VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aagacuuaugauccucucuca"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6788
.
Total Genes with multiple seed matches:
2731
.
Genes with at least one seed match:
NM_000021 NM_000025 NM_000033 NM_000037 NM_000044 NM_000053 NM_000054 NM_000060 NM_000063 NM_000074 NM_000080 NM_000081 NM_000088 NM_000097 NM_000108 NM_000115 NM_000116 NM_000121 NM_000125 NM_000127 NM_000129 NM_000132 NM_000133 NM_000136 NM_000139 NM_000140 NM_000141 NM_000149 NM_000151 NM_000152 NM_000153 NM_000162 NM_000163 NM_000165 NM_000166 NM_000170 NM_000176 NM_000182 NM_000188 NM_000189 NM_000191 NM_000195 NM_000198 NM_000204 NM_000209 NM_000212 NM_000215 NM_000218 NM_000226 NM_000230 NM_000231 NM_000232 NM_000237 NM_000239 NM_000243 NM_000253 NM_000254 NM_000260 NM_000262 NM_000264 NM_000268 NM_000278 NM_000291 NM_000292 NM_000294 NM_000300 NM_000306 NM_000307 NM_000310 NM_000311 NM_000319 NM_000320 NM_000321 NM_000322 NM_000330 NM_000332 NM_000334 NM_000337 NM_000346 NM_000351 NM_000353 NM_000358 NM_000361 NM_000362 NM_000363 NM_000366 NM_000367 NM_000369 NM_000373 NM_000376 NM_000377 NM_000381 NM_000389 NM_000391 NM_000394 NM_000395 NM_000396 NM_000397 NM_000399 NM_000401 NM_000405 NM_000406 NM_000407 NM_000410 NM_000411 NM_000417 NM_000423 NM_000428 NM_000429 NM_000431 NM_000432 NM_000435 NM_000439 NM_000445 NM_000459 NM_000460 NM_000477 NM_000481 NM_000484 NM_000486 NM_000489 NM_000492 NM_000497 NM_000498 NM_000500 NM_000503 NM_000508 NM_000510 NM_000511 NM_000523 NM_000525 NM_000527 NM_000533 NM_000538 NM_000539 NM_000544 NM_000546 NM_000554 NM_000555 NM_000560 NM_000565 NM_000566 NM_000576 NM_000579 NM_000582 NM_000585 NM_000588 NM_000593 NM_000594 NM_000597 NM_000598 NM_000599 NM_000602 NM_000603 NM_000609 NM_000610 NM_000611 NM_000612 NM_000614 NM_000616 NM_000618 NM_000620 NM_000625 NM_000629 NM_000632 NM_000633 NM_000635 NM_000647 NM_000660 NM_000663 NM_000664 NM_000668 NM_000670 NM_000677 NM_000681 NM_000689 NM_000690 NM_000694 NM_000696 NM_000721 NM_000723 NM_000726 NM_000727 NM_000728 NM_000738 NM_000742 NM_000750 NM_000754 NM_000757 NM_000758 NM_000761 NM_000765 NM_000767 NM_000772 NM_000778 NM_000782 NM_000785 NM_000789 NM_000792 NM_000793 NM_000795 NM_000798 NM_000809 NM_000817 NM_000818 NM_000826 NM_000831 NM_000833 NM_000834 NM_000837 NM_000838 NM_000841 NM_000843 NM_000844 NM_000849 NM_000854 NM_000857 NM_000858 NM_000864 NM_000868 NM_000875 NM_000876 NM_000877 NM_000885 NM_000890 NM_000891 NM_000896 NM_000901 NM_000902 NM_000908 NM_000925 NM_000927 NM_000933 NM_000941 NM_000945 NM_000947 NM_000956 NM_000959 NM_000960 NM_000961 NM_000966 NM_000983 NM_000991 NM_000997 NM_001001188 NM_001001323 NM_001001331 NM_001001343 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001395 NM_001001396 NM_001001412 NM_001001418 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001523 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001557 NM_001001661 NM_001001662 NM_001001666 NM_001001669 NM_001001677 NM_001001679 NM_001001681 NM_001001684 NM_001001685 NM_001001686 NM_001001687 NM_001001689 NM_001001694 NM_001001695 NM_001001696 NM_001001698 NM_001001702 NM_001001703 NM_001001706 NM_001001711 NM_001001713 NM_001001723 NM_001001740 NM_001001791 NM_001001872 NM_001001873 NM_001001874 NM_001001875 NM_001001890 NM_001001891 NM_001001894 NM_001001928 NM_001001929 NM_001001930 NM_001001936 NM_001001938 NM_001001971 NM_001002006 NM_001002009 NM_001002010 NM_001002026 NM_001002032 NM_001002033 NM_001002034 NM_001002231 NM_001002232 NM_001002233 NM_001002254 NM_001002257 NM_001002260 NM_001002261 NM_001002262 NM_001002295 NM_001002760 NM_001002761 NM_001002762 NM_001002814 NM_001002837 NM_001002838 NM_001002840 NM_001002848 NM_001002849 NM_001002857 NM_001002858 NM_001002860 NM_001002861 NM_001002862 NM_001002880 NM_001002881 NM_001002912 NM_001002914 NM_001002926 NM_001003395 NM_001003396 NM_001003397 NM_001003398 NM_001003399 NM_001003406 NM_001003407 NM_001003408 NM_001003665 NM_001003674 NM_001003675 NM_001003682 NM_001003688 NM_001003694 NM_001003716 NM_001003790 NM_001003791 NM_001003799 NM_001003800 NM_001003806 NM_001003807 NM_001003809 NM_001003812 NM_001003818 NM_001003937 NM_001003940 NM_001003942 NM_001003943 NM_001003962 NM_001004127 NM_001004128 NM_001004299 NM_001004300 NM_001004304 NM_001004305 NM_001004306 NM_001004314 NM_001004317 NM_001004321 NM_001004322 NM_001004327 NM_001004331 NM_001004333 NM_001004334 NM_001004338 NM_001004341 NM_001004342 NM_001004345 NM_001004348 NM_001004349 NM_001004352 NM_001004354 NM_001004355 NM_001004356 NM_001004358 NM_001004360 NM_001004416 NM_001004439 NM_001004441 NM_001004720 NM_001004722 NM_001005210 NM_001005214 NM_001005291 NM_001005340 NM_001005353 NM_001005360 NM_001005361 NM_001005362 NM_001005366 NM_001005367 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005408 NM_001005413 NM_001005414 NM_001005463 NM_001005473 NM_001005502 NM_001005505 NM_001005609 NM_001005739 NM_001005746 NM_001005747 NM_001005753 NM_001005910 NM_001005911 NM_001005912 NM_001005913 NM_001005918 NM_001006115 NM_001006116 NM_001006600 NM_001006603 NM_001006624 NM_001006625 NM_001006656 NM_001006657 NM_001006658 NM_001006665 NM_001006667 NM_001006932 NM_001006939 NM_001007023 NM_001007024 NM_001007025 NM_001007026 NM_001007033 NM_001007094 NM_001007097 NM_001007098 NM_001007156 NM_001007224 NM_001007225 NM_001007237 NM_001007254 NM_001007269 NM_001007270 NM_001007277 NM_001007278 NM_001007279 NM_001007466 NM_001007471 NM_001007525 NM_001007534 NM_001007536 NM_001007538 NM_001007544 NM_001007546 NM_001007794 NM_001008222 NM_001008223 NM_001008225 NM_001008228 NM_001008229 NM_001008234 NM_001008239 NM_001008391 NM_001008392 NM_001008406 NM_001008408 NM_001008493 NM_001008494 NM_001008528 NM_001008529 NM_001008536 NM_001008539 NM_001008540 NM_001008541 NM_001008657 NM_001008658 NM_001008661 NM_001008662 NM_001008693 NM_001008701 NM_001008707 NM_001008723 NM_001008737 NM_001008742 NM_001008744 NM_001008745 NM_001008756 NM_001008897 NM_001008917 NM_001008938 NM_001009182 NM_001009183 NM_001009184 NM_001009185 NM_001009553 NM_001009566 NM_001009610 NM_001009880 NM_001009883 NM_001009899 NM_001009913 NM_001009956 NM_001009957 NM_001009959 NM_001009960 NM_001009992 NM_001009993 NM_001009997 NM_001010000 NM_001010846 NM_001010862 NM_001010864 NM_001010866 NM_001010867 NM_001010871 NM_001010888 NM_001010891 NM_001010897 NM_001010898 NM_001010903 NM_001010908 NM_001010913 NM_001010915 NM_001010924 NM_001010925 NM_001010931 NM_001010933 NM_001010935 NM_001010974 NM_001010978 NM_001010984 NM_001011513 NM_001011514 NM_001011537 NM_001011538 NM_001011554 NM_001011645 NM_001011649 NM_001011656 NM_001011666 NM_001011703 NM_001011708 NM_001011709 NM_001011720 NM_001011885 NM_001012264 NM_001012270 NM_001012271 NM_001012300 NM_001012329 NM_001012338 NM_001012393 NM_001012398 NM_001012418 NM_001012426 NM_001012427 NM_001012508 NM_001012509 NM_001012512 NM_001012513 NM_001012514 NM_001012515 NM_001012516 NM_001012642 NM_001012651 NM_001012659 NM_001012661 NM_001012662 NM_001012663 NM_001012664 NM_001012706 NM_001012707 NM_001012709 NM_001012711 NM_001012713 NM_001012714 NM_001012715 NM_001012732 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012755 NM_001012756 NM_001012761 NM_001012763 NM_001012957 NM_001012958 NM_001012964 NM_001012965 NM_001012966 NM_001012968 NM_001012969 NM_001012977 NM_001012981 NM_001012984 NM_001012987 NM_001012988 NM_001012993 NM_001013000 NM_001013005 NM_001013031 NM_001013251 NM_001013257 NM_001013398 NM_001013615 NM_001013618 NM_001013629 NM_001013635 NM_001013637 NM_001013645 NM_001013650 NM_001013652 NM_001013664 NM_001013673 NM_001013679 NM_001013683 NM_001013685 NM_001013687 NM_001013690 NM_001013693 NM_001013695 NM_001013697 NM_001013704 NM_001013708 NM_001013710 NM_001013713 NM_001013714 NM_001013718 NM_001013719 NM_001013727 NM_001013738 NM_001014373 NM_001014431 NM_001014432 NM_001014433 NM_001014440 NM_001014442 NM_001014445 NM_001014450 NM_001014765 NM_001014797 NM_001014837 NM_001014838 NM_001014840 NM_001015048 NM_001015049 NM_001015053 NM_001015880 NM_001015881 NM_001015882 NM_001015885 NM_001015886 NM_001015887 NM_001017368 NM_001017369 NM_001017392 NM_001017395 NM_001017396 NM_001017398 NM_001017403 NM_001017404 NM_001017415 NM_001017416 NM_001017424 NM_001017425 NM_001017535 NM_001017916 NM_001017917 NM_001017918 NM_001017919 NM_001017922 NM_001017924 NM_001017925 NM_001017927 NM_001017930 NM_001017931 NM_001017963 NM_001017967 NM_001017987 NM_001017992 NM_001017995 NM_001018000 NM_001018005 NM_001018029 NM_001018037 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018057 NM_001018061 NM_001018062 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018078 NM_001018080 NM_001018081 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018095 NM_001018097 NM_001018098 NM_001018099 NM_001018102 NM_001018104 NM_001018108 NM_001018111 NM_001018112 NM_001018122 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001020825 NM_001023560 NM_001023568 NM_001023570 NM_001023571 NM_001023587 NM_001024094 NM_001024226 NM_001024227 NM_001024228 NM_001024401 NM_001024455 NM_001024592 NM_001024603 NM_001024631 NM_001024646 NM_001024660 NM_001024667 NM_001024669 NM_001024670 NM_001024671 NM_001024676 NM_001024677 NM_001024680 NM_001024681 NM_001024688 NM_001024736 NM_001024808 NM_001024843 NM_001024844 NM_001024847 NM_001024858 NM_001024912 NM_001024959 NM_001024960 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025081 NM_001025090 NM_001025092 NM_001025094 NM_001025098 NM_001025100 NM_001025101 NM_001025107 NM_001025108 NM_001025109 NM_001025193 NM_001025197 NM_001025199 NM_001025231 NM_001025233 NM_001025252 NM_001025253 NM_001025266 NM_001031 NM_001034 NM_001035 NM_001037 NM_001042 NM_001043 NM_001044 NM_001047 NM_001048 NM_001050 NM_001062 NM_001066 NM_001083 NM_001084 NM_001089 NM_001092 NM_001093 NM_001094 NM_001095 NM_001096 NM_001099 NM_001101 NM_001106 NM_001111 NM_001112 NM_001116 NM_001117 NM_001119 NM_001121 NM_001127 NM_001128 NM_001136 NM_001139 NM_001140 NM_001150 NM_001157 NM_001160 NM_001163 NM_001167 NM_001168 NM_001175 NM_001176 NM_001177 NM_001183 NM_001184 NM_001186 NM_001188 NM_001190 NM_001191 NM_001198 NM_001204 NM_001206 NM_001218 NM_001224 NM_001230 NM_001231 NM_001233 NM_001243 NM_001244 NM_001246 NM_001257 NM_001259 NM_001261 NM_001263 NM_001264 NM_001271 NM_001282 NM_001286 NM_001295 NM_001296 NM_001298 NM_001303 NM_001304 NM_001310 NM_001315 NM_001325 NM_001330 NM_001331 NM_001334 NM_001337 NM_001343 NM_001353 NM_001354 NM_001359 NM_001361 NM_001365 NM_001379 NM_001380 NM_001382 NM_001386 NM_001387 NM_001389 NM_001390 NM_001393 NM_001399 NM_001407 NM_001412 NM_001415 NM_001417 NM_001420 NM_001421 NM_001424 NM_001430 NM_001432 NM_001438 NM_001440 NM_001450 NM_001452 NM_001457 NM_001458 NM_001460 NM_001463 NM_001465 NM_001470 NM_001482 NM_001486 NM_001490 NM_001491 NM_001495 NM_001496 NM_001498 NM_001503 NM_001512 NM_001518 NM_001532 NM_001538 NM_001542 NM_001543 NM_001555 NM_001556 NM_001558 NM_001560 NM_001563 NM_001567 NM_001584 NM_001585 NM_001606 NM_001608 NM_001609 NM_001612 NM_001616 NM_001617 NM_001630 NM_001637 NM_001650 NM_001658 NM_001659 NM_001660 NM_001661 NM_001662 NM_001664 NM_001665 NM_001666 NM_001667 NM_001668 NM_001676 NM_001678 NM_001682 NM_001683 NM_001684 NM_001686 NM_001693 NM_001695 NM_001700 NM_001701 NM_001702 NM_001703 NM_001709 NM_001711 NM_001712 NM_001716 NM_001724 NM_001731 NM_001732 NM_001737 NM_001742 NM_001749 NM_001754 NM_001759 NM_001771 NM_001773 NM_001777 NM_001781 NM_001789 NM_001790 NM_001791 NM_001793 NM_001795 NM_001802 NM_001806 NM_001821 NM_001824 NM_001829 NM_001831 NM_001832 NM_001837 NM_001841 NM_001847 NM_001853 NM_001858 NM_001859 NM_001874 NM_001875 NM_001877 NM_001878 NM_001879 NM_001886 NM_001901 NM_001904 NM_001908 NM_001909 NM_001910 NM_001915 NM_001921 NM_001928 NM_001934 NM_001936 NM_001940 NM_001941 NM_001944 NM_001949 NM_001952 NM_001954 NM_001962 NM_001970 NM_001975 NM_001977 NM_001978 NM_001980 NM_001982 NM_001987 NM_001990 NM_001993 NM_002014 NM_002017 NM_002018 NM_002025 NM_002026 NM_002028 NM_002035 NM_002040 NM_002043 NM_002044 NM_002045 NM_002051 NM_002052 NM_002055 NM_002062 NM_002064 NM_002067 NM_002068 NM_002071 NM_002072 NM_002073 NM_002075 NM_002077 NM_002084 NM_002086 NM_002091 NM_002096 NM_002097 NM_002098 NM_002111 NM_002119 NM_002120 NM_002121 NM_002123 NM_002126 NM_002127 NM_002133 NM_002135 NM_002147 NM_002154 NM_002158 NM_002180 NM_002186 NM_002196 NM_002197 NM_002199 NM_002200 NM_002202 NM_002203 NM_002204 NM_002205 NM_002209 NM_002213 NM_002214 NM_002221 NM_002222 NM_002225 NM_002226 NM_002230 NM_002231 NM_002232 NM_002235 NM_002240 NM_002241 NM_002242 NM_002247 NM_002248 NM_002249 NM_002251 NM_002254 NM_002255 NM_002271 NM_002272 NM_002274 NM_002279 NM_002283 NM_002284 NM_002285 NM_002287 NM_002309 NM_002313 NM_002314 NM_002319 NM_002334 NM_002343 NM_002347 NM_002348 NM_002349 NM_002350 NM_002357 NM_002359 NM_002382 NM_002384 NM_002385 NM_002387 NM_002389 NM_002390 NM_002394 NM_002398 NM_002402 NM_002405 NM_002406 NM_002416 NM_002428 NM_002429 NM_002430 NM_002433 NM_002441 NM_002442 NM_002445 NM_002449 NM_002451 NM_002460 NM_002462 NM_002463 NM_002465 NM_002466 NM_002468 NM_002481 NM_002483 NM_002485 NM_002492 NM_002501 NM_002510 NM_002514 NM_002515 NM_002516 NM_002519 NM_002522 NM_002527 NM_002530 NM_002531 NM_002535 NM_002540 NM_002542 NM_002545 NM_002547 NM_002556 NM_002558 NM_002560 NM_002561 NM_002563 NM_002564 NM_002565 NM_002577 NM_002581 NM_002585 NM_002586 NM_002599 NM_002600 NM_002605 NM_002608 NM_002609 NM_002610 NM_002613 NM_002616 NM_002621 NM_002638 NM_002644 NM_002646 NM_002648 NM_002651 NM_002653 NM_002657 NM_002662 NM_002665 NM_002667 NM_002668 NM_002694 NM_002699 NM_002703 NM_002705 NM_002711 NM_002713 NM_002714 NM_002716 NM_002719 NM_002720 NM_002725 NM_002730 NM_002731 NM_002732 NM_002736 NM_002737 NM_002746 NM_002748 NM_002751 NM_002753 NM_002754 NM_002755 NM_002756 NM_002758 NM_002763 NM_002773 NM_002774 NM_002778 NM_002780 NM_002783 NM_002805 NM_002813 NM_002816 NM_002817 NM_002821 NM_002824 NM_002826 NM_002832 NM_002833 NM_002834 NM_002836 NM_002842 NM_002846 NM_002847 NM_002849 NM_002857 NM_002859 NM_002867 NM_002868 NM_002869 NM_002875 NM_002879 NM_002884 NM_002892 NM_002895 NM_002901 NM_002906 NM_002909 NM_002915 NM_002924 NM_002928 NM_002930 NM_002934 NM_002937 NM_002938 NM_002941 NM_002945 NM_002953 NM_002957 NM_002959 NM_002960 NM_002971 NM_002974 NM_002990 NM_002995 NM_002996 NM_002999 NM_003001 NM_003004 NM_003006 NM_003010 NM_003011 NM_003012 NM_003015 NM_003022 NM_003024 NM_003032 NM_003037 NM_003039 NM_003042 NM_003043 NM_003044 NM_003045 NM_003046 NM_003047 NM_003052 NM_003055 NM_003056 NM_003060 NM_003071 NM_003074 NM_003075 NM_003076 NM_003081 NM_003096 NM_003098 NM_003108 NM_003118 NM_003132 NM_003144 NM_003145 NM_003147 NM_003152 NM_003155 NM_003156 NM_003159 NM_003165 NM_003179 NM_003180 NM_003190 NM_003200 NM_003201 NM_003202 NM_003203 NM_003205 NM_003206 NM_003216 NM_003218 NM_003223 NM_003227 NM_003234 NM_003236 NM_003241 NM_003242 NM_003245 NM_003246 NM_003247 NM_003257 NM_003268 NM_003274 NM_003281 NM_003286 NM_003287 NM_003288 NM_003289 NM_003307 NM_003309 NM_003312 NM_003316 NM_003320 NM_003330 NM_003337 NM_003339 NM_003344 NM_003347 NM_003348 NM_003349 NM_003355 NM_003359 NM_003366 NM_003368 NM_003371 NM_003379 NM_003381 NM_003382 NM_003387 NM_003391 NM_003392 NM_003393 NM_003406 NM_003409 NM_003417 NM_003419 NM_003421 NM_003435 NM_003439 NM_003454 NM_003458 NM_003459 NM_003466 NM_003467 NM_003473 NM_003478 NM_003479 NM_003483 NM_003486 NM_003490 NM_003498 NM_003506 NM_003507 NM_003529 NM_003557 NM_003564 NM_003565 NM_003575 NM_003576 NM_003581 NM_003583 NM_003594 NM_003602 NM_003605 NM_003607 NM_003610 NM_003612 NM_003615 NM_003616 NM_003617 NM_003626 NM_003629 NM_003632 NM_003633 NM_003634 NM_003637 NM_003644 NM_003648 NM_003658 NM_003664 NM_003665 NM_003669 NM_003677 NM_003680 NM_003681 NM_003682 NM_003685 NM_003687 NM_003689 NM_003706 NM_003707 NM_003722 NM_003726 NM_003734 NM_003746 NM_003755 NM_003758 NM_003759 NM_003763 NM_003766 NM_003768 NM_003773 NM_003779 NM_003782 NM_003800 NM_003808 NM_003810 NM_003824 NM_003825 NM_003827 NM_003834 NM_003836 NM_003838 NM_003839 NM_003842 NM_003846 NM_003848 NM_003855 NM_003858 NM_003861 NM_003862 NM_003869 NM_003870 NM_003872 NM_003873 NM_003881 NM_003883 NM_003884 NM_003885 NM_003899 NM_003900 NM_003901 NM_003906 NM_003909 NM_003910 NM_003918 NM_003922 NM_003928 NM_003936 NM_003938 NM_003939 NM_003941 NM_003943 NM_003944 NM_003945 NM_003946 NM_003947 NM_003955 NM_003957 NM_003958 NM_003966 NM_003977 NM_003979 NM_003983 NM_003986 NM_003987 NM_003988 NM_003989 NM_003990 NM_004000 NM_004019 NM_004028 NM_004039 NM_004051 NM_004055 NM_004058 NM_004059 NM_004061 NM_004064 NM_004071 NM_004072 NM_004079 NM_004080 NM_004085 NM_004086 NM_004089 NM_004096 NM_004097 NM_004101 NM_004102 NM_004103 NM_004109 NM_004110 NM_004113 NM_004116 NM_004120 NM_004128 NM_004132 NM_004133 NM_004145 NM_004148 NM_004155 NM_004157 NM_004162 NM_004171 NM_004176 NM_004177 NM_004184 NM_004185 NM_004187 NM_004188 NM_004190 NM_004200 NM_004203 NM_004209 NM_004210 NM_004213 NM_004216 NM_004231 NM_004234 NM_004236 NM_004244 NM_004261 NM_004262 NM_004263 NM_004264 NM_004272 NM_004273 NM_004274 NM_004285 NM_004286 NM_004287 NM_004290 NM_004293 NM_004296 NM_004300 NM_004302 NM_004311 NM_004313 NM_004319 NM_004326 NM_004331 NM_004338 NM_004339 NM_004343 NM_004350 NM_004360 NM_004367 NM_004368 NM_004369 NM_004376 NM_004377 NM_004380 NM_004383 NM_004384 NM_004386 NM_004391 NM_004394 NM_004405 NM_004411 NM_004412 NM_004416 NM_004421 NM_004423 NM_004428 NM_004429 NM_004430 NM_004431 NM_004434 NM_004437 NM_004438 NM_004442 NM_004455 NM_004464 NM_004466 NM_004475 NM_004481 NM_004484 NM_004487 NM_004488 NM_004494 NM_004497 NM_004503 NM_004504 NM_004507 NM_004513 NM_004514 NM_004515 NM_004518 NM_004529 NM_004531 NM_004532 NM_004536 NM_004554 NM_004555 NM_004557 NM_004560 NM_004562 NM_004566 NM_004567 NM_004571 NM_004575 NM_004578 NM_004584 NM_004585 NM_004586 NM_004588 NM_004594 NM_004598 NM_004599 NM_004604 NM_004610 NM_004615 NM_004622 NM_004624 NM_004625 NM_004629 NM_004630 NM_004634 NM_004635 NM_004637 NM_004644 NM_004646 NM_004649 NM_004650 NM_004651 NM_004653 NM_004656 NM_004659 NM_004663 NM_004670 NM_004678 NM_004686 NM_004687 NM_004693 NM_004697 NM_004706 NM_004709 NM_004711 NM_004712 NM_004714 NM_004716 NM_004717 NM_004720 NM_004721 NM_004729 NM_004730 NM_004731 NM_004734 NM_004735 NM_004736 NM_004738 NM_004740 NM_004742 NM_004745 NM_004746 NM_004747 NM_004751 NM_004752 NM_004755 NM_004759 NM_004760 NM_004762 NM_004767 NM_004775 NM_004776 NM_004778 NM_004779 NM_004788 NM_004789 NM_004795 NM_004796 NM_004797 NM_004798 NM_004799 NM_004816 NM_004821 NM_004823 NM_004833 NM_004834 NM_004840 NM_004845 NM_004848 NM_004850 NM_004860 NM_004866 NM_004871 NM_004873 NM_004878 NM_004879 NM_004887 NM_004892 NM_004897 NM_004904 NM_004913 NM_004914 NM_004915 NM_004918 NM_004921 NM_004922 NM_004924 NM_004927 NM_004928 NM_004930 NM_004933 NM_004936 NM_004937 NM_004938 NM_004945 NM_004947 NM_004948 NM_004949 NM_004951 NM_004956 NM_004957 NM_004959 NM_004961 NM_004965 NM_004975 NM_004982 NM_004984 NM_004985 NM_004992 NM_004995 NM_004996 NM_004998 NM_005010 NM_005011 NM_005026 NM_005027 NM_005032 NM_005034 NM_005036 NM_005047 NM_005048 NM_005057 NM_005060 NM_005063 NM_005065 NM_005076 NM_005079 NM_005086 NM_005088 NM_005093 NM_005096 NM_005108 NM_005109 NM_005114 NM_005116 NM_005123 NM_005127 NM_005134 NM_005137 NM_005140 NM_005144 NM_005146 NM_005147 NM_005149 NM_005151 NM_005155 NM_005157 NM_005159 NM_005163 NM_005165 NM_005173 NM_005177 NM_005184 NM_005187 NM_005188 NM_005189 NM_005191 NM_005197 NM_005199 NM_005202 NM_005206 NM_005207 NM_005212 NM_005214 NM_005219 NM_005220 NM_005221 NM_005229 NM_005233 NM_005234 NM_005238 NM_005239 NM_005240 NM_005242 NM_005248 NM_005253 NM_005257 NM_005262 NM_005266 NM_005268 NM_005271 NM_005282 NM_005291 NM_005297 NM_005311 NM_005312 NM_005313 NM_005318 NM_005327 NM_005328 NM_005329 NM_005333 NM_005334 NM_005338 NM_005342 NM_005348 NM_005356 NM_005364 NM_005365 NM_005370 NM_005371 NM_005373 NM_005379 NM_005380 NM_005385 NM_005386 NM_005387 NM_005389 NM_005390 NM_005392 NM_005397 NM_005399 NM_005400 NM_005407 NM_005410 NM_005413 NM_005416 NM_005417 NM_005419 NM_005430 NM_005432 NM_005434 NM_005435 NM_005436 NM_005439 NM_005446 NM_005452 NM_005453 NM_005458 NM_005460 NM_005461 NM_005470 NM_005471 NM_005472 NM_005474 NM_005475 NM_005476 NM_005477 NM_005479 NM_005491 NM_005501 NM_005505 NM_005506 NM_005508 NM_005511 NM_005512 NM_005513 NM_005528 NM_005540 NM_005542 NM_005546 NM_005549 NM_005550 NM_005551 NM_005552 NM_005554 NM_005561 NM_005562 NM_005576 NM_005586 NM_005588 NM_005590 NM_005591 NM_005596 NM_005598 NM_005599 NM_005602 NM_005613 NM_005624 NM_005635 NM_005636 NM_005647 NM_005652 NM_005658 NM_005660 NM_005670 NM_005677 NM_005682 NM_005683 NM_005686 NM_005688 NM_005697 NM_005699 NM_005702 NM_005709 NM_005711 NM_005715 NM_005716 NM_005717 NM_005718 NM_005722 NM_005725 NM_005730 NM_005732 NM_005735 NM_005736 NM_005740 NM_005742 NM_005747 NM_005752 NM_005755 NM_005768 NM_005777 NM_005780 NM_005789 NM_005797 NM_005798 NM_005801 NM_005803 NM_005806 NM_005808 NM_005815 NM_005816 NM_005817 NM_005819 NM_005822 NM_005828 NM_005829 NM_005831 NM_005832 NM_005834 NM_005835 NM_005838 NM_005840 NM_005843 NM_005848 NM_005864 NM_005865 NM_005876 NM_005883 NM_005885 NM_005886 NM_005899 NM_005900 NM_005902 NM_005903 NM_005904 NM_005911 NM_005920 NM_005928 NM_005933 NM_005935 NM_005937 NM_005942 NM_005943 NM_005955 NM_005957 NM_005962 NM_005964 NM_005965 NM_005966 NM_005975 NM_005978 NM_005981 NM_005982 NM_005984 NM_005986 NM_005988 NM_005989 NM_006011 NM_006015 NM_006016 NM_006020 NM_006022 NM_006030 NM_006032 NM_006036 NM_006037 NM_006038 NM_006040 NM_006042 NM_006043 NM_006045 NM_006055 NM_006057 NM_006060 NM_006065 NM_006067 NM_006074 NM_006076 NM_006087 NM_006090 NM_006091 NM_006094 NM_006099 NM_006100 NM_006106 NM_006111 NM_006112 NM_006113 NM_006129 NM_006134 NM_006135 NM_006138 NM_006147 NM_006148 NM_006160 NM_006167 NM_006178 NM_006180 NM_006183 NM_006184 NM_006185 NM_006187 NM_006195 NM_006198 NM_006201 NM_006202 NM_006203 NM_006205 NM_006212 NM_006224 NM_006228 NM_006233 NM_006235 NM_006237 NM_006238 NM_006239 NM_006241 NM_006245 NM_006253 NM_006259 NM_006263 NM_006264 NM_006266 NM_006268 NM_006271 NM_006276 NM_006282 NM_006283 NM_006290 NM_006306 NM_006317 NM_006322 NM_006327 NM_006329 NM_006330 NM_006337 NM_006338 NM_006345 NM_006352 NM_006359 NM_006361 NM_006371 NM_006373 NM_006375 NM_006377 NM_006378 NM_006383 NM_006386 NM_006389 NM_006390 NM_006393 NM_006405 NM_006418 NM_006438 NM_006439 NM_006449 NM_006453 NM_006457 NM_006462 NM_006463 NM_006464 NM_006465 NM_006469 NM_006472 NM_006474 NM_006475 NM_006482 NM_006483 NM_006484 NM_006485 NM_006487 NM_006489 NM_006492 NM_006496 NM_006499 NM_006500 NM_006503 NM_006504 NM_006508 NM_006516 NM_006517 NM_006532 NM_006534 NM_006537 NM_006539 NM_006540 NM_006544 NM_006546 NM_006548 NM_006553 NM_006555 NM_006557 NM_006561 NM_006566 NM_006572 NM_006580 NM_006586 NM_006593 NM_006595 NM_006599 NM_006603 NM_006609 NM_006614 NM_006618 NM_006620 NM_006622 NM_006631 NM_006641 NM_006644 NM_006646 NM_006651 NM_006656 NM_006658 NM_006663 NM_006669 NM_006670 NM_006675 NM_006678 NM_006696 NM_006698 NM_006709 NM_006720 NM_006729 NM_006731 NM_006732 NM_006736 NM_006737 NM_006738 NM_006741 NM_006742 NM_006744 NM_006745 NM_006746 NM_006748 NM_006749 NM_006752 NM_006762 NM_006763 NM_006766 NM_006771 NM_006772 NM_006773 NM_006775 NM_006777 NM_006781 NM_006788 NM_006789 NM_006796 NM_006801 NM_006805 NM_006809 NM_006818 NM_006819 NM_006820 NM_006821 NM_006822 NM_006825 NM_006828 NM_006830 NM_006836 NM_006847 NM_006852 NM_006856 NM_006857 NM_006861 NM_006873 NM_006874 NM_006876 NM_006877 NM_006888 NM_006890 NM_006895 NM_006902 NM_006914 NM_006919 NM_006922 NM_006923 NM_006926 NM_006938 NM_006940 NM_006941 NM_006943 NM_006945 NM_006952 NM_006955 NM_006961 NM_006974 NM_006981 NM_006983 NM_006987 NM_006989 NM_006995 NM_007003 NM_007005 NM_007013 NM_007022 NM_007026 NM_007028 NM_007031 NM_007034 NM_007038 NM_007050 NM_007055 NM_007057 NM_007058 NM_007064 NM_007067 NM_007068 NM_007073 NM_007078 NM_007079 NM_007084 NM_007099 NM_007111 NM_007123 NM_007125 NM_007129 NM_007131 NM_007136 NM_007137 NM_007144 NM_007146 NM_007150 NM_007151 NM_007157 NM_007163 NM_007173 NM_007175 NM_007176 NM_007182 NM_007185 NM_007192 NM_007197 NM_007200 NM_007202 NM_007203 NM_007212 NM_007213 NM_007214 NM_007215 NM_007219 NM_007221 NM_007229 NM_007232 NM_007236 NM_007247 NM_007249 NM_007256 NM_007257 NM_007268 NM_007270 NM_007271 NM_007274 NM_007278 NM_007287 NM_007288 NM_007289 NM_007306 NM_007310 NM_007313 NM_007315 NM_007318 NM_007324 NM_007341 NM_007345 NM_007350 NM_007352 NM_007353 NM_007354 NM_007357 NM_007359 NM_007362 NM_007375 NM_009589 NM_012072 NM_012074 NM_012075 NM_012080 NM_012084 NM_012095 NM_012097 NM_012098 NM_012101 NM_012102 NM_012105 NM_012106 NM_012111 NM_012113 NM_012119 NM_012121 NM_012126 NM_012146 NM_012153 NM_012156 NM_012170 NM_012173 NM_012174 NM_012180 NM_012186 NM_012188 NM_012193 NM_012198 NM_012199 NM_012206 NM_012208 NM_012210 NM_012211 NM_012219 NM_012223 NM_012231 NM_012232 NM_012234 NM_012244 NM_012245 NM_012247 NM_012248 NM_012249 NM_012250 NM_012259 NM_012261 NM_012262 NM_012264 NM_012268 NM_012275 NM_012279 NM_012282 NM_012285 NM_012288 NM_012292 NM_012306 NM_012308 NM_012309 NM_012312 NM_012314 NM_012317 NM_012318 NM_012324 NM_012326 NM_012328 NM_012329 NM_012331 NM_012333 NM_012346 NM_012384 NM_012391 NM_012395 NM_012397 NM_012398 NM_012402 NM_012409 NM_012418 NM_012425 NM_012427 NM_012428 NM_012430 NM_012431 NM_012434 NM_012436 NM_012445 NM_012446 NM_012448 NM_012453 NM_012465 NM_012476 NM_012478 NM_012479 NM_013229 NM_013231 NM_013251 NM_013252 NM_013253 NM_013255 NM_013261 NM_013276 NM_013279 NM_013280 NM_013284 NM_013286 NM_013289 NM_013305 NM_013309 NM_013312 NM_013322 NM_013325 NM_013336 NM_013337 NM_013341 NM_013343 NM_013346 NM_013348 NM_013354 NM_013363 NM_013364 NM_013373 NM_013382 NM_013385 NM_013386 NM_013389 NM_013393 NM_013402 NM_013410 NM_013433 NM_013435 NM_013438 NM_013446 NM_013449 NM_013453 NM_013943 NM_013951 NM_013952 NM_013953 NM_013987 NM_013988 NM_013989 NM_013992 NM_013993 NM_013994 NM_014002 NM_014005 NM_014008 NM_014010 NM_014021 NM_014030 NM_014048 NM_014066 NM_014080 NM_014096 NM_014110 NM_014112 NM_014138 NM_014141 NM_014154 NM_014157 NM_014160 NM_014189 NM_014190 NM_014214 NM_014217 NM_014228 NM_014231 NM_014232 NM_014240 NM_014242 NM_014243 NM_014252 NM_014257 NM_014262 NM_014276 NM_014286 NM_014289 NM_014292 NM_014299 NM_014308 NM_014310 NM_014314 NM_014325 NM_014342 NM_014344 NM_014354 NM_014358 NM_014372 NM_014388 NM_014392 NM_014397 NM_014400 NM_014405 NM_014409 NM_014411 NM_014413 NM_014415 NM_014418 NM_014421 NM_014422 NM_014431 NM_014432 NM_014437 NM_014442 NM_014444 NM_014449 NM_014452 NM_014454 NM_014458 NM_014460 NM_014474 NM_014483 NM_014484 NM_014485 NM_014494 NM_014504 NM_014506 NM_014511 NM_014513 NM_014517 NM_014518 NM_014520 NM_014548 NM_014550 NM_014552 NM_014553 NM_014554 NM_014556 NM_014564 NM_014569 NM_014571 NM_014584 NM_014586 NM_014587 NM_014592 NM_014594 NM_014600 NM_014604 NM_014606 NM_014608 NM_014613 NM_014614 NM_014620 NM_014621 NM_014625 NM_014631 NM_014633 NM_014634 NM_014636 NM_014637 NM_014640 NM_014641 NM_014642 NM_014646 NM_014647 NM_014653 NM_014655 NM_014661 NM_014665 NM_014667 NM_014674 NM_014675 NM_014681 NM_014690 NM_014697 NM_014698 NM_014700 NM_014702 NM_014704 NM_014707 NM_014711 NM_014719 NM_014720 NM_014723 NM_014728 NM_014730 NM_014731 NM_014734 NM_014735 NM_014737 NM_014741 NM_014742 NM_014743 NM_014744 NM_014746 NM_014747 NM_014749 NM_014756 NM_014758 NM_014759 NM_014760 NM_014764 NM_014766 NM_014767 NM_014772 NM_014774 NM_014776 NM_014779 NM_014786 NM_014787 NM_014788 NM_014789 NM_014792 NM_014798 NM_014800 NM_014801 NM_014804 NM_014807 NM_014808 NM_014809 NM_014812 NM_014819 NM_014821 NM_014826 NM_014827 NM_014830 NM_014832 NM_014836 NM_014837 NM_014844 NM_014848 NM_014850 NM_014854 NM_014858 NM_014859 NM_014860 NM_014864 NM_014872 NM_014873 NM_014875 NM_014876 NM_014880 NM_014884 NM_014887 NM_014892 NM_014893 NM_014895 NM_014899 NM_014902 NM_014905 NM_014906 NM_014909 NM_014919 NM_014920 NM_014921 NM_014923 NM_014925 NM_014926 NM_014930 NM_014931 NM_014932 NM_014934 NM_014935 NM_014936 NM_014940 NM_014943 NM_014944 NM_014945 NM_014948 NM_014949 NM_014951 NM_014953 NM_014954 NM_014956 NM_014957 NM_014962 NM_014965 NM_014988 NM_014997 NM_015000 NM_015008 NM_015011 NM_015015 NM_015020 NM_015022 NM_015023 NM_015027 NM_015032 NM_015033 NM_015035 NM_015039 NM_015040 NM_015044 NM_015047 NM_015049 NM_015050 NM_015052 NM_015053 NM_015055 NM_015056 NM_015058 NM_015061 NM_015063 NM_015064 NM_015066 NM_015071 NM_015074 NM_015075 NM_015077 NM_015079 NM_015080 NM_015085 NM_015086 NM_015088 NM_015090 NM_015092 NM_015093 NM_015094 NM_015097 NM_015100 NM_015101 NM_015111 NM_015113 NM_015115 NM_015116 NM_015124 NM_015144 NM_015149 NM_015157 NM_015166 NM_015170 NM_015173 NM_015185 NM_015187 NM_015190 NM_015192 NM_015194 NM_015202 NM_015206 NM_015225 NM_015227 NM_015235 NM_015236 NM_015245 NM_015246 NM_015252 NM_015253 NM_015254 NM_015256 NM_015257 NM_015260 NM_015264 NM_015265 NM_015267 NM_015270 NM_015282 NM_015285 NM_015286 NM_015288 NM_015289 NM_015294 NM_015299 NM_015305 NM_015310 NM_015315 NM_015326 NM_015327 NM_015329 NM_015330 NM_015331 NM_015335 NM_015338 NM_015341 NM_015345 NM_015347 NM_015349 NM_015353 NM_015359 NM_015361 NM_015369 NM_015373 NM_015374 NM_015375 NM_015380 NM_015382 NM_015385 NM_015387 NM_015388 NM_015391 NM_015393 NM_015394 NM_015397 NM_015409 NM_015411 NM_015415 NM_015419 NM_015423 NM_015428 NM_015431 NM_015433 NM_015447 NM_015450 NM_015455 NM_015456 NM_015458 NM_015460 NM_015461 NM_015470 NM_015475 NM_015477 NM_015481 NM_015488 NM_015493 NM_015507 NM_015511 NM_015518 NM_015532 NM_015535 NM_015544 NM_015553 NM_015557 NM_015559 NM_015560 NM_015564 NM_015565 NM_015567 NM_015568 NM_015576 NM_015584 NM_015595 NM_015596 NM_015605 NM_015627 NM_015635 NM_015640 NM_015642 NM_015651 NM_015654 NM_015667 NM_015677 NM_015691 NM_015695 NM_015701 NM_015726 NM_015831 NM_015833 NM_015836 NM_015840 NM_015841 NM_015844 NM_015846 NM_015847 NM_015865 NM_015868 NM_015881 NM_015892 NM_015898 NM_015921 NM_015922 NM_015937 NM_015938 NM_015941 NM_015947 NM_015971 NM_015975 NM_015981 NM_015983 NM_015985 NM_015993 NM_015995 NM_015997 NM_016004 NM_016016 NM_016018 NM_016022 NM_016023 NM_016025 NM_016032 NM_016040 NM_016041 NM_016048 NM_016057 NM_016061 NM_016063 NM_016076 NM_016079 NM_016081 NM_016083 NM_016087 NM_016089 NM_016095 NM_016097 NM_016114 NM_016122 NM_016132 NM_016138 NM_016144 NM_016148 NM_016150 NM_016156 NM_016169 NM_016173 NM_016175 NM_016184 NM_016185 NM_016190 NM_016196 NM_016201 NM_016206 NM_016209 NM_016210 NM_016212 NM_016217 NM_016222 NM_016224 NM_016233 NM_016237 NM_016240 NM_016242 NM_016243 NM_016246 NM_016248 NM_016255 NM_016263 NM_016270 NM_016272 NM_016280 NM_016281 NM_016319 NM_016322 NM_016323 NM_016339 NM_016340 NM_016352 NM_016353 NM_016362 NM_016363 NM_016369 NM_016376 NM_016389 NM_016390 NM_016396 NM_016407 NM_016418 NM_016422 NM_016430 NM_016431 NM_016448 NM_016456 NM_016463 NM_016474 NM_016475 NM_016483 NM_016484 NM_016488 NM_016489 NM_016507 NM_016511 NM_016513 NM_016516 NM_016525 NM_016526 NM_016531 NM_016532 NM_016534 NM_016539 NM_016540 NM_016544 NM_016545 NM_016546 NM_016551 NM_016553 NM_016562 NM_016574 NM_016575 NM_016577 NM_016583 NM_016598 NM_016604 NM_016605 NM_016613 NM_016621 NM_016622 NM_016625 NM_016630 NM_016652 NM_016734 NM_016735 NM_016818 NM_016819 NM_016823 NM_016824 NM_016827 NM_016828 NM_016829 NM_016929 NM_016930 NM_016932 NM_016936 NM_016941 NM_017410 NM_017413 NM_017415 NM_017418 NM_017420 NM_017424 NM_017433 NM_017437 NM_017439 NM_017443 NM_017444 NM_017449 NM_017455 NM_017456 NM_017460 NM_017483 NM_017485 NM_017486 NM_017488 NM_017489 NM_017510 NM_017514 NM_017515 NM_017540 NM_017544 NM_017550 NM_017551 NM_017563 NM_017564 NM_017575 NM_017582 NM_017583 NM_017588 NM_017590 NM_017592 NM_017594 NM_017599 NM_017600 NM_017602 NM_017610 NM_017611 NM_017623 NM_017626 NM_017628 NM_017629 NM_017634 NM_017637 NM_017644 NM_017652 NM_017655 NM_017656 NM_017660 NM_017665 NM_017666 NM_017671 NM_017676 NM_017678 NM_017686 NM_017692 NM_017694 NM_017699 NM_017704 NM_017705 NM_017707 NM_017712 NM_017715 NM_017723 NM_017727 NM_017736 NM_017738 NM_017742 NM_017744 NM_017748 NM_017751 NM_017760 NM_017770 NM_017773 NM_017781 NM_017784 NM_017787 NM_017789 NM_017799 NM_017801 NM_017814 NM_017822 NM_017824 NM_017828 NM_017832 NM_017842 NM_017843 NM_017849 NM_017851 NM_017856 NM_017860 NM_017896 NM_017902 NM_017908 NM_017919 NM_017926 NM_017928 NM_017935 NM_017938 NM_017941 NM_017951 NM_017964 NM_017966 NM_017967 NM_017969 NM_017971 NM_017972 NM_017974 NM_017975 NM_017980 NM_017982 NM_017990 NM_017999 NM_018000 NM_018013 NM_018018 NM_018019 NM_018022 NM_018023 NM_018024 NM_018027 NM_018028 NM_018038 NM_018039 NM_018045 NM_018046 NM_018057 NM_018067 NM_018069 NM_018077 NM_018082 NM_018084 NM_018090 NM_018092 NM_018096 NM_018101 NM_018106 NM_018107 NM_018108 NM_018112 NM_018117 NM_018129 NM_018137 NM_018140 NM_018143 NM_018145 NM_018150 NM_018152 NM_018153 NM_018155 NM_018157 NM_018159 NM_018164 NM_018168 NM_018170 NM_018173 NM_018178 NM_018182 NM_018184 NM_018189 NM_018191 NM_018192 NM_018196 NM_018198 NM_018200 NM_018201 NM_018203 NM_018204 NM_018205 NM_018208 NM_018210 NM_018211 NM_018212 NM_018214 NM_018215 NM_018222 NM_018224 NM_018226 NM_018227 NM_018235 NM_018239 NM_018240 NM_018243 NM_018244 NM_018249 NM_018250 NM_018259 NM_018263 NM_018265 NM_018267 NM_018268 NM_018279 NM_018281 NM_018286 NM_018299 NM_018303 NM_018316 NM_018319 NM_018322 NM_018326 NM_018332 NM_018337 NM_018353 NM_018357 NM_018358 NM_018360 NM_018363 NM_018364 NM_018370 NM_018371 NM_018373 NM_018374 NM_018375 NM_018378 NM_018382 NM_018384 NM_018389 NM_018393 NM_018401 NM_018404 NM_018406 NM_018407 NM_018409 NM_018414 NM_018416 NM_018419 NM_018420 NM_018424 NM_018425 NM_018431 NM_018440 NM_018450 NM_018453 NM_018462 NM_018465 NM_018475 NM_018478 NM_018482 NM_018488 NM_018489 NM_018494 NM_018502 NM_018538 NM_018555 NM_018566 NM_018571 NM_018579 NM_018602 NM_018639 NM_018640 NM_018644 NM_018648 NM_018656 NM_018658 NM_018659 NM_018660 NM_018662 NM_018664 NM_018669 NM_018674 NM_018683 NM_018684 NM_018689 NM_018695 NM_018706 NM_018711 NM_018714 NM_018715 NM_018718 NM_018728 NM_018841 NM_018843 NM_018847 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018941 NM_018944 NM_018947 NM_018952 NM_018962 NM_018969 NM_018977 NM_018982 NM_018987 NM_018988 NM_018991 NM_018992 NM_018993 NM_018997 NM_018999 NM_019001 NM_019008 NM_019009 NM_019011 NM_019014 NM_019018 NM_019020 NM_019027 NM_019034 NM_019035 NM_019041 NM_019049 NM_019054 NM_019055 NM_019061 NM_019063 NM_019064 NM_019069 NM_019072 NM_019081 NM_019086 NM_019087 NM_019094 NM_019105 NM_019106 NM_019555 NM_019556 NM_019590 NM_019592 NM_019593 NM_019596 NM_019600 NM_019624 NM_019625 NM_019845 NM_019854 NM_019855 NM_019858 NM_019862 NM_019863 NM_019887 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_019903 NM_020039 NM_020056 NM_020064 NM_020069 NM_020070 NM_020107 NM_020108 NM_020109 NM_020110 NM_020111 NM_020113 NM_020114 NM_020115 NM_020119 NM_020123 NM_020124 NM_020125 NM_020127 NM_020128 NM_020131 NM_020132 NM_020133 NM_020150 NM_020151 NM_020157 NM_020161 NM_020162 NM_020165 NM_020166 NM_020168 NM_020177 NM_020178 NM_020179 NM_020180 NM_020182 NM_020199 NM_020203 NM_020228 NM_020235 NM_020237 NM_020239 NM_020245 NM_020247 NM_020248 NM_020309 NM_020310 NM_020311 NM_020313 NM_020315 NM_020319 NM_020335 NM_020337 NM_020338 NM_020341 NM_020342 NM_020346 NM_020347 NM_020348 NM_020350 NM_020353 NM_020360 NM_020367 NM_020370 NM_020373 NM_020374 NM_020375 NM_020377 NM_020384 NM_020393 NM_020400 NM_020402 NM_020403 NM_020404 NM_020405 NM_020408 NM_020416 NM_020418 NM_020421 NM_020429 NM_020439 NM_020440 NM_020443 NM_020448 NM_020451 NM_020452 NM_020453 NM_020462 NM_020474 NM_020475 NM_020476 NM_020477 NM_020528 NM_020535 NM_020546 NM_020550 NM_020638 NM_020639 NM_020651 NM_020659 NM_020661 NM_020673 NM_020684 NM_020686 NM_020689 NM_020693 NM_020698 NM_020699 NM_020702 NM_020708 NM_020711 NM_020714 NM_020715 NM_020717 NM_020727 NM_020738 NM_020742 NM_020746 NM_020748 NM_020750 NM_020751 NM_020753 NM_020755 NM_020764 NM_020766 NM_020768 NM_020770 NM_020771 NM_020773 NM_020776 NM_020777 NM_020778 NM_020779 NM_020781 NM_020782 NM_020789 NM_020792 NM_020801 NM_020803 NM_020804 NM_020809 NM_020810 NM_020825 NM_020826 NM_020830 NM_020831 NM_020832 NM_020834 NM_020844 NM_020850 NM_020851 NM_020853 NM_020857 NM_020859 NM_020868 NM_020886 NM_020888 NM_020892 NM_020899 NM_020909 NM_020914 NM_020918 NM_020921 NM_020922 NM_020925 NM_020927 NM_020933 NM_020935 NM_020944 NM_020946 NM_020947 NM_020951 NM_020952 NM_020954 NM_020956 NM_020962 NM_020967 NM_020970 NM_020971 NM_020980 NM_020983 NM_020988 NM_020992 NM_020993 NM_021010 NM_021014 NM_021019 NM_021020 NM_021032 NM_021035 NM_021038 NM_021045 NM_021049 NM_021067 NM_021083 NM_021088 NM_021096 NM_021101 NM_021105 NM_021110 NM_021116 NM_021128 NM_021131 NM_021132 NM_021133 NM_021135 NM_021137 NM_021146 NM_021151 NM_021155 NM_021156 NM_021165 NM_021168 NM_021181 NM_021183 NM_021187 NM_021200 NM_021202 NM_021205 NM_021210 NM_021212 NM_021221 NM_021222 NM_021233 NM_021242 NM_021260 NM_021269 NM_021571 NM_021572 NM_021612 NM_021615 NM_021619 NM_021624 NM_021635 NM_021636 NM_021637 NM_021638 NM_021645 NM_021648 NM_021652 NM_021706 NM_021724 NM_021735 NM_021736 NM_021737 NM_021783 NM_021795 NM_021807 NM_021809 NM_021813 NM_021815 NM_021817 NM_021821 NM_021903 NM_021904 NM_021905 NM_021908 NM_021916 NM_021923 NM_021934 NM_021936 NM_021937 NM_021947 NM_021950 NM_021958 NM_021959 NM_021960 NM_021961 NM_021962 NM_021965 NM_021976 NM_021977 NM_021979 NM_021984 NM_021987 NM_021988 NM_021990 NM_021991 NM_022041 NM_022046 NM_022049 NM_022051 NM_022054 NM_022055 NM_022059 NM_022060 NM_022062 NM_022067 NM_022081 NM_022085 NM_022106 NM_022112 NM_022114 NM_022116 NM_022123 NM_022124 NM_022130 NM_022131 NM_022134 NM_022137 NM_022140 NM_022152 NM_022160 NM_022166 NM_022167 NM_022169 NM_022170 NM_022171 NM_022307 NM_022336 NM_022346 NM_022356 NM_022361 NM_022363 NM_022442 NM_022457 NM_022459 NM_022460 NM_022465 NM_022473 NM_022476 NM_022477 NM_022478 NM_022479 NM_022482 NM_022483 NM_022485 NM_022491 NM_022497 NM_022566 NM_022570 NM_022571 NM_022572 NM_022648 NM_022658 NM_022661 NM_022716 NM_022726 NM_022730 NM_022731 NM_022737 NM_022739 NM_022752 NM_022753 NM_022755 NM_022756 NM_022757 NM_022758 NM_022759 NM_022763 NM_022767 NM_022768 NM_022779 NM_022789 NM_022791 NM_022792 NM_022809 NM_022817 NM_022819 NM_022822 NM_022824 NM_022825 NM_022829 NM_022832 NM_022836 NM_022842 NM_022894 NM_022895 NM_022898 NM_022899 NM_022901 NM_022905 NM_022912 NM_022913 NM_022917 NM_022918 NM_022969 NM_022970 NM_022972 NM_022975 NM_023000 NM_023001 NM_023002 NM_023004 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023032 NM_023033 NM_023037 NM_023067 NM_023071 NM_023072 NM_023074 NM_023075 NM_023078 NM_023080 NM_023109 NM_023112 NM_023936 NM_023937 NM_023938 NM_023939 NM_023947 NM_024015 NM_024016 NM_024017 NM_024022 NM_024025 NM_024033 NM_024034 NM_024038 NM_024052 NM_024054 NM_024069 NM_024072 NM_024074 NM_024076 NM_024080 NM_024085 NM_024086 NM_024092 NM_024102 NM_024293 NM_024294 NM_024295 NM_024301 NM_024310 NM_024311 NM_024312 NM_024320 NM_024328 NM_024334 NM_024335 NM_024342 NM_024348 NM_024408 NM_024411 NM_024417 NM_024421 NM_024422 NM_024423 NM_024430 NM_024490 NM_024491 NM_024493 NM_024494 NM_024503 NM_024510 NM_024511 NM_024513 NM_024517 NM_024522 NM_024533 NM_024544 NM_024545 NM_024551 NM_024554 NM_024557 NM_024558 NM_024561 NM_024567 NM_024575 NM_024578 NM_024581 NM_024583 NM_024590 NM_024594 NM_024598 NM_024602 NM_024607 NM_024610 NM_024611 NM_024613 NM_024616 NM_024626 NM_024627 NM_024628 NM_024633 NM_024637 NM_024646 NM_024649 NM_024653 NM_024657 NM_024662 NM_024665 NM_024670 NM_024674 NM_024677 NM_024681 NM_024698 NM_024701 NM_024705 NM_024707 NM_024709 NM_024711 NM_024726 NM_024729 NM_024733 NM_024735 NM_024738 NM_024743 NM_024744 NM_024745 NM_024749 NM_024761 NM_024770 NM_024771 NM_024772 NM_024779 NM_024780 NM_024782 NM_024783 NM_024784 NM_024785 NM_024791 NM_024798 NM_024800 NM_024807 NM_024818 NM_024819 NM_024821 NM_024830 NM_024833 NM_024836 NM_024841 NM_024843 NM_024850 NM_024866 NM_024870 NM_024871 NM_024874 NM_024875 NM_024877 NM_024881 NM_024882 NM_024886 NM_024887 NM_024896 NM_024909 NM_024910 NM_024911 NM_024915 NM_024922 NM_024938 NM_024939 NM_024940 NM_024941 NM_024942 NM_024943 NM_024953 NM_024955 NM_024958 NM_024971 NM_024974 NM_024986 NM_024996 NM_025004 NM_025030 NM_025031 NM_025042 NM_025049 NM_025057 NM_025058 NM_025061 NM_025063 NM_025073 NM_025076 NM_025079 NM_025082 NM_025083 NM_025084 NM_025090 NM_025104 NM_025106 NM_025108 NM_025129 NM_025134 NM_025146 NM_025149 NM_025151 NM_025161 NM_025164 NM_025184 NM_025191 NM_025194 NM_025197 NM_025201 NM_025203 NM_025208 NM_025213 NM_025214 NM_025230 NM_025235 NM_025236 NM_025238 NM_025240 NM_025243 NM_025247 NM_025250 NM_025251 NM_025256 NM_025259 NM_025261 NM_025268 NM_030569 NM_030570 NM_030571 NM_030579 NM_030621 NM_030625 NM_030626 NM_030627 NM_030628 NM_030629 NM_030633 NM_030634 NM_030636 NM_030640 NM_030641 NM_030643 NM_030648 NM_030650 NM_030661 NM_030665 NM_030752 NM_030753 NM_030758 NM_030767 NM_030770 NM_030774 NM_030775 NM_030776 NM_030777 NM_030781 NM_030786 NM_030796 NM_030798 NM_030803 NM_030806 NM_030809 NM_030810 NM_030817 NM_030877 NM_030881 NM_030882 NM_030883 NM_030885 NM_030891 NM_030911 NM_030912 NM_030914 NM_030915 NM_030916 NM_030918 NM_030920 NM_030923 NM_030925 NM_030926 NM_030929 NM_030934 NM_030937 NM_030949 NM_030950 NM_030953 NM_030958 NM_030960 NM_030964 NM_030966 NM_030981 NM_031200 NM_031212 NM_031216 NM_031227 NM_031228 NM_031229 NM_031268 NM_031281 NM_031283 NM_031293 NM_031294 NM_031295 NM_031296 NM_031305 NM_031313 NM_031363 NM_031364 NM_031407 NM_031409 NM_031411 NM_031416 NM_031418 NM_031426 NM_031429 NM_031433 NM_031435 NM_031437 NM_031438 NM_031439 NM_031444 NM_031445 NM_031453 NM_031455 NM_031457 NM_031459 NM_031463 NM_031473 NM_031474 NM_031476 NM_031478 NM_031481 NM_031484 NM_031485 NM_031491 NM_031849 NM_031854 NM_031857 NM_031858 NM_031860 NM_031862 NM_031889 NM_031890 NM_031891 NM_031892 NM_031901 NM_031904 NM_031910 NM_031912 NM_031920 NM_031936 NM_031942 NM_031952 NM_031954 NM_031988 NM_031992 NM_032013 NM_032014 NM_032015 NM_032017 NM_032023 NM_032028 NM_032039 NM_032042 NM_032044 NM_032045 NM_032046 NM_032052 NM_032053 NM_032105 NM_032109 NM_032120 NM_032130 NM_032134 NM_032136 NM_032139 NM_032144 NM_032160 NM_032174 NM_032192 NM_032208 NM_032211 NM_032213 NM_032214 NM_032217 NM_032221 NM_032222 NM_032227 NM_032228 NM_032242 NM_032255 NM_032266 NM_032276 NM_032281 NM_032283 NM_032286 NM_032287 NM_032288 NM_032290 NM_032294 NM_032300 NM_032310 NM_032311 NM_032322 NM_032325 NM_032329 NM_032351 NM_032361 NM_032369 NM_032372 NM_032375 NM_032383 NM_032385 NM_032401 NM_032404 NM_032410 NM_032414 NM_032417 NM_032425 NM_032429 NM_032430 NM_032433 NM_032434 NM_032435 NM_032440 NM_032442 NM_032445 NM_032446 NM_032448 NM_032452 NM_032459 NM_032470 NM_032486 NM_032492 NM_032495 NM_032499 NM_032501 NM_032508 NM_032512 NM_032521 NM_032529 NM_032536 NM_032538 NM_032539 NM_032550 NM_032552 NM_032554 NM_032558 NM_032587 NM_032588 NM_032590 NM_032592 NM_032611 NM_032642 NM_032643 NM_032646 NM_032664 NM_032683 NM_032701 NM_032710 NM_032711 NM_032721 NM_032726 NM_032732 NM_032735 NM_032738 NM_032740 NM_032744 NM_032750 NM_032753 NM_032756 NM_032775 NM_032780 NM_032785 NM_032786 NM_032787 NM_032788 NM_032792 NM_032800 NM_032804 NM_032817 NM_032826 NM_032827 NM_032829 NM_032836 NM_032837 NM_032839 NM_032843 NM_032846 NM_032848 NM_032854 NM_032862 NM_032865 NM_032866 NM_032870 NM_032872 NM_032873 NM_032875 NM_032876 NM_032882 NM_032883 NM_032889 NM_032900 NM_032907 NM_032918 NM_032928 NM_032932 NM_032933 NM_032940 NM_032951 NM_032952 NM_032953 NM_032954 NM_032960 NM_032961 NM_032966 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032980 NM_032982 NM_032983 NM_032984 NM_032988 NM_032994 NM_032995 NM_032997 NM_032998 NM_032999 NM_033000 NM_033001 NM_033008 NM_033009 NM_033010 NM_033016 NM_033017 NM_033018 NM_033027 NM_033028 NM_033034 NM_033035 NM_033045 NM_033049 NM_033053 NM_033058 NM_033059 NM_033082 NM_033083 NM_033086 NM_033089 NM_033091 NM_033092 NM_033100 NM_033102 NM_033112 NM_033119 NM_033127 NM_033129 NM_033130 NM_033131 NM_033133 NM_033135 NM_033143 NM_033153 NM_033158 NM_033170 NM_033171 NM_033172 NM_033173 NM_033181 NM_033182 NM_033198 NM_033201 NM_033207 NM_033212 NM_033221 NM_033224 NM_033238 NM_033253 NM_033262 NM_033271 NM_033274 NM_033285 NM_033290 NM_033291 NM_033303 NM_033305 NM_033317 NM_033332 NM_033343 NM_033346 NM_033360 NM_033386 NM_033387 NM_033389 NM_033393 NM_033397 NM_033400 NM_033409 NM_033419 NM_033421 NM_033425 NM_033426 NM_033430 NM_033437 NM_033446 NM_033450 NM_033453 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033505 NM_033507 NM_033508 NM_033510 NM_033512 NM_033515 NM_033516 NM_033542 NM_033544 NM_033549 NM_033551 NM_033626 NM_033631 NM_033637 NM_033649 NM_052811 NM_052816 NM_052821 NM_052822 NM_052832 NM_052834 NM_052843 NM_052847 NM_052848 NM_052849 NM_052851 NM_052854 NM_052857 NM_052859 NM_052869 NM_052874 NM_052876 NM_052882 NM_052885 NM_052886 NM_052890 NM_052891 NM_052892 NM_052896 NM_052906 NM_052910 NM_052917 NM_052918 NM_052919 NM_052925 NM_052926 NM_052931 NM_052934 NM_052937 NM_052939 NM_052941 NM_052949 NM_052952 NM_052955 NM_052959 NM_052965 NM_052966 NM_052978 NM_053005 NM_053023 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053051 NM_053064 NM_053277 NM_053279 NM_053282 NM_054022 NM_054025 NM_054033 NM_054108 NM_054110 NM_057088 NM_057164 NM_057165 NM_057166 NM_057167 NM_057168 NM_057169 NM_057170 NM_057174 NM_057178 NM_058164 NM_058166 NM_058172 NM_058174 NM_058175 NM_058188 NM_058189 NM_058197 NM_058238 NM_058240 NM_058242 NM_058243 NM_058244 NM_058246 NM_058248 NM_078467 NM_078470 NM_078471 NM_078483 NM_078487 NM_078628 NM_079423 NM_079424 NM_079425 NM_080391 NM_080392 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080550 NM_080551 NM_080552 NM_080588 NM_080589 NM_080590 NM_080593 NM_080605 NM_080612 NM_080617 NM_080627 NM_080628 NM_080650 NM_080669 NM_080683 NM_080684 NM_080685 NM_080725 NM_080733 NM_080738 NM_080747 NM_080751 NM_080764 NM_080792 NM_080821 NM_080827 NM_080836 NM_080840 NM_080841 NM_080863 NM_080867 NM_080870 NM_080872 NM_080876 NM_080928 NM_130387 NM_130435 NM_130439 NM_130442 NM_130470 NM_130471 NM_130472 NM_130473 NM_130474 NM_130475 NM_130476 NM_130766 NM_130770 NM_130773 NM_130783 NM_130786 NM_130797 NM_130798 NM_130807 NM_130811 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130842 NM_130843 NM_130845 NM_130846 NM_130848 NM_130852 NM_130897 NM_133170 NM_133171 NM_133175 NM_133176 NM_133265 NM_133326 NM_133328 NM_133334 NM_133367 NM_133371 NM_133375 NM_133379 NM_133448 NM_133452 NM_133456 NM_133459 NM_133460 NM_133462 NM_133464 NM_133467 NM_133468 NM_133476 NM_133477 NM_133482 NM_133487 NM_133493 NM_133498 NM_133631 NM_133632 NM_133633 NM_133634 NM_133635 NM_133640 NM_133646 NM_134264 NM_134422 NM_134423 NM_134424 NM_134433 NM_134434 NM_134444 NM_134470 NM_138270 NM_138271 NM_138281 NM_138287 NM_138297 NM_138298 NM_138299 NM_138300 NM_138323 NM_138324 NM_138333 NM_138338 NM_138341 NM_138348 NM_138360 NM_138362 NM_138369 NM_138370 NM_138372 NM_138373 NM_138375 NM_138376 NM_138387 NM_138389 NM_138390 NM_138400 NM_138402 NM_138409 NM_138434 NM_138447 NM_138450 NM_138455 NM_138457 NM_138458 NM_138468 NM_138473 NM_138494 NM_138551 NM_138558 NM_138566 NM_138567 NM_138572 NM_138574 NM_138576 NM_138578 NM_138608 NM_138612 NM_138640 NM_138691 NM_138693 NM_138694 NM_138713 NM_138714 NM_138717 NM_138726 NM_138727 NM_138728 NM_138731 NM_138732 NM_138734 NM_138768 NM_138771 NM_138774 NM_138777 NM_138790 NM_138793 NM_138797 NM_138799 NM_138801 NM_138810 NM_138811 NM_138817 NM_138818 NM_138928 NM_138929 NM_138930 NM_138934 NM_138939 NM_138940 NM_138961 NM_138967 NM_138969 NM_138970 NM_138980 NM_138981 NM_138982 NM_138983 NM_138991 NM_138992 NM_138993 NM_138999 NM_139004 NM_139012 NM_139014 NM_139015 NM_139021 NM_139024 NM_139048 NM_139058 NM_139067 NM_139071 NM_139076 NM_139124 NM_139125 NM_139131 NM_139135 NM_139164 NM_139167 NM_139168 NM_139177 NM_139199 NM_139202 NM_139211 NM_139212 NM_139235 NM_139239 NM_139240 NM_139246 NM_139248 NM_139267 NM_139279 NM_139283 NM_139319 NM_139321 NM_144490 NM_144577 NM_144578 NM_144579 NM_144582 NM_144583 NM_144588 NM_144596 NM_144597 NM_144599 NM_144607 NM_144621 NM_144622 NM_144628 NM_144629 NM_144632 NM_144633 NM_144635 NM_144639 NM_144642 NM_144657 NM_144677 NM_144678 NM_144682 NM_144688 NM_144691 NM_144692 NM_144693 NM_144717 NM_144718 NM_144767 NM_144769 NM_144772 NM_144967 NM_144969 NM_144975 NM_144984 NM_144985 NM_144992 NM_144994 NM_144996 NM_144997 NM_144998 NM_145005 NM_145010 NM_145011 NM_145012 NM_145029 NM_145037 NM_145039 NM_145041 NM_145053 NM_145055 NM_145059 NM_145061 NM_145102 NM_145109 NM_145110 NM_145112 NM_145113 NM_145117 NM_145159 NM_145165 NM_145166 NM_145173 NM_145179 NM_145185 NM_145200 NM_145212 NM_145214 NM_145234 NM_145237 NM_145239 NM_145244 NM_145245 NM_145246 NM_145250 NM_145255 NM_145257 NM_145258 NM_145259 NM_145262 NM_145265 NM_145268 NM_145276 NM_145278 NM_145284 NM_145285 NM_145296 NM_145306 NM_145307 NM_145311 NM_145342 NM_145351 NM_145637 NM_145646 NM_145649 NM_145655 NM_145660 NM_145662 NM_145665 NM_145686 NM_145687 NM_145690 NM_145691 NM_145693 NM_145695 NM_145728 NM_145730 NM_145731 NM_145734 NM_145799 NM_145804 NM_145805 NM_145808 NM_145810 NM_145858 NM_145861 NM_145864 NM_145865 NM_145868 NM_145869 NM_145886 NM_145887 NM_146388 NM_147128 NM_147131 NM_147132 NM_147147 NM_147150 NM_147156 NM_147160 NM_147166 NM_147180 NM_147187 NM_147189 NM_147192 NM_147195 NM_147202 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_148171 NM_148571 NM_148842 NM_148887 NM_148888 NM_148964 NM_152219 NM_152235 NM_152245 NM_152247 NM_152253 NM_152257 NM_152259 NM_152267 NM_152268 NM_152272 NM_152280 NM_152285 NM_152289 NM_152292 NM_152296 NM_152304 NM_152305 NM_152306 NM_152308 NM_152309 NM_152310 NM_152312 NM_152313 NM_152316 NM_152317 NM_152330 NM_152337 NM_152340 NM_152342 NM_152344 NM_152357 NM_152361 NM_152371 NM_152374 NM_152376 NM_152388 NM_152389 NM_152395 NM_152399 NM_152402 NM_152403 NM_152404 NM_152406 NM_152407 NM_152416 NM_152418 NM_152422 NM_152423 NM_152424 NM_152429 NM_152433 NM_152437 NM_152439 NM_152444 NM_152447 NM_152448 NM_152449 NM_152451 NM_152458 NM_152459 NM_152460 NM_152463 NM_152470 NM_152475 NM_152476 NM_152477 NM_152482 NM_152484 NM_152491 NM_152493 NM_152497 NM_152506 NM_152509 NM_152515 NM_152523 NM_152527 NM_152538 NM_152540 NM_152547 NM_152554 NM_152556 NM_152565 NM_152579 NM_152583 NM_152587 NM_152608 NM_152619 NM_152622 NM_152623 NM_152624 NM_152628 NM_152629 NM_152637 NM_152649 NM_152653 NM_152654 NM_152655 NM_152658 NM_152660 NM_152666 NM_152678 NM_152680 NM_152686 NM_152687 NM_152689 NM_152695 NM_152703 NM_152707 NM_152716 NM_152717 NM_152718 NM_152724 NM_152728 NM_152735 NM_152736 NM_152737 NM_152745 NM_152751 NM_152753 NM_152754 NM_152755 NM_152756 NM_152757 NM_152763 NM_152764 NM_152765 NM_152774 NM_152785 NM_152792 NM_152793 NM_152794 NM_152830 NM_152834 NM_152840 NM_152841 NM_152842 NM_152843 NM_152855 NM_152860 NM_152866 NM_152879 NM_152880 NM_152881 NM_152882 NM_152883 NM_152896 NM_152897 NM_152906 NM_152933 NM_152934 NM_152939 NM_152942 NM_152989 NM_152990 NM_152994 NM_152995 NM_152999 NM_153001 NM_153008 NM_153022 NM_153027 NM_153028 NM_153029 NM_153031 NM_153032 NM_153033 NM_153034 NM_153035 NM_153036 NM_153041 NM_153045 NM_153206 NM_153208 NM_153213 NM_153215 NM_153220 NM_153230 NM_153231 NM_153232 NM_153233 NM_153235 NM_153238 NM_153239 NM_153246 NM_153254 NM_153262 NM_153266 NM_153271 NM_153273 NM_153292 NM_153335 NM_153343 NM_153345 NM_153346 NM_153347 NM_153348 NM_153364 NM_153371 NM_153379 NM_153442 NM_153443 NM_153450 NM_153453 NM_153456 NM_153462 NM_153463 NM_153487 NM_153490 NM_153607 NM_153609 NM_153610 NM_153620 NM_153631 NM_153632 NM_153633 NM_153646 NM_153647 NM_153648 NM_153676 NM_153681 NM_153682 NM_153683 NM_153685 NM_153688 NM_153693 NM_153694 NM_153701 NM_153709 NM_153714 NM_153718 NM_153719 NM_153754 NM_153756 NM_153810 NM_153826 NM_153836 NM_156036 NM_156037 NM_170601 NM_170607 NM_170662 NM_170686 NM_170706 NM_170707 NM_170708 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170720 NM_170724 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170741 NM_170742 NM_170743 NM_170744 NM_170768 NM_170769 NM_170770 NM_170773 NM_170774 NM_170776 NM_170781 NM_170782 NM_171825 NM_171982 NM_171998 NM_171999 NM_172000 NM_172005 NM_172058 NM_172059 NM_172060 NM_172069 NM_172087 NM_172088 NM_172089 NM_172097 NM_172127 NM_172128 NM_172165 NM_172166 NM_172174 NM_172175 NM_172193 NM_172197 NM_172206 NM_172207 NM_172211 NM_172217 NM_172225 NM_172239 NM_172244 NM_172314 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172367 NM_172369 NM_172370 NM_173042 NM_173043 NM_173044 NM_173064 NM_173065 NM_173075 NM_173080 NM_173086 NM_173156 NM_173157 NM_173158 NM_173160 NM_173163 NM_173165 NM_173170 NM_173174 NM_173175 NM_173176 NM_173198 NM_173199 NM_173200 NM_173214 NM_173216 NM_173217 NM_173341 NM_173354 NM_173355 NM_173357 NM_173358 NM_173452 NM_173454 NM_173455 NM_173456 NM_173457 NM_173462 NM_173464 NM_173468 NM_173470 NM_173472 NM_173473 NM_173477 NM_173478 NM_173491 NM_173509 NM_173511 NM_173524 NM_173528 NM_173529 NM_173532 NM_173536 NM_173542 NM_173551 NM_173561 NM_173566 NM_173568 NM_173570 NM_173576 NM_173578 NM_173580 NM_173582 NM_173590 NM_173591 NM_173599 NM_173611 NM_173627 NM_173629 NM_173632 NM_173640 NM_173641 NM_173643 NM_173650 NM_173651 NM_173652 NM_173675 NM_173677 NM_173682 NM_173688 NM_173698 NM_173701 NM_173794 NM_173795 NM_173798 NM_173799 NM_173800 NM_173801 NM_173805 NM_173812 NM_173815 NM_173825 NM_173827 NM_173829 NM_173832 NM_173833 NM_173834 NM_173851 NM_173854 NM_173855 NM_173872 NM_174871 NM_174891 NM_174892 NM_174901 NM_174902 NM_174911 NM_174914 NM_174917 NM_174920 NM_174934 NM_174936 NM_174937 NM_174938 NM_174953 NM_174954 NM_174955 NM_174956 NM_174957 NM_174961 NM_174962 NM_174972 NM_174976 NM_175053 NM_175063 NM_175068 NM_175069 NM_175071 NM_175072 NM_175073 NM_175077 NM_175078 NM_175080 NM_175085 NM_175567 NM_175568 NM_175610 NM_175616 NM_175698 NM_175709 NM_175724 NM_175727 NM_175729 NM_175733 NM_175736 NM_175744 NM_175747 NM_175852 NM_175857 NM_175861 NM_175864 NM_175872 NM_175888 NM_175892 NM_175900 NM_175901 NM_175907 NM_175908 NM_175921 NM_175922 NM_175931 NM_175932 NM_176071 NM_176072 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176095 NM_176783 NM_176786 NM_176801 NM_176806 NM_176815 NM_176823 NM_176863 NM_176871 NM_177401 NM_177402 NM_177405 NM_177438 NM_177442 NM_177452 NM_177453 NM_177524 NM_177525 NM_177532 NM_177550 NM_177554 NM_177959 NM_177963 NM_177967 NM_177972 NM_177985 NM_177990 NM_177995 NM_177996 NM_178000 NM_178001 NM_178002 NM_178003 NM_178004 NM_178006 NM_178007 NM_178010 NM_178011 NM_178014 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178122 NM_178123 NM_178126 NM_178129 NM_178136 NM_178140 NM_178145 NM_178151 NM_178152 NM_178153 NM_178175 NM_178177 NM_178191 NM_178228 NM_178229 NM_178231 NM_178276 NM_178326 NM_178329 NM_178422 NM_178426 NM_178427 NM_178432 NM_178438 NM_178441 NM_178456 NM_178466 NM_178470 NM_178494 NM_178498 NM_178502 NM_178509 NM_178514 NM_178516 NM_178519 NM_178520 NM_178526 NM_178542 NM_178550 NM_178557 NM_178564 NM_178571 NM_178582 NM_178586 NM_178823 NM_178829 NM_178830 NM_178831 NM_178832 NM_178836 NM_178837 NM_178839 NM_178842 NM_178863 NM_180976 NM_180977 NM_180989 NM_181311 NM_181312 NM_181313 NM_181314 NM_181332 NM_181337 NM_181349 NM_181355 NM_181357 NM_181358 NM_181359 NM_181361 NM_181430 NM_181431 NM_181443 NM_181481 NM_181482 NM_181483 NM_181489 NM_181491 NM_181493 NM_181504 NM_181505 NM_181521 NM_181523 NM_181524 NM_181531 NM_181532 NM_181558 NM_181618 NM_181654 NM_181659 NM_181671 NM_181689 NM_181698 NM_181703 NM_181705 NM_181709 NM_181712 NM_181713 NM_181714 NM_181719 NM_181720 NM_181727 NM_181774 NM_181780 NM_181783 NM_181784 NM_181785 NM_181797 NM_181798 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181838 NM_181844 NM_181846 NM_181847 NM_181861 NM_181862 NM_181863 NM_181864 NM_181865 NM_181866 NM_181868 NM_181869 NM_181870 NM_181874 NM_181876 NM_181882 NM_182314 NM_182487 NM_182500 NM_182501 NM_182503 NM_182510 NM_182511 NM_182516 NM_182526 NM_182527 NM_182534 NM_182540 NM_182547 NM_182548 NM_182551 NM_182554 NM_182556 NM_182558 NM_182562 NM_182565 NM_182566 NM_182568 NM_182573 NM_182584 NM_182606 NM_182607 NM_182612 NM_182616 NM_182623 NM_182628 NM_182637 NM_182638 NM_182643 NM_182645 NM_182663 NM_182664 NM_182665 NM_182683 NM_182684 NM_182685 NM_182686 NM_182687 NM_182697 NM_182700 NM_182701 NM_182703 NM_182728 NM_182729 NM_182734 NM_182740 NM_182742 NM_182743 NM_182744 NM_182757 NM_182760 NM_182763 NM_182764 NM_182765 NM_182767 NM_182779 NM_182797 NM_182798 NM_182799 NM_182801 NM_182833 NM_182838 NM_182847 NM_182854 NM_182894 NM_182896 NM_182898 NM_182899 NM_182907 NM_182919 NM_182920 NM_182932 NM_182933 NM_182935 NM_182936 NM_182948 NM_182964 NM_182970 NM_182978 NM_183002 NM_183006 NM_183010 NM_183050 NM_183075 NM_183078 NM_183079 NM_183238 NM_183239 NM_183337 NM_183359 NM_183376 NM_183377 NM_183398 NM_183399 NM_183400 NM_183401 NM_183412 NM_183413 NM_183418 NM_183420 NM_183421 NM_183422 NM_184042 NM_184085 NM_184086 NM_184087 NM_194071 NM_194255 NM_194272 NM_194286 NM_194287 NM_194289 NM_194290 NM_194291 NM_194294 NM_194300 NM_194303 NM_194309 NM_194310 NM_194313 NM_194318 NM_194356 NM_194428 NM_194430 NM_194431 NM_194435 NM_194447 NM_194448 NM_194450 NM_197939 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197976 NM_198057 NM_198058 NM_198061 NM_198066 NM_198076 NM_198086 NM_198087 NM_198088 NM_198138 NM_198147 NM_198148 NM_198155 NM_198157 NM_198181 NM_198182 NM_198186 NM_198187 NM_198188 NM_198196 NM_198204 NM_198205 NM_198212 NM_198215 NM_198225 NM_198256 NM_198257 NM_198258 NM_198266 NM_198268 NM_198269 NM_198270 NM_198271 NM_198274 NM_198276 NM_198277 NM_198278 NM_198279 NM_198291 NM_198309 NM_198310 NM_198317 NM_198320 NM_198321 NM_198325 NM_198327 NM_198328 NM_198329 NM_198336 NM_198337 NM_198389 NM_198390 NM_198392 NM_198399 NM_198402 NM_198403 NM_198431 NM_198439 NM_198440 NM_198442 NM_198459 NM_198461 NM_198466 NM_198474 NM_198477 NM_198484 NM_198485 NM_198492 NM_198493 NM_198499 NM_198503 NM_198526 NM_198530 NM_198532 NM_198537 NM_198539 NM_198554 NM_198563 NM_198567 NM_198569 NM_198571 NM_198584 NM_198595 NM_198597 NM_198679 NM_198681 NM_198682 NM_198686 NM_198715 NM_198793 NM_198795 NM_198797 NM_198799 NM_198830 NM_198835 NM_198841 NM_198843 NM_198851 NM_198859 NM_198889 NM_198890 NM_198896 NM_198900 NM_198935 NM_198945 NM_198947 NM_198955 NM_198956 NM_198968 NM_198977 NM_198988 NM_198989 NM_198990 NM_198992 NM_198993 NM_199002 NM_199003 NM_199004 NM_199040 NM_199045 NM_199050 NM_199071 NM_199072 NM_199078 NM_199126 NM_199131 NM_199144 NM_199162 NM_199168 NM_199169 NM_199170 NM_199171 NM_199176 NM_199177 NM_199181 NM_199186 NM_199203 NM_199206 NM_199228 NM_199245 NM_199262 NM_199280 NM_199282 NM_199329 NM_199334 NM_199335 NM_199339 NM_199343 NM_199356 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199415 NM_199421 NM_199437 NM_199438 NM_199439 NM_199454 NM_199461 NM_199462 NM_199478 NM_199482 NM_199487 NM_199513 NM_201252 NM_201263 NM_201265 NM_201266 NM_201277 NM_201278 NM_201279 NM_201280 NM_201281 NM_201348 NM_201378 NM_201379 NM_201380 NM_201381 NM_201382 NM_201383 NM_201384 NM_201397 NM_201413 NM_201414 NM_201431 NM_201432 NM_201433 NM_201520 NM_201524 NM_201525 NM_201543 NM_201544 NM_201545 NM_201546 NM_201555 NM_201556 NM_201557 NM_201565 NM_201567 NM_201568 NM_201569 NM_201599 NM_201628 NM_201630 NM_201632 NM_201634 NM_201647 NM_201994 NM_201995 NM_201998 NM_201999 NM_202467 NM_202468 NM_202469 NM_202470 NM_202494 NM_203305 NM_203306 NM_203311 NM_203314 NM_203315 NM_203316 NM_203318 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203341 NM_203342 NM_203343 NM_203347 NM_203353 NM_203371 NM_203375 NM_203381 NM_203394 NM_203395 NM_203405 NM_203413 NM_203416 NM_203422 NM_203438 NM_203439 NM_203440 NM_203441 NM_203444 NM_203445 NM_203453 NM_203454 NM_203457 NM_203459 NM_203463 NM_203464 NM_203468 NM_203473 NM_203474 NM_203475 NM_203476 NM_203481 NM_203486 NM_203487 NM_203506 NM_205543 NM_205548 NM_205768 NM_205833 NM_205845 NM_205861 NM_206538 NM_206594 NM_206595 NM_206809 NM_206810 NM_206811 NM_206812 NM_206813 NM_206814 NM_206817 NM_206818 NM_206819 NM_206820 NM_206821 NM_206866 NM_206887 NM_206892 NM_206902 NM_206909 NM_206914 NM_206925 NM_206926 NM_206944 NM_206945 NM_206946 NM_206947 NM_207002 NM_207012 NM_207015 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207111 NM_207113 NM_207116 NM_207119 NM_207122 NM_207168 NM_207171 NM_207174 NM_207285 NM_207286 NM_207288 NM_207289 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207303 NM_207306 NM_207309 NM_207313 NM_207315 NM_207318 NM_207323 NM_207325 NM_207327 NM_207329 NM_207334 NM_207335 NM_207348 NM_207352 NM_207356 NM_207357 NM_207358 NM_207367 NM_207371 NM_207372 NM_207380 NM_207381 NM_207386 NM_207388 NM_207390 NM_207394 NM_207400 NM_207401 NM_207404 NM_207405 NM_207406 NM_207410 NM_207411 NM_207412 NM_207417 NM_207426 NM_207428 NM_207429 NM_207430 NM_207432 NM_207434 NM_207438 NM_207439 NM_207442 NM_207443 NM_207444 NM_207445 NM_207446 NM_207447 NM_207449 NM_207463 NM_207465 NM_207468 NM_207470 NM_207473 NM_207478 NM_207481 NM_207482 NM_207483 NM_207484 NM_207486 NM_207495 NM_207500 NM_207501 NM_207506 NM_207510 NM_207517 NM_207518 NM_207577 NM_207578 NM_207582 NM_207627 NM_207628 NM_207629 NM_207630 NM_207647 NM_207672 NM_212464 NM_212474 NM_212475 NM_212476 NM_212478 NM_212479 NM_212482 NM_212533 NM_212540 NM_212551 NM_212555 NM_213566 NM_213568 NM_213589 NM_213590 NM_213593 NM_213596 NM_213597 NM_213600 NM_213604 NM_213605 NM_213619 NM_213620 NM_213622 NM_213633 NM_213645 NM_213646 NM_213648 NM_213651 NM_213654 NM_213723 NM_213726 NM_214676 NM_214677 NM_214678 NM_214679 XM_027307 XM_028810 XM_031104 XM_032278 XM_032571 XM_032901 XM_032996 XM_034274 XM_035497 XM_036988 XM_037523 XM_037557 XM_038150 XM_038436 XM_039515 XM_039570 XM_039676 XM_039733 XM_040592 XM_041126 XM_042066 XM_042698 XM_042833 XM_042936 XM_042978 XM_043493 XM_044062 XM_044434 XM_044921 XM_045911 XM_046581 XM_047357 XM_047610 XM_048898 XM_049078 XM_049237 XM_050278 XM_051017 XM_051081 XM_051200 XM_051264 XM_055636 XM_056455 XM_058513 XM_058720 XM_059482 XM_059689 XM_059929 XM_059954 XM_064190 XM_065166 XM_066058 XM_067605 XM_084467 XM_084529 XM_085831 XM_085833 XM_087353 XM_087386 XM_087490 XM_087671 XM_087672 XM_088726 XM_091331 XM_096688 XM_113743 XM_113947 XM_113967 XM_116980 XM_117236 XM_117266 XM_117294 XM_166140 XM_166164 XM_166227 XM_166320 XM_167044 XM_167908 XM_168073 XM_168530 XM_168578 XM_171054 XM_171855 XM_172889 XM_173015 XM_173087 XM_208097 XM_208320 XM_208522 XM_208545 XM_208658 XM_208835 XM_208847 XM_208990 XM_209196 XM_209363 XM_209429 XM_209569 XM_209700 XM_210906 XM_211028 XM_211816 XM_211871 XM_211908 XM_212170 XM_212238 XM_290351 XM_290502 XM_290527 XM_290597 XM_290615 XM_290734 XM_290842 XM_290925 XM_291019 XM_291020 XM_291095 XM_291204 XM_291208 XM_291247 XM_291262 XM_291671 XM_291729 XM_293687 XM_294765 XM_294993 XM_295007 XM_295155 XM_297816 XM_370536 XM_370603 XM_370654 XM_370664 XM_370696 XM_370756 XM_370838 XM_370878 XM_370899 XM_371074 XM_371116 XM_371167 XM_371176 XM_371179 XM_371181 XM_371184 XM_371204 XM_371214 XM_371254 XM_371302 XM_371304 XM_371311 XM_371369 XM_371461 XM_371470 XM_371486 XM_371488 XM_371590 XM_371664 XM_371741 XM_371759 XM_371783 XM_371801 XM_371891 XM_372035 XM_372038 XM_372090 XM_372198 XM_372233 XM_372239 XM_372420 XM_372579 XM_372716 XM_373030 XM_373451 XM_373477 XM_373500 XM_373543 XM_373548 XM_373561 XM_373602 XM_373631 XM_373666 XM_373704 XM_373742 XM_373744 XM_373775 XM_373848 XM_373883 XM_373906 XM_373926 XM_373950 XM_373981 XM_374013 XM_374023 XM_374035 XM_374059 XM_374064 XM_374069 XM_374100 XM_374112 XM_374124 XM_374175 XM_374260 XM_374286 XM_374317 XM_374414 XM_374422 XM_374437 XM_374484 XM_374502 XM_374529 XM_374768 XM_374803 XM_374912 XM_374915 XM_374973 XM_375033 XM_375041 XM_375090 XM_375185 XM_375272 XM_375275 XM_375284 XM_375307 XM_375357 XM_375359 XM_375373 XM_375378 XM_375424 XM_375430 XM_375456 XM_375491 XM_375606 XM_375608 XM_375619 XM_375629 XM_375669 XM_375697 XM_375713 XM_375816 XM_375821 XM_375928 XM_376018 XM_376049 XM_376051 XM_376062 XM_376111 XM_376165 XM_376179 XM_376207 XM_376212 XM_376254 XM_376257 XM_376269 XM_376303 XM_376320 XM_376334 XM_376372 XM_376412 XM_376423 XM_376436 XM_376444 XM_376454 XM_376550 XM_376587 XM_376602 XM_376616 XM_376652 XM_376658 XM_376677 XM_376679 XM_376720 XM_376774 XM_376784 XM_376795 XM_376821 XM_376902 XM_376905 XM_377002 XM_377028 XM_377053 XM_377476 XM_377742 XM_378178 XM_378207 XM_378208 XM_378236 XM_378238 XM_378239 XM_378247 XM_378280 XM_378305 XM_378312 XM_378316 XM_378321 XM_378327 XM_378331 XM_378355 XM_378358 XM_378362 XM_378368 XM_378372 XM_378379 XM_378390 XM_378392 XM_378421 XM_378452 XM_378453 XM_378454 XM_378456 XM_378460 XM_378462 XM_378494 XM_378512 XM_378514 XM_378542 XM_378546 XM_378550 XM_378558 XM_378582 XM_378589 XM_378625 XM_378628 XM_378649 XM_378653 XM_378655 XM_378661 XM_378678 XM_378692 XM_378698 XM_378700 XM_378703 XM_378708 XM_378712 XM_378730 XM_378738 XM_378741 XM_378742 XM_378743 XM_378746 XM_378756 XM_378758 XM_378760 XM_378777 XM_378783 XM_378786 XM_378787 XM_378798 XM_378799 XM_378810 XM_378822 XM_378840 XM_378842 XM_378843 XM_378852 XM_378858 XM_378860 XM_378861 XM_378876 XM_378886 XM_378908 XM_378917 XM_378921 XM_378925 XM_378964 XM_378971 XM_378973 XM_378985 XM_378993 XM_379006 XM_379023 XM_379030 XM_379041 XM_379075 XM_379078 XM_379099 XM_379100 XM_379106 XM_379114 XM_379118 XM_379123 XM_379135 XM_379136 XM_379154 XM_379156 XM_379173 XM_379189 XM_379204 XM_379206 XM_379215 XM_379235 XM_379243 XM_379248 XM_379255 XM_379267 XM_379273 XM_379276 XM_379280 XM_379309 XM_379320 XM_379324 XM_379355 XM_379359 XM_379371 XM_379373 XM_379381 XM_379391 XM_379398 XM_379402 XM_379403 XM_379406 XM_379409 XM_379417 XM_379432 XM_379452 XM_379454 XM_379456 XM_379458 XM_379459 XM_379484 XM_379510 XM_379515 XM_379530 XM_379535 XM_379547 XM_379562 XM_379595 XM_379597 XM_379608 XM_379623 XM_379629 XM_379643 XM_379648 XM_379651 XM_379657 XM_379664 XM_379665 XM_379668 XM_379702 XM_379704 XM_379720 XM_379722 XM_379786 XM_379809 XM_379820 XM_379843 XM_379844 XM_379850 XM_379892 XM_379897 XM_379931 XM_379933 XM_379967 XM_380100 XM_380131 XM_380139 XM_380154 XM_380160 XM_380173 XM_495795 XM_495798 XM_495807 XM_495814 XM_495844 XM_495886 XM_495888 XM_495902 XM_495909 XM_495926 XM_495939 XM_495950 XM_495970 XM_496041 XM_496044 XM_496050 XM_496054 XM_496056 XM_496061 XM_496075 XM_496079 XM_496081 XM_496088 XM_496103 XM_496134 XM_496145 XM_496157 XM_496158 XM_496191 XM_496266 XM_496267 XM_496268 XM_496328 XM_496333 XM_496349 XM_496351 XM_496352 XM_496373 XM_496405 XM_496436 XM_496467 XM_496547 XM_496549 XM_496554 XM_496575 XM_496584 XM_496608 XM_496637 XM_496643 XM_496664 XM_496690 XM_496692 XM_496705 XM_496724 XM_496725 XM_496740 XM_496798 XM_496814 XM_496844 XM_496876 XM_496877 XM_496901 XM_496904 XM_496907 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497002 XM_497036 XM_497056 XM_497062 XM_497098 XM_497121 XM_497160 XM_498422 XM_498440 XM_498441 XM_498442 XM_498445 XM_498449 XM_498454 XM_498457 XM_498463 XM_498466 XM_498467 XM_498479 XM_498480 XM_498481 XM_498482 XM_498484 XM_498485 XM_498487 XM_498490 XM_498497 XM_498500 XM_498540 XM_498544 XM_498545 XM_498555 XM_498558 XM_498560 XM_498569 XM_498572 XM_498581 XM_498593 XM_498594 XM_498595 XM_498596 XM_498602 XM_498614 XM_498624 XM_498633 XM_498646 XM_498655 XM_498683 XM_498687 XM_498688 XM_498693 XM_498724 XM_498727 XM_498729 XM_498736 XM_498737 XM_498739 XM_498817 XM_498827 XM_498828 XM_498829 XM_498835 XM_498841 XM_498853 XM_498862 XM_498883 XM_498884 XM_498894 XM_498899 XM_498902 XM_498903 XM_498905 XM_498910 XM_498912 XM_498929 XM_498954 XM_498961 XM_498962 XM_498964 XM_498986 XM_498989 XM_498995 XM_498998 XM_499003 XM_499005 XM_499008 XM_499012 XM_499013 XM_499020 XM_499023 XM_499029 XM_499034 XM_499044 XM_499046 XM_499047 XM_499050 XM_499051 XM_499056 XM_499063 XM_499072 XM_499085 XM_499093 XM_499101 XM_499105 XM_499114 XM_499115 XM_499123 XM_499125 XM_499139 XM_499142 XM_499146 XM_499147 XM_499148 XM_499149 XM_499151 XM_499152 XM_499165 XM_499177 XM_499182 XM_499187 XM_499276 XM_499277 XM_499293 XM_499301 XM_499309 XM_499336 XM_499343 XM_499366 XM_499502 XM_499503 XM_499512 XM_499514 XM_499525 XM_499550 XM_499570 XM_499571 XM_499572 XM_499575 XM_499579 XM_499583 XM_499586 XM_499593 XM_499596 XM_499597 XR_000192 XR_000195 XR_000227 XR_000256 XR_000259 XR_000261 XR_000265 XR_000268 XR_000272 XR_000292 XR_000293
Genes with multiple seed matches:
NM_000037 NM_000074 NM_000088 NM_000129 NM_000140 NM_000141 NM_000151 NM_000163 NM_000166 NM_000188 NM_000195 NM_000204 NM_000212 NM_000215 NM_000237 NM_000239 NM_000243 NM_000262 NM_000264 NM_000268 NM_000278 NM_000307 NM_000310 NM_000332 NM_000334 NM_000346 NM_000351 NM_000361 NM_000366 NM_000369 NM_000373 NM_000376 NM_000389 NM_000399 NM_000405 NM_000406 NM_000410 NM_000411 NM_000429 NM_000431 NM_000432 NM_000435 NM_000445 NM_000459 NM_000484 NM_000486 NM_000489 NM_000527 NM_000533 NM_000554 NM_000555 NM_000560 NM_000565 NM_000576 NM_000599 NM_000610 NM_000611 NM_000616 NM_000618 NM_000660 NM_000681 NM_000694 NM_000696 NM_000750 NM_000778 NM_000792 NM_000793 NM_000809 NM_000833 NM_000834 NM_000837 NM_000841 NM_000843 NM_000849 NM_000875 NM_000877 NM_000891 NM_000896 NM_000901 NM_000902 NM_000997 NM_001001188 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001395 NM_001001418 NM_001001419 NM_001001420 NM_001001481 NM_001001482 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001557 NM_001001661 NM_001001677 NM_001001681 NM_001001684 NM_001001687 NM_001001694 NM_001001695 NM_001001696 NM_001001698 NM_001001702 NM_001001711 NM_001001791 NM_001001873 NM_001001890 NM_001001928 NM_001001929 NM_001001930 NM_001001936 NM_001001938 NM_001002009 NM_001002010 NM_001002026 NM_001002032 NM_001002033 NM_001002034 NM_001002233 NM_001002254 NM_001002260 NM_001002261 NM_001002262 NM_001002295 NM_001002762 NM_001002814 NM_001002838 NM_001002840 NM_001002861 NM_001002880 NM_001002912 NM_001002914 NM_001003395 NM_001003396 NM_001003397 NM_001003399 NM_001003406 NM_001003407 NM_001003408 NM_001003674 NM_001003675 NM_001003688 NM_001003800 NM_001003937 NM_001003940 NM_001003942 NM_001003943 NM_001003962 NM_001004128 NM_001004304 NM_001004306 NM_001004322 NM_001004338 NM_001004341 NM_001004342 NM_001005291 NM_001005387 NM_001005388 NM_001005404 NM_001005413 NM_001005414 NM_001005502 NM_001005609 NM_001005910 NM_001005911 NM_001005912 NM_001005913 NM_001006115 NM_001006116 NM_001006600 NM_001006603 NM_001006656 NM_001006657 NM_001006667 NM_001006939 NM_001007023 NM_001007024 NM_001007025 NM_001007094 NM_001007097 NM_001007098 NM_001007156 NM_001007225 NM_001007237 NM_001007254 NM_001007277 NM_001007278 NM_001007466 NM_001007536 NM_001007546 NM_001008223 NM_001008225 NM_001008228 NM_001008239 NM_001008406 NM_001008408 NM_001008493 NM_001008494 NM_001008541 NM_001008701 NM_001008707 NM_001008737 NM_001008742 NM_001008744 NM_001008756 NM_001008897 NM_001009184 NM_001009566 NM_001009610 NM_001009880 NM_001009883 NM_001009956 NM_001009957 NM_001009959 NM_001009960 NM_001010846 NM_001010867 NM_001010871 NM_001010888 NM_001010891 NM_001010898 NM_001010913 NM_001010915 NM_001010974 NM_001011513 NM_001011514 NM_001011537 NM_001011554 NM_001011656 NM_001011666 NM_001011708 NM_001011720 NM_001012264 NM_001012270 NM_001012271 NM_001012329 NM_001012393 NM_001012418 NM_001012426 NM_001012427 NM_001012514 NM_001012515 NM_001012516 NM_001012651 NM_001012659 NM_001012709 NM_001012711 NM_001012713 NM_001012715 NM_001012732 NM_001012733 NM_001012734 NM_001012755 NM_001012761 NM_001012763 NM_001012957 NM_001012958 NM_001012968 NM_001012977 NM_001012981 NM_001012993 NM_001013031 NM_001013615 NM_001013618 NM_001013629 NM_001013635 NM_001013650 NM_001013664 NM_001013679 NM_001013687 NM_001013690 NM_001013693 NM_001013695 NM_001013708 NM_001013713 NM_001013714 NM_001013727 NM_001013738 NM_001014431 NM_001014432 NM_001014440 NM_001014442 NM_001014765 NM_001015048 NM_001015049 NM_001015053 NM_001015885 NM_001015886 NM_001017395 NM_001017396 NM_001017403 NM_001017404 NM_001017535 NM_001017916 NM_001017917 NM_001017918 NM_001017922 NM_001017924 NM_001017930 NM_001017995 NM_001018005 NM_001018029 NM_001018051 NM_001018053 NM_001018057 NM_001018065 NM_001018066 NM_001018078 NM_001018089 NM_001018097 NM_001023560 NM_001023570 NM_001023571 NM_001024401 NM_001024667 NM_001024676 NM_001024681 NM_001024843 NM_001024858 NM_001024912 NM_001025076 NM_001025077 NM_001025100 NM_001025107 NM_001025109 NM_001025197 NM_001025199 NM_001025231 NM_001025266 NM_001035 NM_001043 NM_001047 NM_001050 NM_001062 NM_001084 NM_001089 NM_001095 NM_001111 NM_001112 NM_001128 NM_001136 NM_001140 NM_001160 NM_001163 NM_001168 NM_001176 NM_001186 NM_001188 NM_001198 NM_001204 NM_001218 NM_001224 NM_001231 NM_001259 NM_001264 NM_001286 NM_001296 NM_001298 NM_001303 NM_001304 NM_001310 NM_001330 NM_001331 NM_001353 NM_001354 NM_001382 NM_001386 NM_001387 NM_001390 NM_001399 NM_001407 NM_001420 NM_001421 NM_001430 NM_001458 NM_001460 NM_001463 NM_001470 NM_001490 NM_001491 NM_001532 NM_001542 NM_001543 NM_001556 NM_001609 NM_001617 NM_001650 NM_001659 NM_001661 NM_001664 NM_001678 NM_001686 NM_001693 NM_001695 NM_001701 NM_001709 NM_001711 NM_001712 NM_001724 NM_001749 NM_001754 NM_001759 NM_001773 NM_001791 NM_001802 NM_001829 NM_001837 NM_001874 NM_001878 NM_001904 NM_001915 NM_001921 NM_001928 NM_001941 NM_001954 NM_001970 NM_001975 NM_001982 NM_001987 NM_001990 NM_002017 NM_002025 NM_002035 NM_002044 NM_002045 NM_002051 NM_002052 NM_002062 NM_002068 NM_002072 NM_002073 NM_002077 NM_002086 NM_002111 NM_002119 NM_002120 NM_002121 NM_002126 NM_002147 NM_002180 NM_002197 NM_002202 NM_002230 NM_002232 NM_002235 NM_002240 NM_002241 NM_002247 NM_002249 NM_002254 NM_002274 NM_002283 NM_002284 NM_002313 NM_002314 NM_002319 NM_002334 NM_002349 NM_002357 NM_002359 NM_002387 NM_002398 NM_002402 NM_002406 NM_002416 NM_002430 NM_002442 NM_002445 NM_002468 NM_002481 NM_002483 NM_002501 NM_002514 NM_002522 NM_002531 NM_002540 NM_002542 NM_002545 NM_002556 NM_002558 NM_002561 NM_002577 NM_002581 NM_002585 NM_002586 NM_002609 NM_002613 NM_002616 NM_002644 NM_002651 NM_002657 NM_002667 NM_002694 NM_002711 NM_002716 NM_002719 NM_002725 NM_002731 NM_002737 NM_002751 NM_002824 NM_002826 NM_002832 NM_002834 NM_002849 NM_002857 NM_002906 NM_002915 NM_002924 NM_002928 NM_002930 NM_002941 NM_002957 NM_002959 NM_002990 NM_002996 NM_002999 NM_003001 NM_003004 NM_003011 NM_003012 NM_003032 NM_003037 NM_003039 NM_003045 NM_003047 NM_003074 NM_003081 NM_003098 NM_003108 NM_003132 NM_003144 NM_003145 NM_003152 NM_003156 NM_003179 NM_003190 NM_003200 NM_003216 NM_003223 NM_003241 NM_003245 NM_003247 NM_003281 NM_003287 NM_003289 NM_003307 NM_003309 NM_003320 NM_003379 NM_003387 NM_003392 NM_003417 NM_003421 NM_003458 NM_003459 NM_003466 NM_003479 NM_003483 NM_003506 NM_003507 NM_003557 NM_003575 NM_003607 NM_003610 NM_003615 NM_003617 NM_003633 NM_003644 NM_003677 NM_003681 NM_003685 NM_003707 NM_003722 NM_003734 NM_003759 NM_003766 NM_003768 NM_003782 NM_003808 NM_003827 NM_003836 NM_003846 NM_003848 NM_003862 NM_003869 NM_003870 NM_003873 NM_003883 NM_003885 NM_003901 NM_003928 NM_003936 NM_003939 NM_003941 NM_003943 NM_003946 NM_003958 NM_003966 NM_003979 NM_003987 NM_003988 NM_003989 NM_003990 NM_004000 NM_004019 NM_004028 NM_004059 NM_004061 NM_004079 NM_004096 NM_004097 NM_004110 NM_004116 NM_004148 NM_004162 NM_004171 NM_004176 NM_004185 NM_004209 NM_004210 NM_004262 NM_004273 NM_004274 NM_004286 NM_004287 NM_004290 NM_004293 NM_004302 NM_004311 NM_004313 NM_004319 NM_004326 NM_004331 NM_004338 NM_004339 NM_004350 NM_004367 NM_004376 NM_004380 NM_004386 NM_004391 NM_004405 NM_004423 NM_004434 NM_004437 NM_004438 NM_004442 NM_004466 NM_004475 NM_004481 NM_004484 NM_004487 NM_004488 NM_004507 NM_004529 NM_004554 NM_004566 NM_004567 NM_004575 NM_004588 NM_004598 NM_004599 NM_004622 NM_004624 NM_004630 NM_004637 NM_004644 NM_004646 NM_004649 NM_004650 NM_004656 NM_004686 NM_004693 NM_004711 NM_004714 NM_004716 NM_004717 NM_004738 NM_004747 NM_004759 NM_004760 NM_004762 NM_004767 NM_004796 NM_004797 NM_004798 NM_004821 NM_004823 NM_004840 NM_004845 NM_004850 NM_004860 NM_004871 NM_004873 NM_004879 NM_004887 NM_004897 NM_004904 NM_004913 NM_004922 NM_004924 NM_004928 NM_004930 NM_004937 NM_004949 NM_004956 NM_004957 NM_004959 NM_004961 NM_004992 NM_005027 NM_005032 NM_005036 NM_005047 NM_005063 NM_005065 NM_005076 NM_005086 NM_005093 NM_005096 NM_005108 NM_005114 NM_005116 NM_005123 NM_005127 NM_005140 NM_005149 NM_005151 NM_005155 NM_005159 NM_005163 NM_005165 NM_005177 NM_005184 NM_005187 NM_005197 NM_005219 NM_005220 NM_005229 NM_005233 NM_005238 NM_005239 NM_005240 NM_005248 NM_005253 NM_005266 NM_005291 NM_005297 NM_005311 NM_005312 NM_005328 NM_005329 NM_005333 NM_005334 NM_005365 NM_005385 NM_005387 NM_005389 NM_005392 NM_005399 NM_005400 NM_005416 NM_005417 NM_005430 NM_005436 NM_005446 NM_005458 NM_005461 NM_005471 NM_005474 NM_005476 NM_005477 NM_005512 NM_005513 NM_005550 NM_005552 NM_005554 NM_005561 NM_005590 NM_005591 NM_005598 NM_005599 NM_005635 NM_005636 NM_005647 NM_005658 NM_005660 NM_005677 NM_005682 NM_005686 NM_005688 NM_005697 NM_005699 NM_005709 NM_005717 NM_005725 NM_005730 NM_005732 NM_005789 NM_005798 NM_005806 NM_005819 NM_005822 NM_005828 NM_005831 NM_005834 NM_005838 NM_005840 NM_005864 NM_005865 NM_005885 NM_005900 NM_005902 NM_005903 NM_005911 NM_005920 NM_005928 NM_005933 NM_005937 NM_005957 NM_005962 NM_005964 NM_005965 NM_005981 NM_006011 NM_006015 NM_006022 NM_006037 NM_006042 NM_006045 NM_006065 NM_006099 NM_006134 NM_006138 NM_006148 NM_006160 NM_006167 NM_006178 NM_006187 NM_006195 NM_006212 NM_006224 NM_006235 NM_006237 NM_006238 NM_006239 NM_006245 NM_006268 NM_006271 NM_006282 NM_006306 NM_006317 NM_006327 NM_006371 NM_006373 NM_006377 NM_006393 NM_006439 NM_006457 NM_006464 NM_006483 NM_006484 NM_006504 NM_006508 NM_006517 NM_006532 NM_006540 NM_006546 NM_006548 NM_006555 NM_006557 NM_006561 NM_006566 NM_006572 NM_006593 NM_006599 NM_006644 NM_006646 NM_006658 NM_006670 NM_006698 NM_006709 NM_006720 NM_006731 NM_006732 NM_006736 NM_006737 NM_006738 NM_006746 NM_006763 NM_006771 NM_006772 NM_006773 NM_006788 NM_006789 NM_006801 NM_006818 NM_006822 NM_006825 NM_006830 NM_006856 NM_006861 NM_006873 NM_006877 NM_006914 NM_006922 NM_006923 NM_006940 NM_006941 NM_006943 NM_006952 NM_006987 NM_006995 NM_007031 NM_007038 NM_007050 NM_007057 NM_007067 NM_007073 NM_007084 NM_007131 NM_007137 NM_007144 NM_007146 NM_007151 NM_007157 NM_007173 NM_007182 NM_007185 NM_007200 NM_007212 NM_007219 NM_007221 NM_007229 NM_007232 NM_007249 NM_007257 NM_007271 NM_007287 NM_007288 NM_007289 NM_007315 NM_007345 NM_007353 NM_007359 NM_007362 NM_012072 NM_012101 NM_012102 NM_012106 NM_012153 NM_012156 NM_012173 NM_012174 NM_012193 NM_012199 NM_012219 NM_012232 NM_012244 NM_012249 NM_012262 NM_012264 NM_012275 NM_012288 NM_012292 NM_012306 NM_012308 NM_012309 NM_012317 NM_012324 NM_012328 NM_012329 NM_012391 NM_012395 NM_012402 NM_012425 NM_012427 NM_012430 NM_012431 NM_012436 NM_012448 NM_012453 NM_012465 NM_012479 NM_013229 NM_013231 NM_013251 NM_013253 NM_013255 NM_013261 NM_013276 NM_013279 NM_013286 NM_013312 NM_013336 NM_013341 NM_013343 NM_013382 NM_013393 NM_013433 NM_013449 NM_013943 NM_013951 NM_013952 NM_013953 NM_013989 NM_013992 NM_013993 NM_013994 NM_014005 NM_014010 NM_014030 NM_014048 NM_014112 NM_014141 NM_014157 NM_014214 NM_014232 NM_014240 NM_014243 NM_014262 NM_014276 NM_014292 NM_014310 NM_014314 NM_014325 NM_014372 NM_014388 NM_014405 NM_014409 NM_014411 NM_014431 NM_014442 NM_014444 NM_014452 NM_014460 NM_014484 NM_014485 NM_014494 NM_014517 NM_014518 NM_014520 NM_014553 NM_014554 NM_014556 NM_014586 NM_014594 NM_014606 NM_014613 NM_014614 NM_014621 NM_014631 NM_014636 NM_014637 NM_014642 NM_014653 NM_014661 NM_014665 NM_014667 NM_014674 NM_014681 NM_014697 NM_014720 NM_014723 NM_014728 NM_014730 NM_014731 NM_014737 NM_014741 NM_014744 NM_014746 NM_014747 NM_014758 NM_014759 NM_014764 NM_014766 NM_014767 NM_014772 NM_014776 NM_014789 NM_014792 NM_014800 NM_014807 NM_014809 NM_014826 NM_014837 NM_014850 NM_014854 NM_014872 NM_014873 NM_014875 NM_014876 NM_014880 NM_014887 NM_014895 NM_014902 NM_014905 NM_014919 NM_014921 NM_014926 NM_014930 NM_014932 NM_014935 NM_014936 NM_014940 NM_014944 NM_014945 NM_014949 NM_014951 NM_014954 NM_014957 NM_014997 NM_015008 NM_015015 NM_015020 NM_015033 NM_015035 NM_015039 NM_015047 NM_015049 NM_015055 NM_015056 NM_015058 NM_015061 NM_015063 NM_015064 NM_015071 NM_015074 NM_015075 NM_015077 NM_015079 NM_015088 NM_015090 NM_015092 NM_015094 NM_015097 NM_015111 NM_015115 NM_015173 NM_015185 NM_015192 NM_015202 NM_015227 NM_015235 NM_015246 NM_015252 NM_015253 NM_015254 NM_015257 NM_015264 NM_015267 NM_015286 NM_015310 NM_015315 NM_015326 NM_015327 NM_015329 NM_015330 NM_015335 NM_015338 NM_015359 NM_015369 NM_015373 NM_015374 NM_015375 NM_015393 NM_015394 NM_015397 NM_015409 NM_015428 NM_015431 NM_015458 NM_015470 NM_015493 NM_015544 NM_015553 NM_015564 NM_015568 NM_015584 NM_015595 NM_015605 NM_015627 NM_015651 NM_015691 NM_015695 NM_015701 NM_015726 NM_015833 NM_015836 NM_015840 NM_015841 NM_015865 NM_015881 NM_015892 NM_015975 NM_015981 NM_015983 NM_016076 NM_016114 NM_016122 NM_016144 NM_016169 NM_016185 NM_016196 NM_016206 NM_016212 NM_016242 NM_016243 NM_016248 NM_016280 NM_016281 NM_016319 NM_016322 NM_016352 NM_016369 NM_016376 NM_016389 NM_016418 NM_016431 NM_016456 NM_016484 NM_016488 NM_016489 NM_016507 NM_016526 NM_016531 NM_016562 NM_016577 NM_016598 NM_016605 NM_016613 NM_016734 NM_016735 NM_016819 NM_016930 NM_016932 NM_017410 NM_017424 NM_017433 NM_017439 NM_017443 NM_017444 NM_017449 NM_017456 NM_017483 NM_017485 NM_017486 NM_017488 NM_017510 NM_017514 NM_017592 NM_017599 NM_017602 NM_017626 NM_017634 NM_017652 NM_017656 NM_017699 NM_017705 NM_017712 NM_017715 NM_017727 NM_017738 NM_017744 NM_017760 NM_017770 NM_017824 NM_017843 NM_017849 NM_017902 NM_017908 NM_017919 NM_017974 NM_017990 NM_018000 NM_018019 NM_018027 NM_018028 NM_018045 NM_018057 NM_018069 NM_018082 NM_018084 NM_018112 NM_018129 NM_018137 NM_018150 NM_018170 NM_018173 NM_018178 NM_018182 NM_018192 NM_018196 NM_018201 NM_018205 NM_018211 NM_018212 NM_018215 NM_018222 NM_018224 NM_018239 NM_018243 NM_018244 NM_018263 NM_018265 NM_018299 NM_018316 NM_018319 NM_018337 NM_018358 NM_018364 NM_018370 NM_018374 NM_018393 NM_018416 NM_018425 NM_018440 NM_018450 NM_018462 NM_018482 NM_018538 NM_018579 NM_018639 NM_018640 NM_018656 NM_018658 NM_018662 NM_018684 NM_018689 NM_018695 NM_018715 NM_018841 NM_018847 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018941 NM_018969 NM_018977 NM_018982 NM_018991 NM_018992 NM_018999 NM_019001 NM_019008 NM_019009 NM_019018 NM_019027 NM_019035 NM_019041 NM_019064 NM_019106 NM_019555 NM_019855 NM_020039 NM_020064 NM_020070 NM_020119 NM_020125 NM_020127 NM_020132 NM_020133 NM_020150 NM_020162 NM_020165 NM_020166 NM_020168 NM_020177 NM_020178 NM_020182 NM_020228 NM_020237 NM_020245 NM_020248 NM_020309 NM_020310 NM_020311 NM_020315 NM_020335 NM_020337 NM_020338 NM_020346 NM_020347 NM_020367 NM_020370 NM_020374 NM_020384 NM_020393 NM_020400 NM_020405 NM_020418 NM_020429 NM_020440 NM_020443 NM_020451 NM_020452 NM_020462 NM_020475 NM_020476 NM_020477 NM_020639 NM_020651 NM_020661 NM_020673 NM_020698 NM_020699 NM_020711 NM_020714 NM_020715 NM_020746 NM_020755 NM_020764 NM_020776 NM_020777 NM_020779 NM_020781 NM_020782 NM_020789 NM_020792 NM_020803 NM_020804 NM_020825 NM_020830 NM_020834 NM_020844 NM_020850 NM_020851 NM_020853 NM_020857 NM_020859 NM_020886 NM_020888 NM_020892 NM_020899 NM_020914 NM_020921 NM_020922 NM_020927 NM_020946 NM_020947 NM_020951 NM_020956 NM_020962 NM_020967 NM_021010 NM_021088 NM_021096 NM_021101 NM_021110 NM_021116 NM_021128 NM_021131 NM_021137 NM_021146 NM_021155 NM_021168 NM_021181 NM_021183 NM_021187 NM_021202 NM_021222 NM_021260 NM_021269 NM_021615 NM_021636 NM_021637 NM_021638 NM_021645 NM_021648 NM_021724 NM_021735 NM_021736 NM_021737 NM_021783 NM_021795 NM_021815 NM_021903 NM_021904 NM_021905 NM_021937 NM_021950 NM_021959 NM_021960 NM_021961 NM_021979 NM_021984 NM_021987 NM_021990 NM_021991 NM_022046 NM_022049 NM_022059 NM_022067 NM_022112 NM_022131 NM_022137 NM_022152 NM_022169 NM_022170 NM_022346 NM_022356 NM_022363 NM_022459 NM_022460 NM_022465 NM_022477 NM_022478 NM_022491 NM_022571 NM_022731 NM_022737 NM_022753 NM_022758 NM_022767 NM_022791 NM_022819 NM_022824 NM_022829 NM_022894 NM_022898 NM_022899 NM_022905 NM_022912 NM_022969 NM_022970 NM_022972 NM_022975 NM_023004 NM_023028 NM_023029 NM_023030 NM_023031 NM_023072 NM_023080 NM_023112 NM_023938 NM_023939 NM_024015 NM_024016 NM_024017 NM_024072 NM_024080 NM_024092 NM_024102 NM_024294 NM_024301 NM_024311 NM_024312 NM_024328 NM_024335 NM_024411 NM_024417 NM_024422 NM_024423 NM_024430 NM_024494 NM_024510 NM_024511 NM_024513 NM_024517 NM_024522 NM_024551 NM_024557 NM_024561 NM_024583 NM_024594 NM_024598 NM_024611 NM_024613 NM_024627 NM_024633 NM_024649 NM_024657 NM_024662 NM_024677 NM_024729 NM_024761 NM_024771 NM_024779 NM_024783 NM_024841 NM_024850 NM_024871 NM_024882 NM_024887 NM_024909 NM_024910 NM_024915 NM_024941 NM_024943 NM_024958 NM_024974 NM_025042 NM_025082 NM_025083 NM_025084 NM_025104 NM_025106 NM_025151 NM_025164 NM_025191 NM_025194 NM_025201 NM_025230 NM_025235 NM_025236 NM_025243 NM_025247 NM_025250 NM_025256 NM_025261 NM_030569 NM_030570 NM_030571 NM_030626 NM_030627 NM_030629 NM_030633 NM_030636 NM_030643 NM_030650 NM_030752 NM_030753 NM_030774 NM_030775 NM_030781 NM_030796 NM_030803 NM_030806 NM_030809 NM_030817 NM_030885 NM_030912 NM_030915 NM_030918 NM_030926 NM_030937 NM_030949 NM_030953 NM_031216 NM_031268 NM_031281 NM_031283 NM_031305 NM_031407 NM_031409 NM_031411 NM_031416 NM_031418 NM_031426 NM_031433 NM_031437 NM_031445 NM_031473 NM_031474 NM_031849 NM_031854 NM_031857 NM_031860 NM_031889 NM_031890 NM_031910 NM_031936 NM_031954 NM_031992 NM_032013 NM_032015 NM_032017 NM_032028 NM_032042 NM_032052 NM_032105 NM_032130 NM_032139 NM_032174 NM_032208 NM_032211 NM_032213 NM_032242 NM_032281 NM_032288 NM_032294 NM_032310 NM_032322 NM_032325 NM_032372 NM_032375 NM_032385 NM_032410 NM_032433 NM_032440 NM_032446 NM_032452 NM_032459 NM_032486 NM_032521 NM_032529 NM_032536 NM_032538 NM_032539 NM_032550 NM_032552 NM_032642 NM_032646 NM_032664 NM_032701 NM_032710 NM_032711 NM_032726 NM_032744 NM_032750 NM_032785 NM_032792 NM_032817 NM_032827 NM_032829 NM_032836 NM_032837 NM_032839 NM_032870 NM_032872 NM_032876 NM_032900 NM_032933 NM_032940 NM_032961 NM_032968 NM_032969 NM_032973 NM_032975 NM_032980 NM_032982 NM_032983 NM_032984 NM_032988 NM_032994 NM_032997 NM_033008 NM_033009 NM_033010 NM_033017 NM_033059 NM_033083 NM_033086 NM_033089 NM_033091 NM_033092 NM_033102 NM_033119 NM_033127 NM_033129 NM_033130 NM_033182 NM_033198 NM_033201 NM_033207 NM_033224 NM_033238 NM_033262 NM_033274 NM_033285 NM_033332 NM_033343 NM_033346 NM_033389 NM_033393 NM_033409 NM_033426 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033505 NM_033510 NM_033512 NM_033549 NM_033551 NM_033631 NM_033637 NM_033649 NM_052811 NM_052847 NM_052848 NM_052869 NM_052874 NM_052906 NM_052918 NM_052925 NM_052931 NM_052934 NM_052937 NM_052939 NM_052959 NM_052978 NM_053005 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053051 NM_053277 NM_054033 NM_057169 NM_057170 NM_058164 NM_058240 NM_058242 NM_058243 NM_078467 NM_078470 NM_078471 NM_078483 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080551 NM_080588 NM_080589 NM_080605 NM_080628 NM_080725 NM_080738 NM_080764 NM_080792 NM_080836 NM_080870 NM_130387 NM_130435 NM_130439 NM_130442 NM_130773 NM_130783 NM_130786 NM_130807 NM_130811 NM_130830 NM_130846 NM_130848 NM_133170 NM_133171 NM_133175 NM_133176 NM_133328 NM_133334 NM_133367 NM_133371 NM_133448 NM_133452 NM_133468 NM_133476 NM_133477 NM_133482 NM_133631 NM_133646 NM_134423 NM_134434 NM_138270 NM_138271 NM_138287 NM_138300 NM_138333 NM_138360 NM_138362 NM_138376 NM_138387 NM_138400 NM_138402 NM_138457 NM_138458 NM_138473 NM_138494 NM_138567 NM_138576 NM_138694 NM_138713 NM_138714 NM_138717 NM_138727 NM_138728 NM_138771 NM_138774 NM_138777 NM_138797 NM_138799 NM_138934 NM_138967 NM_138970 NM_138983 NM_138993 NM_139004 NM_139124 NM_139125 NM_139131 NM_139135 NM_139246 NM_139248 NM_139279 NM_139321 NM_144577 NM_144582 NM_144583 NM_144588 NM_144599 NM_144607 NM_144629 NM_144677 NM_144682 NM_144692 NM_144717 NM_144767 NM_144967 NM_144985 NM_145010 NM_145041 NM_145055 NM_145117 NM_145173 NM_145185 NM_145234 NM_145237 NM_145239 NM_145245 NM_145250 NM_145265 NM_145284 NM_145296 NM_145307 NM_145311 NM_145649 NM_145655 NM_145660 NM_145728 NM_145799 NM_145805 NM_145808 NM_145858 NM_145861 NM_147131 NM_147132 NM_147147 NM_147180 NM_147189 NM_147192 NM_147195 NM_147202 NM_148170 NM_148171 NM_152235 NM_152257 NM_152267 NM_152268 NM_152280 NM_152289 NM_152296 NM_152308 NM_152312 NM_152313 NM_152330 NM_152337 NM_152376 NM_152389 NM_152395 NM_152399 NM_152433 NM_152447 NM_152448 NM_152458 NM_152460 NM_152470 NM_152476 NM_152491 NM_152527 NM_152619 NM_152622 NM_152623 NM_152624 NM_152637 NM_152649 NM_152653 NM_152654 NM_152660 NM_152680 NM_152686 NM_152687 NM_152695 NM_152703 NM_152716 NM_152724 NM_152736 NM_152737 NM_152753 NM_152754 NM_152757 NM_152785 NM_152793 NM_152794 NM_152834 NM_152840 NM_152842 NM_152855 NM_152860 NM_152866 NM_152906 NM_152933 NM_152934 NM_152939 NM_152989 NM_152990 NM_152994 NM_153022 NM_153031 NM_153033 NM_153034 NM_153035 NM_153036 NM_153045 NM_153208 NM_153220 NM_153230 NM_153233 NM_153239 NM_153262 NM_153273 NM_153335 NM_153347 NM_153348 NM_153379 NM_153442 NM_153450 NM_153456 NM_153463 NM_153490 NM_153609 NM_153646 NM_153647 NM_153648 NM_153676 NM_153683 NM_153685 NM_153688 NM_153714 NM_153756 NM_156036 NM_170686 NM_170706 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170741 NM_170742 NM_170743 NM_170744 NM_170769 NM_170773 NM_170774 NM_170781 NM_170782 NM_171825 NM_172000 NM_172087 NM_172088 NM_172089 NM_172127 NM_172128 NM_172197 NM_172206 NM_172225 NM_172239 NM_172346 NM_173042 NM_173043 NM_173044 NM_173064 NM_173065 NM_173156 NM_173158 NM_173170 NM_173214 NM_173216 NM_173217 NM_173354 NM_173357 NM_173358 NM_173462 NM_173470 NM_173542 NM_173551 NM_173561 NM_173566 NM_173570 NM_173580 NM_173582 NM_173611 NM_173629 NM_173641 NM_173643 NM_173682 NM_173799 NM_173800 NM_173805 NM_173825 NM_173827 NM_173832 NM_173833 NM_173851 NM_173854 NM_173872 NM_174902 NM_174914 NM_174934 NM_174962 NM_175068 NM_175080 NM_175085 NM_175729 NM_175736 NM_175864 NM_175892 NM_175901 NM_175907 NM_175921 NM_175922 NM_175931 NM_176084 NM_176085 NM_176086 NM_176823 NM_176863 NM_176871 NM_177402 NM_177405 NM_177442 NM_177524 NM_177525 NM_177532 NM_177963 NM_177972 NM_177996 NM_178000 NM_178001 NM_178002 NM_178003 NM_178010 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178126 NM_178151 NM_178152 NM_178153 NM_178229 NM_178329 NM_178441 NM_178498 NM_178509 NM_178514 NM_178516 NM_178519 NM_178520 NM_178526 NM_178542 NM_178564 NM_178586 NM_178823 NM_178830 NM_178839 NM_180976 NM_180977 NM_181349 NM_181357 NM_181358 NM_181359 NM_181481 NM_181482 NM_181483 NM_181491 NM_181504 NM_181523 NM_181524 NM_181531 NM_181654 NM_181703 NM_181720 NM_181774 NM_181783 NM_181785 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181844 NM_181846 NM_181847 NM_181861 NM_181868 NM_181869 NM_182487 NM_182500 NM_182503 NM_182516 NM_182526 NM_182534 NM_182540 NM_182548 NM_182558 NM_182562 NM_182568 NM_182584 NM_182637 NM_182638 NM_182663 NM_182664 NM_182665 NM_182683 NM_182684 NM_182686 NM_182700 NM_182701 NM_182728 NM_182734 NM_182763 NM_182764 NM_182767 NM_182838 NM_182898 NM_182899 NM_182907 NM_182932 NM_182933 NM_182936 NM_182948 NM_182964 NM_182970 NM_183002 NM_183006 NM_183078 NM_183238 NM_183376 NM_183398 NM_183399 NM_183400 NM_183401 NM_183412 NM_183413 NM_183420 NM_183421 NM_183422 NM_194071 NM_194286 NM_194294 NM_194428 NM_197939 NM_197941 NM_198061 NM_198086 NM_198147 NM_198155 NM_198186 NM_198187 NM_198188 NM_198268 NM_198269 NM_198271 NM_198278 NM_198279 NM_198291 NM_198320 NM_198327 NM_198328 NM_198390 NM_198392 NM_198402 NM_198439 NM_198442 NM_198474 NM_198477 NM_198484 NM_198485 NM_198493 NM_198539 NM_198567 NM_198571 NM_198584 NM_198595 NM_198597 NM_198679 NM_198682 NM_198686 NM_198799 NM_198841 NM_198843 NM_198851 NM_198859 NM_198890 NM_198900 NM_198955 NM_198956 NM_198988 NM_198990 NM_198993 NM_199004 NM_199045 NM_199071 NM_199072 NM_199131 NM_199162 NM_199169 NM_199170 NM_199171 NM_199176 NM_199177 NM_199186 NM_199437 NM_199438 NM_199439 NM_199462 NM_199478 NM_199487 NM_199513 NM_201263 NM_201348 NM_201378 NM_201379 NM_201380 NM_201381 NM_201382 NM_201383 NM_201384 NM_201397 NM_201413 NM_201414 NM_201431 NM_201432 NM_201433 NM_201524 NM_201525 NM_201565 NM_201568 NM_201569 NM_201599 NM_201628 NM_203305 NM_203306 NM_203316 NM_203318 NM_203327 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_203371 NM_203394 NM_203454 NM_203463 NM_203506 NM_205833 NM_205845 NM_205861 NM_206809 NM_206812 NM_206814 NM_206866 NM_206892 NM_206902 NM_206909 NM_206925 NM_206926 NM_207015 NM_207043 NM_207044 NM_207047 NM_207119 NM_207309 NM_207318 NM_207334 NM_207335 NM_207352 NM_207381 NM_207404 NM_207411 NM_207417 NM_207428 NM_207430 NM_207434 NM_207438 NM_207439 NM_207443 NM_207444 NM_207445 NM_207446 NM_207449 NM_207463 NM_207478 NM_207483 NM_207484 NM_207486 NM_207500 NM_207501 NM_207510 NM_207517 NM_207577 NM_207647 NM_207672 NM_212551 NM_213568 NM_213589 NM_213590 NM_213593 NM_213596 NM_213726 NM_214677 NM_214678 NM_214679 XM_028810 XM_032278 XM_032901 XM_032996 XM_035497 XM_036988 XM_037523 XM_037557 XM_038436 XM_039676 XM_039733 XM_041126 XM_042833 XM_042936 XM_042978 XM_043493 XM_044062 XM_045911 XM_046581 XM_047357 XM_047610 XM_048898 XM_049237 XM_051017 XM_051200 XM_055636 XM_059689 XM_084467 XM_084529 XM_085831 XM_087353 XM_087386 XM_113947 XM_113967 XM_117236 XM_166140 XM_166227 XM_166320 XM_167044 XM_168530 XM_168578 XM_171855 XM_208320 XM_290502 XM_290842 XM_291671 XM_297816 XM_370654 XM_370878 XM_371074 XM_371116 XM_371181 XM_371214 XM_371461 XM_371590 XM_371664 XM_371783 XM_371891 XM_372038 XM_372090 XM_372198 XM_372579 XM_373451 XM_373602 XM_373704 XM_373744 XM_373883 XM_373906 XM_374013 XM_374064 XM_374069 XM_374414 XM_374422 XM_374484 XM_374502 XM_374915 XM_375033 XM_375090 XM_375275 XM_375307 XM_375357 XM_375373 XM_375491 XM_375669 XM_375697 XM_375713 XM_375816 XM_375821 XM_375928 XM_376018 XM_376165 XM_376207 XM_376257 XM_376269 XM_376303 XM_376412 XM_376436 XM_376550 XM_376587 XM_376652 XM_376658 XM_376677 XM_376720 XM_376784 XM_376902 XM_377002 XM_377028 XM_377053 XM_377742 XM_378207 XM_378238 XM_378247 XM_378312 XM_378355 XM_378379 XM_378390 XM_378421 XM_378453 XM_378454 XM_378456 XM_378460 XM_378512 XM_378546 XM_378550 XM_378625 XM_378628 XM_378698 XM_378703 XM_378730 XM_378746 XM_378756 XM_378777 XM_378783 XM_378786 XM_378787 XM_378822 XM_378840 XM_378842 XM_378843 XM_378852 XM_378860 XM_378861 XM_378886 XM_378908 XM_378925 XM_378964 XM_379006 XM_379075 XM_379099 XM_379100 XM_379114 XM_379118 XM_379135 XM_379136 XM_379154 XM_379156 XM_379173 XM_379215 XM_379235 XM_379243 XM_379276 XM_379309 XM_379324 XM_379371 XM_379373 XM_379381 XM_379391 XM_379403 XM_379452 XM_379458 XM_379459 XM_379484 XM_379510 XM_379595 XM_379643 XM_379648 XM_379657 XM_379664 XM_379665 XM_379668 XM_379702 XM_379720 XM_379722 XM_379892 XM_379897 XM_379931 XM_379967 XM_380100 XM_380131 XM_495807 XM_495886 XM_495902 XM_495909 XM_496050 XM_496075 XM_496145 XM_496191 XM_496328 XM_496333 XM_496349 XM_496547 XM_496549 XM_496575 XM_496608 XM_496637 XM_496664 XM_496690 XM_496692 XM_496740 XM_496876 XM_496877 XM_496901 XM_496904 XM_496907 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497002 XM_497036 XM_498440 XM_498441 XM_498442 XM_498445 XM_498457 XM_498467 XM_498490 XM_498500 XM_498540 XM_498545 XM_498558 XM_498581 XM_498614 XM_498646 XM_498655 XM_498683 XM_498687 XM_498693 XM_498724 XM_498828 XM_498829 XM_498841 XM_498899 XM_498902 XM_498903 XM_498910 XM_498912 XM_498929 XM_498954 XM_498995 XM_498998 XM_499056 XM_499085 XM_499093 XM_499105 XM_499114 XM_499123 XM_499142 XM_499147 XM_499165 XM_499293 XM_499309 XM_499336 XM_499343 XM_499502 XM_499503 XM_499514 XM_499570 XM_499571 XM_499572 XM_499575 XM_499586 XM_499597 XR_000195 XR_000227 XR_000268
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)