002033 NM_002045 NM_002048 NM_002052 NM_002060 NM_002073 NM_002074 NM_002086 NM_002087 NM_002103 NM_002111 NM_002119 NM_002131 NM_002133 NM_002212 NM_002218 NM_002226 NM_002240 NM_002242 NM_002243 NM_002251 NM_002298 NM_002309 NM_002319 NM_002334 NM_002347 NM_002359 NM_002389 NM_002401 NM_002416 NM_002441 NM_002505 NM_002507 NM_002522 NM_002531 NM_002545 NM_002547 NM_002558 NM_002569 NM_002596 NM_002604 NM_002608 NM_002610 NM_002613 NM_002640 NM_002716 NM_002717 NM_002719 NM_002737 NM_002743 NM_002748 NM_002751 NM_002816 NM_002834 NM_002840 NM_002848 NM_002857 NM_002867 NM_002883 NM_002926 NM_002957 NM_002959 NM_002990 NM_002997 NM_002998 NM_003016 NM_003021 NM_003023 NM_003039 NM_003108 NM_003119 NM_003139 NM_003150 NM_003161 NM_003173 NM_003179 NM_003189 NM_003200 NM_003215 NM_003216 NM_003217 NM_003242 NM_003247 NM_003255 NM_003291 NM_003307 NM_003320 NM_003340 NM_003347 NM_003388 NM_003392 NM_003414 NM_003421 NM_003427 NM_003435 NM_003439 NM_003441 NM_003449 NM_003458 NM_003459 NM_003462 NM_003484 NM_003486 NM_003564 NM_003565 NM_003597 NM_003605 NM_003615 NM_003618 NM_003626 NM_003629 NM_003644 NM_003648 NM_003660 NM_003681 NM_003682 NM_003683 NM_003684 NM_003687 NM_003722 NM_003724 NM_003731 NM_003749 NM_003761 NM_003820 NM_003831 NM_003842 NM_003855 NM_003874 NM_003895 NM_003900 NM_003901 NM_003909 NM_003913 NM_003939 NM_003941 NM_003949 NM_003950 NM_003966 NM_003970 NM_003994 NM_004028 NM_004040 NM_004050 NM_004090 NM_004091 NM_004093 NM_004101 NM_004125 NM_004136 NM_004171 NM_004172 NM_004200 NM_004210 NM_004216 NM_004220 NM_004263 NM_004264 NM_004275 NM_004287 NM_004311 NM_004319 NM_004321 NM_004338 NM_004382 NM_004391 NM_004399 NM_004408 NM_004426 NM_004437 NM_004438 NM_004449 NM_004459 NM_004462 NM_004474 NM_004488 NM_004505 NM_004514 NM_004518 NM_004537 NM_004554 NM_004567 NM_004571 NM_004649 NM_004650 NM_004656 NM_004670 NM_004687 NM_004703 NM_004709 NM_004711 NM_004745 NM_004758 NM_004759 NM_004768 NM_004772 NM_004781 NM_004797 NM_004798 NM_004804 NM_004809 NM_004845 NM_004863 NM_004873 NM_004929 NM_004943 NM_004947 NM_004992 NM_005036 NM_005041 NM_005063 NM_005065 NM_005076 NM_005082 NM_005110 NM_005116 NM_005134 NM_005137 NM_005149 NM_005155 NM_005163 NM_005184 NM_005187 NM_005188 NM_005197 NM_005207 NM_005219 NM_005220 NM_005231 NM_005253 NM_005271 NM_005313 NM_005349 NM_005374 NM_005376 NM_005399 NM_005407 NM_005417 NM_005432 NM_005446 NM_005456 NM_005474 NM_005479 NM_005504 NM_005541 NM_005562 NM_005569 NM_005578 NM_005650 NM_005664 NM_005668 NM_005670 NM_005682 NM_005722 NM_005729 NM_005730 NM_005764 NM_005779 NM_005785 NM_005808 NM_005819 NM_005828 NM_005840 NM_005856 NM_005858 NM_005868 NM_005877 NM_005895 NM_005902 NM_005957 NM_005962 NM_005984 NM_005990 NM_006005 NM_006013 NM_006035 NM_006037 NM_006052 NM_006055 NM_006065 NM_006092 NM_006100 NM_006122 NM_006132 NM_006141 NM_006178 NM_006184 NM_006224 NM_006226 NM_006268 NM_006282 NM_006283 NM_006291 NM_006312 NM_006315 NM_006321 NM_006371 NM_006373 NM_006375 NM_006377 NM_006383 NM_006454 NM_006457 NM_006459 NM_006464 NM_006465 NM_006478 NM_006481 NM_006485 NM_006508 NM_006524 NM_006546 NM_006548 NM_006549 NM_006561 NM_006572 NM_006596 NM_006598 NM_006599 NM_006617 NM_006622 NM_006624 NM_006640 NM_006650 NM_006661 NM_006693 NM_006697 NM_006706 NM_006729 NM_006736 NM_006742 NM_006749 NM_006762 NM_006767 NM_006795 NM_006796 NM_006823 NM_006827 NM_006869 NM_006873 NM_006888 NM_006890 NM_006907 NM_006914 NM_006926 NM_006969 NM_006984 NM_006987 NM_006996 NM_007014 NM_007024 NM_007030 NM_007050 NM_007157 NM_007173 NM_007238 NM_007249 NM_007271 NM_007306 NM_007353 NM_007375 NM_012075 NM_012084 NM_012096 NM_012158 NM_012193 NM_012215 NM_012218 NM_012229 NM_012268 NM_012271 NM_012275 NM_012281 NM_012287 NM_012288 NM_012305 NM_012306 NM_012309 NM_012315 NM_012318 NM_012320 NM_012333 NM_012346 NM_012384 NM_012387 NM_012400 NM_012409 NM_012420 NM_012448 NM_012455 NM_012465 NM_012470 NM_013230 NM_013255 NM_013279 NM_013284 NM_013309 NM_013323 NM_013325 NM_013332 NM_013345 NM_013411 NM_013446 NM_013449 NM_013450 NM_014001 NM_014002 NM_014007 NM_014112 NM_014141 NM_014157 NM_014212 NM_014286 NM_014293 NM_014347 NM_014388 NM_014399 NM_014460 NM_014506 NM_014554 NM_014556 NM_014586 NM_014601 NM_014613 NM_014616 NM_014628 NM_014631 NM_014637 NM_014642 NM_014647 NM_014661 NM_014663 NM_014665 NM_014667 NM_014690 NM_014700 NM_014702 NM_014723 NM_014730 NM_014732 NM_014734 NM_014737 NM_014741 NM_014743 NM_014744 NM_014746 NM_014747 NM_014758 NM_014759 NM_014762 NM_014766 NM_014767 NM_014772 NM_014789 NM_014798 NM_014801 NM_014819 NM_014820 NM_014824 NM_014830 NM_014835 NM_014836 NM_014841 NM_014844 NM_014850 NM_014858 NM_014862 NM_014867 NM_014870 NM_014873 NM_014874 NM_014876 NM_014883 NM_014893 NM_014903 NM_014909 NM_014910 NM_014919 NM_014921 NM_014930 NM_014934 NM_014935 NM_014947 NM_014952 NM_014957 NM_014965 NM_015002 NM_015003 NM_015008 NM_015025 NM_015033 NM_015035 NM_015043 NM_015052 NM_015066 NM_015071 NM_015074 NM_015075 NM_015077 NM_015085 NM_015088 NM_015090 NM_015100 NM_015107 NM_015111 NM_015115 NM_015124 NM_015137 NM_015141 NM_015144 NM_015155 NM_015193 NM_015194 NM_015202 NM_015208 NM_015226 NM_015227 NM_015229 NM_015236 NM_015238 NM_015246 NM_015251 NM_015253 NM_015254 NM_015262 NM_015264 NM_015266 NM_015270 NM_015278 NM_015285 NM_015288 NM_015299 NM_015308 NM_015310 NM_015313 NM_015320 NM_015326 NM_015329 NM_015330 NM_015332 NM_015338 NM_015340 NM_015345 NM_015352 NM_015359 NM_015393 NM_015394 NM_015411 NM_015432 NM_015438 NM_015443 NM_015447 NM_015477 NM_015492 NM_015506 NM_015508 NM_015516 NM_015534 NM_015537 NM_015544 NM_015549 NM_015553 NM_015555 NM_015557 NM_015568 NM_015596 NM_015630 NM_015640 NM_015641 NM_015654 NM_015670 NM_015695 NM_015850 NM_015852 NM_015874 NM_015886 NM_015910 NM_015917 NM_015981 NM_015995 NM_016018 NM_016032 NM_016068 NM_016083 NM_016107 NM_016114 NM_016143 NM_016169 NM_016173 NM_016220 NM_016224 NM_016263 NM_016264 NM_016280 NM_016308 NM_016322 NM_016389 NM_016418 NM_016458 NM_016522 NM_016526 NM_016553 NM_016563 NM_016575 NM_016577 NM_016605 NM_016641 NM_016642 NM_016733 NM_017415 NM_017420 NM_017438 NM_017443 NM_017515 NM_017540 NM_017582 NM_017586 NM_017588 NM_017590 NM_017594 NM_017599 NM_017623 NM_017626 NM_017628 NM_017635 NM_017656 NM_017668 NM_017705 NM_017712 NM_017713 NM_017719 NM_017723 NM_017728 NM_017787 NM_017789 NM_017791 NM_017799 NM_017804 NM_017825 NM_017848 NM_017849 NM_017851 NM_017873 NM_017890 NM_017896 NM_017931 NM_017974 NM_017982 NM_017999 NM_018031 NM_018059 NM_018096 NM_018126 NM_018159 NM_018188 NM_018214 NM_018224 NM_018227 NM_018233 NM_018260 NM_018279 NM_018300 NM_018330 NM_018355 NM_018364 NM_018370 NM_018381 NM_018389 NM_018439 NM_018440 NM_018461 NM_018462 NM_018498 NM_018553 NM_018644 NM_018660 NM_018667 NM_018704 NM_018717 NM_018839 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018947 NM_018987 NM_018994 NM_018999 NM_019008 NM_019009 NM_019036 NM_019061 NM_019064 NM_019081 NM_019096 NM_019117 NM_019590 NM_019594 NM_019854 NM_019885 NM_019892 NM_020038 NM_020127 NM_020133 NM_020141 NM_020211 NM_020219 NM_020245 NM_020248 NM_020338 NM_020362 NM_020398 NM_020421 NM_020431 NM_020433 NM_020440 NM_020443 NM_020475 NM_020476 NM_020477 NM_020639 NM_020657 NM_020697 NM_020702 NM_020711 NM_020713 NM_020714 NM_020724 NM_020742 NM_020746 NM_020761 NM_020773 NM_020776 NM_020779 NM_020781 NM_020783 NM_020784 NM_020795 NM_020807 NM_020810 NM_020814 NM_020825 NM_020828 NM_020839 NM_020850 NM_020853 NM_020858 NM_020899 NM_020909 NM_020917 NM_020918 NM_020933 NM_020935 NM_020954 NM_020956 NM_020960 NM_020962 NM_020977 NM_020983 NM_021020 NM_021064 NM_021067 NM_021096 NM_021101 NM_021116 NM_021117 NM_021134 NM_021135 NM_021155 NM_021183 NM_021189 NM_021190 NM_021201 NM_021202 NM_021255 NM_021258 NM_021269 NM_021638 NM_021705 NM_021808 NM_021812 NM_021813 NM_021823 NM_021905 NM_021943 NM_021950 NM_021961 NM_021962 NM_021998 NM_022041 NM_022080 NM_022082 NM_022085 NM_022114 NM_022117 NM_022139 NM_022152 NM_022153 NM_022445 NM_022465 NM_022491 NM_022497 NM_022720 NM_022755 NM_022758 NM_022759 NM_022766 NM_022767 NM_022769 NM_022780 NM_022824 NM_022829 NM_022833 NM_022898 NM_022905 NM_022912 NM_023007 NM_023067 NM_023105 NM_023106 NM_023111 NM_023112 NM_023924 NM_023935 NM_023938 NM_024061 NM_024085 NM_024294 NM_024308 NM_024342 NM_024512 NM_024554 NM_024585 NM_024607 NM_024618 NM_024627 NM_024659 NM_024665 NM_024667 NM_024676 NM_024701 NM_024704 NM_024709 NM_024735 NM_024736 NM_024771 NM_024789 NM_024812 NM_024836 NM_024854 NM_024855 NM_024866 NM_024881 NM_024896 NM_024915 NM_024924 NM_024938 NM_024940 NM_024946 NM_025010 NM_025090 NM_025104 NM_025130 NM_025151 NM_025161 NM_025187 NM_025189 NM_025194 NM_025219 NM_025224 NM_025230 NM_025236 NM_025259 NM_030576 NM_030626 NM_030630 NM_030653 NM_030655 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030761 NM_030781 NM_030792 NM_030803 NM_030806 NM_030809 NM_030810 NM_030915 NM_030916 NM_030918 NM_030927 NM_030928 NM_030945 NM_030968 NM_030972 NM_030981 NM_031226 NM_031244 NM_031268 NM_031411 NM_031417 NM_031422 NM_031426 NM_031432 NM_031445 NM_031462 NM_031469 NM_031476 NM_031485 NM_031849 NM_031857 NM_031860 NM_031890 NM_031912 NM_031954 NM_032015 NM_032016 NM_032042 NM_032046 NM_032207 NM_032214 NM_032242 NM_032251 NM_032271 NM_032272 NM_032276 NM_032287 NM_032289 NM_032294 NM_032296 NM_032329 NM_032350 NM_032385 NM_032414 NM_032415 NM_032421 NM_032432 NM_032433 NM_032452 NM_032486 NM_032501 NM_032509 NM_032529 NM_032552 NM_032561 NM_032578 NM_032584 NM_032711 NM_032780 NM_032800 NM_032808 NM_032809 NM_032815 NM_032818 NM_032825 NM_032845 NM_032853 NM_032865 NM_032866 NM_032871 NM_032886 NM_032895 NM_032900 NM_032932 NM_032960 NM_032966 NM_032975 NM_032980 NM_032988 NM_032995 NM_032998 NM_033016 NM_033052 NM_033086 NM_033089 NM_033102 NM_033141 NM_033143 NM_033161 NM_033181 NM_033199 NM_033224 NM_033238 NM_033240 NM_033244 NM_033245 NM_033274 NM_033282 NM_033288 NM_033332 NM_033387 NM_033397 NM_033419 NM_033426 NM_033429 NM_033446 NM_033503 NM_033512 NM_033544 NM_033624 NM_033631 NM_033637 NM_033641 NM_033655 NM_033656 NM_033666 NM_052821 NM_052834 NM_052839 NM_052859 NM_052878 NM_052896 NM_052906 NM_052919 NM_053029 NM_053282 NM_054025 NM_057088 NM_057175 NM_058172 NM_058178 NM_058180 NM_058182 NM_078481 NM_078483 NM_078628 NM_080476 NM_080621 NM_080668 NM_080725 NM_080730 NM_080731 NM_080836 NM_080867 NM_080927 NM_101395 NM_130436 NM_130437 NM_130438 NM_130439 NM_130440 NM_130468 NM_130470 NM_130471 NM_130472 NM_130473 NM_130474 NM_130475 NM_130476 NM_130807 NM_133170 NM_133175 NM_133176 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133443 NM_133460 NM_133463 NM_133468 NM_133474 NM_133627 NM_134268 NM_138294 NM_138300 NM_138338 NM_138373 NM_138384 NM_138399 NM_138409 NM_138565 NM_138576 NM_138578 NM_138619 NM_138713 NM_138714 NM_138717 NM_138793 NM_138967 NM_139015 NM_139024 NM_139028 NM_139075 NM_139178 NM_139207 NM_139246 NM_139276 NM_139279 NM_139280 NM_144498 NM_144570 NM_144579 NM_144582 NM_144588 NM_144607 NM_144671 NM_144968 NM_144973 NM_144994 NM_145015 NM_145039 NM_145044 NM_145055 NM_145065 NM_145071 NM_145117 NM_145159 NM_145166 NM_145173 NM_145187 NM_145188 NM_145189 NM_145190 NM_145230 NM_145278 NM_145279 NM_145310 NM_145323 NM_145324 NM_145349 NM_145351 NM_145685 NM_145693 NM_145735 NM_145762 NM_145763 NM_145799 NM_145808 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145906 NM_147129 NM_147161 NM_147187 NM_147202 NM_148175 NM_148176 NM_148571 NM_148957 NM_152222 NM_152236 NM_152237 NM_152244 NM_152253 NM_152264 NM_152272 NM_152340 NM_152376 NM_152380 NM_152389 NM_152399 NM_152472 NM_152482 NM_152507 NM_152536 NM_152547 NM_152564 NM_152665 NM_152673 NM_152686 NM_152689 NM_152702 NM_152717 NM_152737 NM_152754 NM_152765 NM_152780 NM_152793 NM_152829 NM_152831 NM_152835 NM_152854 NM_152866 NM_152879 NM_152889 NM_153029 NM_153034 NM_153044 NM_153183 NM_153229 NM_153239 NM_153263 NM_153273 NM_153320 NM_153343 NM_153442 NM_153456 NM_153462 NM_153463 NM_153487 NM_153499 NM_153500 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153683 NM_153718 NM_153719 NM_153810 NM_153812 NM_153823 NM_153826 NM_153832 NM_170686 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170743 NM_170769 NM_170770 NM_170773 NM_170774 NM_171825 NM_171982 NM_172069 NM_172106 NM_172107 NM_172165 NM_172166 NM_172206 NM_172216 NM_172226 NM_172234 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_173060 NM_173064 NM_173065 NM_173170 NM_173214 NM_173352 NM_173355 NM_173470 NM_173477 NM_173510 NM_173528 NM_173530 NM_173531 NM_173551 NM_173617 NM_173632 NM_173640 NM_173660 NM_173669 NM_173680 NM_173728 NM_174871 NM_174917 NM_174918 NM_174972 NM_175063 NM_175077 NM_175709 NM_175875 NM_175900 NM_175910 NM_175921 NM_175931 NM_176677 NM_176786 NM_176815 NM_176823 NM_176871 NM_177427 NM_177436 NM_177442 NM_177963 NM_177967 NM_177972 NM_177977 NM_177978 NM_177999 NM_178004 NM_178122 NM_178151 NM_178152 NM_178153 NM_178226 NM_178229 NM_178326 NM_178509 NM_178514 NM_178516 NM_178519 NM_178520 NM_178546 NM_178582 NM_178586 NM_178831 NM_178836 NM_181076 NM_181077 NM_181332 NM_181355 NM_181357 NM_181358 NM_181430 NM_181431 NM_181435 NM_181466 NM_181467 NM_181468 NM_181469 NM_181481 NM_181482 NM_181483 NM_181489 NM_181492 NM_181502 NM_181701 NM_181704 NM_181709 NM_181789 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181839 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_182314 NM_182481 NM_182482 NM_182483 NM_182484 NM_182502 NM_182508 NM_182510 NM_182527 NM_182531 NM_182534 NM_182554 NM_182557 NM_182565 NM_182609 NM_182612 NM_182613 NM_182641 NM_182647 NM_182661 NM_182686 NM_182752 NM_182775 NM_182791 NM_182848 NM_182907 NM_182918 NM_182933 NM_182935 NM_182964 NM_183059 NM_183397 NM_184042 NM_194278 NM_194283 NM_194285 NM_194286 NM_194288 NM_194295 NM_194309 NM_194310 NM_194312 NM_194314 NM_194318 NM_194356 NM_194358 NM_194359 NM_197941 NM_197956 NM_198056 NM_198074 NM_198081 NM_198138 NM_198155 NM_198157 NM_198207 NM_198225 NM_198268 NM_198269 NM_198274 NM_198291 NM_198321 NM_198440 NM_198457 NM_198480 NM_198484 NM_198490 NM_198549 NM_198553 NM_198582 NM_198593 NM_198594 NM_198595 NM_198833 NM_198835 NM_198859 NM_198868 NM_198890 NM_198893 NM_198968 NM_199050 NM_199071 NM_199072 NM_199078 NM_199132 NM_199420 NM_199421 NM_199424 NM_199454 NM_201280 NM_201399 NM_201403 NM_201432 NM_201433 NM_201524 NM_201525 NM_201542 NM_201548 NM_201628 NM_203283 NM_203284 NM_203305 NM_203306 NM_203307 NM_203327 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_203351 NM_203391 NM_203395 NM_203446 NM_203452 NM_203506 NM_206538 NM_206835 NM_206891 NM_206909 NM_206938 NM_206939 NM_206940 NM_207035 NM_207171 NM_207305 NM_207333 NM_207357 NM_207367 NM_207368 NM_207380 NM_207395 NM_207397 NM_207400 NM_207405 NM_207411 NM_207428 NM_207430 NM_207432 NM_207451 NM_207458 NM_207483 NM_207484 NM_207488 NM_207503 NM_207505 NM_207510 NM_207514 NM_207577 NM_207644 NM_212464 NM_212502 NM_212503 NM_212555 NM_213596 NM_213612 NM_213662 XM_031104 XM_032996 XM_037523 XM_039393 XM_039877 XM_039908 XM_042698 XM_042833 XM_042936 XM_043493 XM_044062 XM_045421 XM_047610 XM_048592 XM_051200 XM_064856 XM_065166 XM_084529 XM_088459 XM_113743 XM_117117 XM_166132 XM_167044 XM_209700 XM_212061 XM_290342 XM_290482 XM_290546 XM_290597 XM_290615 XM_290734 XM_294775 XM_296817 XM_350880 XM_370557 XM_370654 XM_370756 XM_370838 XM_370878 XM_370928 XM_371074 XM_371184 XM_371214 XM_371254 XM_371374 XM_371474 XM_371488 XM_371680 XM_371891 XM_372039 XM_372097 XM_372193 XM_372194 XM_372267 XM_372584 XM_373030 XM_373539 XM_373616 XM_373704 XM_373865 XM_373906 XM_373925 XM_374013 XM_374025 XM_374112 XM_374422 XM_374529 XM_374915 XM_375065 XM_375153 XM_375292 XM_375373 XM_375456 XM_375602 XM_375608 XM_375619 XM_375646 XM_375669 XM_375697 XM_375698 XM_375853 XM_375928 XM_376018 XM_376241 XM_376303 XM_376419 XM_376469 XM_376550 XM_376558 XM_376560 XM_376602 XM_376658 XM_376680 XM_376727 XM_376869 XM_376902 XM_377476 XM_377506 XM_377742 XM_378238 XM_378299 XM_378312 XM_378316 XM_378389 XM_378419 XM_378511 XM_378620 XM_378623 XM_378625 XM_378708 XM_378735 XM_378747 XM_378756 XM_378758 XM_378783 XM_378786 XM_378843 XM_378855 XM_378858 XM_378908 XM_378964 XM_379030 XM_379065 XM_379075 XM_379123 XM_379145 XM_379154 XM_379214 XM_379273 XM_379276 XM_379403 XM_379409 XM_379452 XM_379459 XM_379664 XM_379665 XM_379705 XM_379820 XM_379897 XM_379927 XM_379934 XM_379979 XM_495798 XM_495902 XM_495908 XM_495926 XM_495937 XM_496054 XM_496163 XM_496328 XM_496575 XM_496690 XM_496692 XM_496724 XM_496844 XM_496877 XM_496879 XM_496943 XM_496959 XM_496966 XM_497021 XM_498424 XM_498446 XM_498452 XM_498511 XM_498555 XM_498567 XM_498569 XM_498572 XM_498611 XM_498614 XM_498649 XM_498683 XM_498751 XM_498828 XM_498841 XM_498859 XM_498907 XM_498955 XM_498998 XM_499041 XM_499047 XM_499057 XM_499105 XM_499130 XM_499131 XM_499147 XM_499170 XM_499298 XM_499366 XM_499392 XM_499502 XM_499505 XM_499554 XM_499564 XM_499576 XR_000182 XR_000190 XR_000192 XR_000194 XR_000195 XR_000217 XR_000227
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)