VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"gggagcauugacacaugugca"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
5437
.
Total Genes with multiple seed matches:
1231
.
Genes with at least one seed match:
NM_000015 NM_000018 NM_000022 NM_000038 NM_000052 NM_000055 NM_000081 NM_000082 NM_000087 NM_000091 NM_000098 NM_000099 NM_000102 NM_000103 NM_000104 NM_000113 NM_000114 NM_000115 NM_000119 NM_000125 NM_000131 NM_000132 NM_000134 NM_000138 NM_000141 NM_000143 NM_000148 NM_000151 NM_000153 NM_000160 NM_000165 NM_000170 NM_000176 NM_000180 NM_000189 NM_000192 NM_000196 NM_000198 NM_000199 NM_000202 NM_000209 NM_000210 NM_000212 NM_000216 NM_000226 NM_000230 NM_000231 NM_000232 NM_000233 NM_000237 NM_000240 NM_000242 NM_000246 NM_000250 NM_000251 NM_000252 NM_000260 NM_000262 NM_000268 NM_000270 NM_000273 NM_000274 NM_000281 NM_000297 NM_000299 NM_000303 NM_000311 NM_000313 NM_000314 NM_000318 NM_000321 NM_000332 NM_000335 NM_000337 NM_000340 NM_000345 NM_000349 NM_000361 NM_000367 NM_000368 NM_000370 NM_000383 NM_000397 NM_000399 NM_000404 NM_000405 NM_000411 NM_000415 NM_000428 NM_000429 NM_000430 NM_000436 NM_000440 NM_000441 NM_000450 NM_000451 NM_000452 NM_000458 NM_000459 NM_000462 NM_000463 NM_000476 NM_000484 NM_000486 NM_000489 NM_000492 NM_000497 NM_000498 NM_000503 NM_000510 NM_000511 NM_000538 NM_000544 NM_000549 NM_000553 NM_000555 NM_000573 NM_000584 NM_000585 NM_000588 NM_000599 NM_000605 NM_000609 NM_000610 NM_000611 NM_000614 NM_000617 NM_000618 NM_000629 NM_000632 NM_000633 NM_000634 NM_000639 NM_000647 NM_000648 NM_000651 NM_000658 NM_000659 NM_000664 NM_000675 NM_000686 NM_000693 NM_000696 NM_000701 NM_000719 NM_000732 NM_000733 NM_000734 NM_000745 NM_000749 NM_000757 NM_000765 NM_000770 NM_000782 NM_000786 NM_000791 NM_000793 NM_000801 NM_000806 NM_000814 NM_000821 NM_000833 NM_000834 NM_000838 NM_000840 NM_000844 NM_000849 NM_000861 NM_000862 NM_000867 NM_000868 NM_000885 NM_000896 NM_000899 NM_000909 NM_000913 NM_000916 NM_000917 NM_000944 NM_000945 NM_000950 NM_000956 NM_000959 NM_000960 NM_000961 NM_000962 NM_000963 NM_000966 NM_000975 NM_000991 NM_000994 NM_000997 NM_001001132 NM_001001188 NM_001001323 NM_001001330 NM_001001331 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001435 NM_001001482 NM_001001503 NM_001001523 NM_001001548 NM_001001549 NM_001001550 NM_001001555 NM_001001586 NM_001001669 NM_001001671 NM_001001675 NM_001001680 NM_001001690 NM_001001694 NM_001001698 NM_001001702 NM_001001709 NM_001001713 NM_001001789 NM_001001851 NM_001001874 NM_001001890 NM_001001895 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001001974 NM_001001995 NM_001002019 NM_001002020 NM_001002231 NM_001002232 NM_001002243 NM_001002257 NM_001002260 NM_001002762 NM_001002814 NM_001002838 NM_001002840 NM_001002843 NM_001002844 NM_001002860 NM_001002861 NM_001002862 NM_001002881 NM_001002909 NM_001002912 NM_001002914 NM_001002926 NM_001003395 NM_001003396 NM_001003397 NM_001003399 NM_001003407 NM_001003408 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003698 NM_001003699 NM_001003712 NM_001003716 NM_001003725 NM_001003792 NM_001003793 NM_001003794 NM_001003796 NM_001003810 NM_001003812 NM_001003818 NM_001003891 NM_001003895 NM_001003931 NM_001003935 NM_001004106 NM_001004196 NM_001004197 NM_001004285 NM_001004286 NM_001004300 NM_001004302 NM_001004313 NM_001004316 NM_001004317 NM_001004330 NM_001004338 NM_001004346 NM_001004348 NM_001004351 NM_001004356 NM_001004358 NM_001004417 NM_001004421 NM_001004422 NM_001004433 NM_001004707 NM_001004720 NM_001004722 NM_001005209 NM_001005210 NM_001005214 NM_001005217 NM_001005242 NM_001005337 NM_001005340 NM_001005356 NM_001005357 NM_001005366 NM_001005387 NM_001005404 NM_001005473 NM_001005474 NM_001005505 NM_001005609 NM_001005737 NM_001005753 NM_001005849 NM_001005852 NM_001005909 NM_001006116 NM_001006600 NM_001006603 NM_001006604 NM_001006616 NM_001006623 NM_001006635 NM_001006641 NM_001006642 NM_001006643 NM_001006657 NM_001006932 NM_001006933 NM_001006935 NM_001006936 NM_001006937 NM_001006938 NM_001007023 NM_001007024 NM_001007025 NM_001007071 NM_001007073 NM_001007074 NM_001007075 NM_001007097 NM_001007101 NM_001007122 NM_001007169 NM_001007224 NM_001007233 NM_001007239 NM_001007243 NM_001007246 NM_001007247 NM_001007248 NM_001007254 NM_001007279 NM_001007525 NM_001007527 NM_001007531 NM_001007535 NM_001007538 NM_001007543 NM_001008211 NM_001008212 NM_001008213 NM_001008226 NM_001008239 NM_001008392 NM_001008396 NM_001008397 NM_001008401 NM_001008407 NM_001008408 NM_001008410 NM_001008491 NM_001008492 NM_001008493 NM_001008494 NM_001008496 NM_001008537 NM_001008539 NM_001008541 NM_001008544 NM_001008563 NM_001008564 NM_001008568 NM_001008569 NM_001008570 NM_001008571 NM_001008657 NM_001008658 NM_001008660 NM_001008742 NM_001008744 NM_001008756 NM_001008777 NM_001008781 NM_001008783 NM_001008860 NM_001008892 NM_001008894 NM_001009552 NM_001009553 NM_001009555 NM_001009565 NM_001009567 NM_001009571 NM_001009610 NM_001009612 NM_001009880 NM_001009899 NM_001009909 NM_001009913 NM_001009938 NM_001009956 NM_001009960 NM_001009996 NM_001009999 NM_001010000 NM_001010844 NM_001010846 NM_001010851 NM_001010854 NM_001010866 NM_001010867 NM_001010874 NM_001010879 NM_001010883 NM_001010888 NM_001010891 NM_001010898 NM_001010903 NM_001010909 NM_001010913 NM_001010915 NM_001010917 NM_001010923 NM_001010934 NM_001010976 NM_001010980 NM_001010984 NM_001010986 NM_001011513 NM_001011514 NM_001011538 NM_001011540 NM_001011546 NM_001011552 NM_001011554 NM_001011656 NM_001011666 NM_001011703 NM_001011705 NM_001011713 NM_001011718 NM_001011720 NM_001011885 NM_001012239 NM_001012267 NM_001012329 NM_001012339 NM_001012393 NM_001012420 NM_001012423 NM_001012426 NM_001012427 NM_001012452 NM_001012506 NM_001012508 NM_001012514 NM_001012516 NM_001012626 NM_001012642 NM_001012651 NM_001012711 NM_001012715 NM_001012732 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012753 NM_001012754 NM_001012756 NM_001012761 NM_001012957 NM_001012979 NM_001013031 NM_001013406 NM_001013438 NM_001013439 NM_001013629 NM_001013634 NM_001013635 NM_001013649 NM_001013659 NM_001013675 NM_001013676 NM_001013677 NM_001013680 NM_001013681 NM_001013682 NM_001013687 NM_001013688 NM_001013690 NM_001013692 NM_001013697 NM_001013698 NM_001013699 NM_001013704 NM_001013707 NM_001013710 NM_001013713 NM_001013714 NM_001013715 NM_001013716 NM_001013717 NM_001013718 NM_001013723 NM_001013734 NM_001014279 NM_001014283 NM_001014374 NM_001014839 NM_001014841 NM_001015045 NM_001015048 NM_001015049 NM_001015877 NM_001015880 NM_001015887 NM_001017368 NM_001017370 NM_001017371 NM_001017387 NM_001017389 NM_001017390 NM_001017391 NM_001017392 NM_001017396 NM_001017423 NM_001017424 NM_001017425 NM_001017430 NM_001017431 NM_001017434 NM_001017440 NM_001017915 NM_001017916 NM_001017917 NM_001017918 NM_001017919 NM_001017962 NM_001017970 NM_001017975 NM_001017980 NM_001017989 NM_001017995 NM_001017998 NM_001018004 NM_001018006 NM_001018007 NM_001018008 NM_001018009 NM_001018020 NM_001018021 NM_001018037 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018057 NM_001018058 NM_001018065 NM_001018066 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018078 NM_001018080 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018095 NM_001018097 NM_001018098 NM_001018099 NM_001018102 NM_001018111 NM_001018112 NM_001020825 NM_001023562 NM_001023563 NM_001023565 NM_001023567 NM_001024094 NM_001024216 NM_001024218 NM_001024226 NM_001024227 NM_001024228 NM_001024372 NM_001024401 NM_001024457 NM_001024460 NM_001024463 NM_001024465 NM_001024466 NM_001024631 NM_001024649 NM_001024667 NM_001024732 NM_001024736 NM_001024808 NM_001024843 NM_001024845 NM_001024855 NM_001024912 NM_001024933 NM_001024948 NM_001025 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025081 NM_001025090 NM_001025092 NM_001025094 NM_001025096 NM_001025097 NM_001025098 NM_001025100 NM_001025101 NM_001025108 NM_001025109 NM_001025247 NM_001025252 NM_001025253 NM_001034 NM_001038 NM_001041 NM_001045 NM_001046 NM_001047 NM_001050 NM_001067 NM_001071 NM_001072 NM_001080 NM_001083 NM_001092 NM_001093 NM_001105 NM_001110 NM_001114 NM_001116 NM_001121 NM_001123 NM_001132 NM_001141 NM_001147 NM_001156 NM_001157 NM_001158 NM_001165 NM_001167 NM_001174 NM_001176 NM_001186 NM_001187 NM_001198 NM_001204 NM_001211 NM_001212 NM_001218 NM_001227 NM_001254 NM_001259 NM_001260 NM_001268 NM_001269 NM_001270 NM_001271 NM_001277 NM_001286 NM_001289 NM_001292 NM_001295 NM_001303 NM_001304 NM_001315 NM_001326 NM_001331 NM_001332 NM_001334 NM_001337 NM_001340 NM_001346 NM_001347 NM_001351 NM_001356 NM_001362 NM_001374 NM_001380 NM_001387 NM_001391 NM_001394 NM_001399 NM_001401 NM_001406 NM_001407 NM_001410 NM_001418 NM_001419 NM_001420 NM_001427 NM_001432 NM_001433 NM_001438 NM_001440 NM_001447 NM_001448 NM_001452 NM_001455 NM_001458 NM_001460 NM_001470 NM_001482 NM_001483 NM_001490 NM_001491 NM_001494 NM_001497 NM_001505 NM_001511 NM_001539 NM_001547 NM_001552 NM_001558 NM_001565 NM_001609 NM_001616 NM_001620 NM_001621 NM_001622 NM_001634 NM_001642 NM_001648 NM_001649 NM_001650 NM_001654 NM_001658 NM_001660 NM_001668 NM_001675 NM_001678 NM_001681 NM_001682 NM_001683 NM_001684 NM_001695 NM_001704 NM_001706 NM_001712 NM_001720 NM_001729 NM_001732 NM_001741 NM_001744 NM_001746 NM_001752 NM_001753 NM_001754 NM_001759 NM_001767 NM_001771 NM_001773 NM_001777 NM_001781 NM_001792 NM_001798 NM_001826 NM_001829 NM_001837 NM_001858 NM_001862 NM_001870 NM_001875 NM_001882 NM_001884 NM_001898 NM_001899 NM_001901 NM_001915 NM_001917 NM_001921 NM_001931 NM_001935 NM_001949 NM_001951 NM_001952 NM_001964 NM_001966 NM_001969 NM_001980 NM_001981 NM_001982 NM_001987 NM_001995 NM_001999 NM_002006 NM_002015 NM_002025 NM_002026 NM_002039 NM_002062 NM_002063 NM_002065 NM_002069 NM_002079 NM_002080 NM_002082 NM_002086 NM_002092 NM_002099 NM_002108 NM_002111 NM_002126 NM_002135 NM_002136 NM_002138 NM_002141 NM_002142 NM_002158 NM_002187 NM_002210 NM_002211 NM_002221 NM_002226 NM_002228 NM_002235 NM_002239 NM_002247 NM_002254 NM_002257 NM_002264 NM_002268 NM_002277 NM_002284 NM_002285 NM_002293 NM_002294 NM_002296 NM_002298 NM_002304 NM_002310 NM_002313 NM_002340 NM_002345 NM_002349 NM_002350 NM_002355 NM_002359 NM_002374 NM_002375 NM_002376 NM_002380 NM_002384 NM_002385 NM_002397 NM_002401 NM_002406 NM_002412 NM_002414 NM_002417 NM_002421 NM_002425 NM_002427 NM_002428 NM_002429 NM_002431 NM_002438 NM_002442 NM_002449 NM_002466 NM_002469 NM_002472 NM_002473 NM_002480 NM_002481 NM_002483 NM_002484 NM_002487 NM_002490 NM_002508 NM_002510 NM_002514 NM_002515 NM_002522 NM_002526 NM_002531 NM_002545 NM_002547 NM_002552 NM_002563 NM_002564 NM_002575 NM_002577 NM_002589 NM_002590 NM_002591 NM_002604 NM_002609 NM_002610 NM_002612 NM_002613 NM_002623 NM_002624 NM_002627 NM_002629 NM_002631 NM_002634 NM_002640 NM_002646 NM_002649 NM_002650 NM_002653 NM_002655 NM_002661 NM_002662 NM_002670 NM_002677 NM_002702 NM_002703 NM_002709 NM_002715 NM_002725 NM_002736 NM_002738 NM_002745 NM_002747 NM_002751 NM_002752 NM_002755 NM_002759 NM_002764 NM_002768 NM_002778 NM_002781 NM_002784 NM_002785 NM_002790 NM_002822 NM_002827 NM_002829 NM_002833 NM_002834 NM_002843 NM_002844 NM_002848 NM_002858 NM_002860 NM_002862 NM_002869 NM_002871 NM_002876 NM_002877 NM_002883 NM_002891 NM_002895 NM_002900 NM_002905 NM_002906 NM_002912 NM_002919 NM_002922 NM_002923 NM_002928 NM_002936 NM_002937 NM_002948 NM_002949 NM_002955 NM_002956 NM_002957 NM_002959 NM_002971 NM_002984 NM_002986 NM_003003 NM_003010 NM_003012 NM_003014 NM_003016 NM_003017 NM_003020 NM_003024 NM_003026 NM_003032 NM_003035 NM_003038 NM_003042 NM_003044 NM_003045 NM_003046 NM_003047 NM_003051 NM_003052 NM_003053 NM_003056 NM_003068 NM_003069 NM_003072 NM_003074 NM_003076 NM_003077 NM_003081 NM_003103 NM_003108 NM_003110 NM_003111 NM_003112 NM_003118 NM_003123 NM_003125 NM_003131 NM_003139 NM_003152 NM_003155 NM_003161 NM_003164 NM_003165 NM_003166 NM_003172 NM_003173 NM_003174 NM_003178 NM_003184 NM_003188 NM_003195 NM_003199 NM_003200 NM_003201 NM_003203 NM_003205 NM_003216 NM_003222 NM_003236 NM_003239 NM_003246 NM_003247 NM_003255 NM_003262 NM_003274 NM_003275 NM_003287 NM_003291 NM_003298 NM_003307 NM_003319 NM_003320 NM_003324 NM_003325 NM_003326 NM_003340 NM_003342 NM_003347 NM_003360 NM_003362 NM_003363 NM_003373 NM_003379 NM_003382 NM_003385 NM_003400 NM_003404 NM_003406 NM_003407 NM_003408 NM_003412 NM_003417 NM_003419 NM_003423 NM_003426 NM_003436 NM_003439 NM_003441 NM_003453 NM_003454 NM_003458 NM_003459 NM_003462 NM_003463 NM_003466 NM_003472 NM_003475 NM_003479 NM_003489 NM_003506 NM_003507 NM_003559 NM_003565 NM_003567 NM_003573 NM_003575 NM_003578 NM_003580 NM_003581 NM_003583 NM_003590 NM_003599 NM_003607 NM_003615 NM_003617 NM_003622 NM_003626 NM_003627 NM_003629 NM_003631 NM_003633 NM_003636 NM_003640 NM_003642 NM_003643 NM_003647 NM_003648 NM_003651 NM_003655 NM_003670 NM_003671 NM_003672 NM_003673 NM_003674 NM_003677 NM_003679 NM_003681 NM_003701 NM_003713 NM_003715 NM_003724 NM_003759 NM_003763 NM_003774 NM_003783 NM_003799 NM_003800 NM_003803 NM_003805 NM_003808 NM_003811 NM_003831 NM_003838 NM_003846 NM_003847 NM_003849 NM_003850 NM_003851 NM_003856 NM_003861 NM_003873 NM_003874 NM_003878 NM_003885 NM_003888 NM_003890 NM_003895 NM_003898 NM_003901 NM_003907 NM_003909 NM_003913 NM_003916 NM_003924 NM_003926 NM_003929 NM_003933 NM_003939 NM_003943 NM_003949 NM_003954 NM_003958 NM_003966 NM_003972 NM_003980 NM_003983 NM_003994 NM_003998 NM_004028 NM_004034 NM_004050 NM_004055 NM_004063 NM_004079 NM_004080 NM_004085 NM_004090 NM_004091 NM_004093 NM_004095 NM_004098 NM_004099 NM_004103 NM_004109 NM_004125 NM_004126 NM_004137 NM_004145 NM_004156 NM_004170 NM_004171 NM_004178 NM_004184 NM_004188 NM_004202 NM_004214 NM_004215 NM_004216 NM_004232 NM_004235 NM_004261 NM_004263 NM_004268 NM_004272 NM_004273 NM_004275 NM_004276 NM_004281 NM_004290 NM_004293 NM_004302 NM_004311 NM_004319 NM_004321 NM_004326 NM_004329 NM_004330 NM_004335 NM_004338 NM_004341 NM_004342 NM_004349 NM_004357 NM_004360 NM_004364 NM_004369 NM_004375 NM_004379 NM_004384 NM_004386 NM_004390 NM_004392 NM_004402 NM_004404 NM_004411 NM_004419 NM_004421 NM_004422 NM_004433 NM_004438 NM_004449 NM_004454 NM_004457 NM_004459 NM_004464 NM_004467 NM_004473 NM_004482 NM_004484 NM_004485 NM_004486 NM_004495 NM_004497 NM_004499 NM_004504 NM_004505 NM_004507 NM_004508 NM_004513 NM_004518 NM_004520 NM_004537 NM_004556 NM_004557 NM_004563 NM_004564 NM_004566 NM_004567 NM_004571 NM_004572 NM_004580 NM_004586 NM_004588 NM_004595 NM_004600 NM_004603 NM_004610 NM_004612 NM_004613 NM_004621 NM_004622 NM_004624 NM_004635 NM_004637 NM_004645 NM_004649 NM_004657 NM_004660 NM_004663 NM_004670 NM_004680 NM_004684 NM_004687 NM_004698 NM_004710 NM_004711 NM_004718 NM_004719 NM_004729 NM_004731 NM_004734 NM_004738 NM_004744 NM_004745 NM_004766 NM_004776 NM_004778 NM_004783 NM_004784 NM_004788 NM_004795 NM_004796 NM_004798 NM_004799 NM_004800 NM_004824 NM_004827 NM_004834 NM_004840 NM_004844 NM_004845 NM_004848 NM_004849 NM_004854 NM_004858 NM_004859 NM_004860 NM_004863 NM_004865 NM_004866 NM_004871 NM_004873 NM_004887 NM_004896 NM_004898 NM_004900 NM_004902 NM_004904 NM_004905 NM_004912 NM_004914 NM_004921 NM_004924 NM_004925 NM_004926 NM_004927 NM_004929 NM_004931 NM_004936 NM_004948 NM_004949 NM_004957 NM_004958 NM_004959 NM_004966 NM_004968 NM_004982 NM_004983 NM_004985 NM_004992 NM_004993 NM_004998 NM_005006 NM_005008 NM_005011 NM_005018 NM_005019 NM_005032 NM_005036 NM_005038 NM_005046 NM_005060 NM_005065 NM_005068 NM_005069 NM_005070 NM_005075 NM_005079 NM_005081 NM_005082 NM_005087 NM_005093 NM_005095 NM_005100 NM_005102 NM_005105 NM_005109 NM_005118 NM_005124 NM_005132 NM_005137 NM_005156 NM_005157 NM_005173 NM_005184 NM_005188 NM_005192 NM_005197 NM_005199 NM_005202 NM_005204 NM_005207 NM_005214 NM_005216 NM_005219 NM_005225 NM_005226 NM_005235 NM_005238 NM_005256 NM_005257 NM_005266 NM_005274 NM_005277 NM_005291 NM_005296 NM_005297 NM_005311 NM_005316 NM_005324 NM_005327 NM_005339 NM_005347 NM_005355 NM_005358 NM_005359 NM_005367 NM_005369 NM_005375 NM_005380 NM_005384 NM_005385 NM_005387 NM_005391 NM_005397 NM_005398 NM_005399 NM_005400 NM_005402 NM_005417 NM_005420 NM_005428 NM_005436 NM_005465 NM_005470 NM_005476 NM_005477 NM_005485 NM_005492 NM_005495 NM_005504 NM_005505 NM_005509 NM_005511 NM_005512 NM_005518 NM_005537 NM_005539 NM_005541 NM_005544 NM_005552 NM_005559 NM_005564 NM_005569 NM_005574 NM_005578 NM_005588 NM_005590 NM_005591 NM_005598 NM_005604 NM_005607 NM_005613 NM_005618 NM_005627 NM_005629 NM_005638 NM_005646 NM_005656 NM_005658 NM_005665 NM_005667 NM_005668 NM_005670 NM_005679 NM_005683 NM_005686 NM_005704 NM_005717 NM_005721 NM_005724 NM_005725 NM_005730 NM_005739 NM_005752 NM_005754 NM_005763 NM_005765 NM_005768 NM_005772 NM_005779 NM_005785 NM_005788 NM_005789 NM_005808 NM_005819 NM_005821 NM_005822 NM_005828 NM_005829 NM_005832 NM_005833 NM_005840 NM_005842 NM_005844 NM_005862 NM_005869 NM_005870 NM_005872 NM_005876 NM_005885 NM_005887 NM_005894 NM_005902 NM_005903 NM_005906 NM_005911 NM_005915 NM_005924 NM_005927 NM_005928 NM_005930 NM_005931 NM_005933 NM_005935 NM_005938 NM_005942 NM_005943 NM_005944 NM_005962 NM_005964 NM_005965 NM_005966 NM_005968 NM_005969 NM_005984 NM_005986 NM_005992 NM_005993 NM_005996 NM_005999 NM_006005 NM_006007 NM_006011 NM_006013 NM_006017 NM_006022 NM_006030 NM_006031 NM_006033 NM_006036 NM_006037 NM_006038 NM_006052 NM_006054 NM_006055 NM_006061 NM_006063 NM_006067 NM_006091 NM_006092 NM_006096 NM_006106 NM_006112 NM_006115 NM_006117 NM_006122 NM_006133 NM_006139 NM_006141 NM_006155 NM_006162 NM_006178 NM_006190 NM_006201 NM_006203 NM_006206 NM_006210 NM_006216 NM_006228 NM_006241 NM_006242 NM_006243 NM_006253 NM_006262 NM_006265 NM_006268 NM_006269 NM_006281 NM_006282 NM_006283 NM_006286 NM_006291 NM_006297 NM_006298 NM_006306 NM_006313 NM_006315 NM_006321 NM_006325 NM_006328 NM_006352 NM_006359 NM_006361 NM_006363 NM_006371 NM_006373 NM_006377 NM_006380 NM_006386 NM_006387 NM_006389 NM_006390 NM_006393 NM_006402 NM_006407 NM_006408 NM_006415 NM_006418 NM_006449 NM_006452 NM_006457 NM_006464 NM_006479 NM_006481 NM_006482 NM_006485 NM_006487 NM_006489 NM_006492 NM_006493 NM_006495 NM_006496 NM_006504 NM_006505 NM_006510 NM_006520 NM_006526 NM_006528 NM_006534 NM_006546 NM_006547 NM_006554 NM_006557 NM_006561 NM_006564 NM_006572 NM_006578 NM_006581 NM_006587 NM_006588 NM_006593 NM_006599 NM_006603 NM_006606 NM_006611 NM_006613 NM_006617 NM_006620 NM_006628 NM_006634 NM_006643 NM_006665 NM_006667 NM_006675 NM_006676 NM_006678 NM_006699 NM_006703 NM_006706 NM_006713 NM_006720 NM_006721 NM_006731 NM_006734 NM_006738 NM_006742 NM_006743 NM_006746 NM_006748 NM_006751 NM_006764 NM_006771 NM_006774 NM_006777 NM_006788 NM_006791 NM_006803 NM_006822 NM_006827 NM_006832 NM_006843 NM_006858 NM_006859 NM_006862 NM_006870 NM_006876 NM_006880 NM_006881 NM_006888 NM_006901 NM_006902 NM_006904 NM_006922 NM_006924 NM_006925 NM_006926 NM_006931 NM_006934 NM_006937 NM_006940 NM_006948 NM_006955 NM_006982 NM_006984 NM_006989 NM_006990 NM_006993 NM_006995 NM_006996 NM_006999 NM_007007 NM_007015 NM_007023 NM_007026 NM_007030 NM_007038 NM_007043 NM_007048 NM_007050 NM_007052 NM_007065 NM_007067 NM_007068 NM_007078 NM_007086 NM_007106 NM_007107 NM_007110 NM_007118 NM_007120 NM_007122 NM_007123 NM_007127 NM_007136 NM_007137 NM_007146 NM_007147 NM_007150 NM_007157 NM_007159 NM_007166 NM_007174 NM_007175 NM_007182 NM_007187 NM_007189 NM_007197 NM_007200 NM_007203 NM_007218 NM_007219 NM_007220 NM_007223 NM_007225 NM_007231 NM_007232 NM_007236 NM_007240 NM_007246 NM_007249 NM_007257 NM_007283 NM_007306 NM_007308 NM_007313 NM_007324 NM_007341 NM_007349 NM_007351 NM_007354 NM_007362 NM_007371 NM_007372 NM_007373 NM_009586 NM_009590 NM_012072 NM_012073 NM_012074 NM_012075 NM_012081 NM_012089 NM_012095 NM_012096 NM_012105 NM_012116 NM_012117 NM_012120 NM_012121 NM_012129 NM_012133 NM_012137 NM_012156 NM_012160 NM_012171 NM_012174 NM_012188 NM_012189 NM_012198 NM_012207 NM_012210 NM_012215 NM_012219 NM_012223 NM_012231 NM_012233 NM_012234 NM_012249 NM_012252 NM_012262 NM_012264 NM_012266 NM_012281 NM_012284 NM_012287 NM_012288 NM_012289 NM_012300 NM_012306 NM_012307 NM_012319 NM_012320 NM_012325 NM_012328 NM_012342 NM_012347 NM_012397 NM_012398 NM_012399 NM_012406 NM_012409 NM_012412 NM_012415 NM_012416 NM_012419 NM_012421 NM_012423 NM_012425 NM_012428 NM_012430 NM_012434 NM_012448 NM_012458 NM_012464 NM_012465 NM_012479 NM_012481 NM_013230 NM_013231 NM_013232 NM_013233 NM_013235 NM_013236 NM_013238 NM_013241 NM_013249 NM_013253 NM_013255 NM_013257 NM_013261 NM_013277 NM_013279 NM_013281 NM_013284 NM_013286 NM_013312 NM_013322 NM_013368 NM_013372 NM_013375 NM_013377 NM_013380 NM_013381 NM_013386 NM_013390 NM_013397 NM_013399 NM_013411 NM_013423 NM_013427 NM_013433 NM_013436 NM_013447 NM_013449 NM_013450 NM_013937 NM_013951 NM_013952 NM_013953 NM_013955 NM_013989 NM_013992 NM_013995 NM_014000 NM_014001 NM_014005 NM_014009 NM_014011 NM_014028 NM_014035 NM_014039 NM_014043 NM_014048 NM_014050 NM_014078 NM_014079 NM_014089 NM_014096 NM_014106 NM_014112 NM_014138 NM_014146 NM_014149 NM_014153 NM_014160 NM_014166 NM_014167 NM_014187 NM_014212 NM_014217 NM_014218 NM_014219 NM_014220 NM_014222 NM_014231 NM_014240 NM_014243 NM_014246 NM_014268 NM_014275 NM_014276 NM_014280 NM_014283 NM_014284 NM_014286 NM_014293 NM_014294 NM_014300 NM_014310 NM_014313 NM_014315 NM_014317 NM_014319 NM_014320 NM_014321 NM_014322 NM_014325 NM_014332 NM_014341 NM_014344 NM_014351 NM_014364 NM_014375 NM_014382 NM_014405 NM_014411 NM_014415 NM_014433 NM_014438 NM_014441 NM_014442 NM_014444 NM_014445 NM_014459 NM_014468 NM_014472 NM_014480 NM_014500 NM_014504 NM_014506 NM_014507 NM_014520 NM_014521 NM_014553 NM_014554 NM_014556 NM_014562 NM_014571 NM_014574 NM_014575 NM_014583 NM_014584 NM_014585 NM_014586 NM_014588 NM_014592 NM_014601 NM_014606 NM_014607 NM_014612 NM_014613 NM_014615 NM_014631 NM_014634 NM_014647 NM_014653 NM_014656 NM_014659 NM_014665 NM_014671 NM_014674 NM_014682 NM_014686 NM_014689 NM_014690 NM_014697 NM_014701 NM_014702 NM_014703 NM_014706 NM_014707 NM_014719 NM_014721 NM_014730 NM_014732 NM_014733 NM_014734 NM_014737 NM_014739 NM_014743 NM_014744 NM_014746 NM_014747 NM_014755 NM_014758 NM_014760 NM_014762 NM_014765 NM_014766 NM_014767 NM_014772 NM_014773 NM_014776 NM_014777 NM_014784 NM_014786 NM_014787 NM_014789 NM_014795 NM_014804 NM_014805 NM_014808 NM_014813 NM_014814 NM_014819 NM_014820 NM_014824 NM_014826 NM_014829 NM_014830 NM_014836 NM_014837 NM_014839 NM_014844 NM_014849 NM_014857 NM_014859 NM_014860 NM_014862 NM_014864 NM_014867 NM_014870 NM_014872 NM_014873 NM_014879 NM_014880 NM_014883 NM_014891 NM_014893 NM_014895 NM_014897 NM_014898 NM_014900 NM_014903 NM_014904 NM_014905 NM_014906 NM_014912 NM_014916 NM_014918 NM_014919 NM_014920 NM_014923 NM_014926 NM_014932 NM_014934 NM_014935 NM_014936 NM_014942 NM_014945 NM_014947 NM_014948 NM_014949 NM_014950 NM_014955 NM_014962 NM_014965 NM_014974 NM_014992 NM_014996 NM_014997 NM_015002 NM_015003 NM_015005 NM_015011 NM_015013 NM_015017 NM_015020 NM_015022 NM_015025 NM_015027 NM_015032 NM_015033 NM_015035 NM_015039 NM_015040 NM_015043 NM_015045 NM_015049 NM_015050 NM_015051 NM_015055 NM_015056 NM_015065 NM_015071 NM_015074 NM_015076 NM_015079 NM_015084 NM_015085 NM_015088 NM_015092 NM_015093 NM_015094 NM_015097 NM_015111 NM_015125 NM_015127 NM_015129 NM_015133 NM_015134 NM_015138 NM_015141 NM_015144 NM_015148 NM_015149 NM_015150 NM_015160 NM_015163 NM_015170 NM_015172 NM_015173 NM_015184 NM_015190 NM_015192 NM_015199 NM_015200 NM_015202 NM_015205 NM_015206 NM_015208 NM_015210 NM_015215 NM_015216 NM_015224 NM_015225 NM_015226 NM_015233 NM_015245 NM_015246 NM_015247 NM_015254 NM_015260 NM_015261 NM_015264 NM_015265 NM_015266 NM_015270 NM_015271 NM_015282 NM_015286 NM_015288 NM_015289 NM_015296 NM_015305 NM_015310 NM_015313 NM_015315 NM_015316 NM_015320 NM_015328 NM_015329 NM_015332 NM_015336 NM_015340 NM_015345 NM_015347 NM_015352 NM_015353 NM_015358 NM_015359 NM_015367 NM_015368 NM_015375 NM_015384 NM_015385 NM_015393 NM_015395 NM_015396 NM_015417 NM_015432 NM_015438 NM_015441 NM_015446 NM_015449 NM_015455 NM_015458 NM_015459 NM_015460 NM_015469 NM_015470 NM_015471 NM_015472 NM_015474 NM_015477 NM_015483 NM_015493 NM_015516 NM_015525 NM_015532 NM_015534 NM_015545 NM_015549 NM_015553 NM_015554 NM_015555 NM_015558 NM_015560 NM_015564 NM_015565 NM_015569 NM_015570 NM_015576 NM_015577 NM_015578 NM_015584 NM_015600 NM_015610 NM_015627 NM_015633 NM_015634 NM_015652 NM_015657 NM_015670 NM_015679 NM_015683 NM_015686 NM_015687 NM_015690 NM_015691 NM_015723 NM_015844 NM_015846 NM_015847 NM_015865 NM_015878 NM_015881 NM_015889 NM_015901 NM_015904 NM_015910 NM_015913 NM_015928 NM_015935 NM_015947 NM_015960 NM_015967 NM_015975 NM_015980 NM_015982 NM_015984 NM_015986 NM_015990 NM_015995 NM_015996 NM_016003 NM_016011 NM_016018 NM_016021 NM_016025 NM_016034 NM_016048 NM_016052 NM_016057 NM_016061 NM_016068 NM_016072 NM_016078 NM_016079 NM_016083 NM_016107 NM_016114 NM_016122 NM_016124 NM_016131 NM_016132 NM_016133 NM_016143 NM_016153 NM_016156 NM_016162 NM_016173 NM_016183 NM_016184 NM_016194 NM_016201 NM_016203 NM_016206 NM_016210 NM_016217 NM_016224 NM_016225 NM_016227 NM_016232 NM_016235 NM_016240 NM_016249 NM_016255 NM_016257 NM_016269 NM_016275 NM_016277 NM_016280 NM_016282 NM_016284 NM_016285 NM_016291 NM_016297 NM_016302 NM_016315 NM_016320 NM_016322 NM_016338 NM_016343 NM_016355 NM_016359 NM_016360 NM_016370 NM_016376 NM_016388 NM_016400 NM_016403 NM_016418 NM_016424 NM_016427 NM_016434 NM_016436 NM_016440 NM_016441 NM_016442 NM_016448 NM_016453 NM_016454 NM_016458 NM_016474 NM_016513 NM_016526 NM_016530 NM_016534 NM_016538 NM_016540 NM_016542 NM_016544 NM_016569 NM_016575 NM_016577 NM_016583 NM_016592 NM_016598 NM_016599 NM_016603 NM_016607 NM_016613 NM_016615 NM_016620 NM_016622 NM_016623 NM_016625 NM_016639 NM_016642 NM_016652 NM_016733 NM_016817 NM_016824 NM_016830 NM_016831 NM_016936 NM_016946 NM_017415 NM_017420 NM_017423 NM_017424 NM_017435 NM_017439 NM_017444 NM_017455 NM_017506 NM_017515 NM_017516 NM_017521 NM_017523 NM_017526 NM_017527 NM_017544 NM_017549 NM_017553 NM_017554 NM_017556 NM_017586 NM_017594 NM_017602 NM_017607 NM_017611 NM_017623 NM_017626 NM_017629 NM_017634 NM_017637 NM_017640 NM_017644 NM_017645 NM_017654 NM_017657 NM_017661 NM_017665 NM_017676 NM_017694 NM_017699 NM_017714 NM_017721 NM_017723 NM_017736 NM_017737 NM_017738 NM_017741 NM_017744 NM_017747 NM_017750 NM_017755 NM_017759 NM_017769 NM_017772 NM_017776 NM_017778 NM_017779 NM_017785 NM_017801 NM_017811 NM_017814 NM_017819 NM_017828 NM_017832 NM_017842 NM_017847 NM_017851 NM_017861 NM_017879 NM_017882 NM_017884 NM_017893 NM_017896 NM_017902 NM_017904 NM_017905 NM_017913 NM_017928 NM_017929 NM_017931 NM_017936 NM_017944 NM_017945 NM_017946 NM_017952 NM_017954 NM_017958 NM_017966 NM_017974 NM_017975 NM_017988 NM_017991 NM_017993 NM_017998 NM_018013 NM_018024 NM_018047 NM_018048 NM_018050 NM_018053 NM_018055 NM_018057 NM_018058 NM_018061 NM_018066 NM_018069 NM_018082 NM_018084 NM_018086 NM_018090 NM_018098 NM_018101 NM_018103 NM_018105 NM_018106 NM_018108 NM_018109 NM_018113 NM_018114 NM_018116 NM_018120 NM_018121 NM_018126 NM_018129 NM_018150 NM_018152 NM_018157 NM_018168 NM_018178 NM_018181 NM_018184 NM_018185 NM_018194 NM_018195 NM_018200 NM_018205 NM_018207 NM_018209 NM_018211 NM_018212 NM_018214 NM_018225 NM_018229 NM_018234 NM_018238 NM_018239 NM_018241 NM_018242 NM_018243 NM_018247 NM_018252 NM_018254 NM_018265 NM_018273 NM_018280 NM_018286 NM_018290 NM_018291 NM_018293 NM_018303 NM_018304 NM_018319 NM_018323 NM_018325 NM_018330 NM_018332 NM_018340 NM_018342 NM_018347 NM_018361 NM_018362 NM_018364 NM_018374 NM_018379 NM_018380 NM_018385 NM_018388 NM_018394 NM_018399 NM_018401 NM_018404 NM_018407 NM_018424 NM_018425 NM_018427 NM_018439 NM_018440 NM_018448 NM_018453 NM_018454 NM_018466 NM_018471 NM_018476 NM_018485 NM_018555 NM_018557 NM_018590 NM_018602 NM_018639 NM_018650 NM_018652 NM_018653 NM_018662 NM_018667 NM_018682 NM_018689 NM_018695 NM_018698 NM_018708 NM_018715 NM_018719 NM_018834 NM_018836 NM_018839 NM_018840 NM_018841 NM_018847 NM_018891 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018932 NM_018937 NM_018961 NM_018963 NM_018964 NM_018976 NM_018981 NM_018991 NM_018993 NM_018995 NM_018999 NM_019001 NM_019011 NM_019012 NM_019013 NM_019022 NM_019027 NM_019034 NM_019043 NM_019045 NM_019061 NM_019063 NM_019075 NM_019076 NM_019077 NM_019078 NM_019080 NM_019081 NM_019087 NM_019089 NM_019091 NM_019093 NM_019094 NM_019095 NM_019102 NM_019117 NM_019119 NM_019555 NM_019590 NM_019593 NM_019604 NM_019605 NM_019616 NM_019624 NM_019625 NM_019863 NM_019885 NM_019895 NM_019903 NM_020037 NM_020038 NM_020066 NM_020116 NM_020125 NM_020131 NM_020132 NM_020133 NM_020139 NM_020141 NM_020147 NM_020148 NM_020150 NM_020159 NM_020161 NM_020164 NM_020167 NM_020179 NM_020182 NM_020194 NM_020198 NM_020207 NM_020208 NM_020215 NM_020219 NM_020227 NM_020228 NM_020238 NM_020243 NM_020248 NM_020309 NM_020310 NM_020313 NM_020337 NM_020338 NM_020342 NM_020347 NM_020354 NM_020357 NM_020374 NM_020381 NM_020390 NM_020394 NM_020398 NM_020405 NM_020416 NM_020421 NM_020431 NM_020432 NM_020440 NM_020448 NM_020451 NM_020455 NM_020456 NM_020465 NM_020467 NM_020474 NM_020536 NM_020546 NM_020552 NM_020553 NM_020645 NM_020647 NM_020648 NM_020653 NM_020654 NM_020657 NM_020665 NM_020673 NM_020674 NM_020675 NM_020676 NM_020684 NM_020689 NM_020698 NM_020699 NM_020702 NM_020708 NM_020710 NM_020713 NM_020715 NM_020724 NM_020727 NM_020728 NM_020738 NM_020739 NM_020750 NM_020751 NM_020761 NM_020768 NM_020770 NM_020771 NM_020772 NM_020777 NM_020779 NM_020781 NM_020782 NM_020783 NM_020789 NM_020791 NM_020792 NM_020795 NM_020796 NM_020800 NM_020802 NM_020806 NM_020807 NM_020809 NM_020810 NM_020813 NM_020814 NM_020818 NM_020825 NM_020828 NM_020841 NM_020844 NM_020850 NM_020860 NM_020865 NM_020886 NM_020894 NM_020919 NM_020922 NM_020925 NM_020936 NM_020939 NM_020940 NM_020947 NM_020954 NM_020956 NM_020957 NM_020961 NM_020962 NM_020972 NM_020983 NM_020988 NM_020993 NM_021003 NM_021016 NM_021020 NM_021021 NM_021027 NM_021038 NM_021045 NM_021049 NM_021075 NM_021076 NM_021083 NM_021088 NM_021102 NM_021116 NM_021129 NM_021132 NM_021135 NM_021148 NM_021151 NM_021155 NM_021156 NM_021159 NM_021161 NM_021181 NM_021183 NM_021190 NM_021197 NM_021201 NM_021203 NM_021204 NM_021215 NM_021226 NM_021238 NM_021239 NM_021255 NM_021619 NM_021622 NM_021624 NM_021629 NM_021633 NM_021635 NM_021642 NM_021643 NM_021644 NM_021648 NM_021728 NM_021735 NM_021736 NM_021737 NM_021738 NM_021783 NM_021798 NM_021807 NM_021808 NM_021813 NM_021814 NM_021815 NM_021828 NM_021903 NM_021904 NM_021905 NM_021912 NM_021923 NM_021925 NM_021931 NM_021932 NM_021935 NM_021940 NM_021945 NM_021953 NM_021957 NM_021961 NM_021962 NM_021970 NM_021973 NM_021977 NM_021980 NM_021999 NM_022006 NM_022036 NM_022040 NM_022041 NM_022060 NM_022062 NM_022066 NM_022074 NM_022080 NM_022097 NM_022106 NM_022112 NM_022114 NM_022123 NM_022129 NM_022130 NM_022143 NM_022145 NM_022151 NM_022160 NM_022162 NM_022167 NM_022170 NM_022307 NM_022308 NM_022337 NM_022343 NM_022346 NM_022361 NM_022365 NM_022373 NM_022405 NM_022444 NM_022459 NM_022462 NM_022469 NM_022473 NM_022474 NM_022475 NM_022482 NM_022491 NM_022495 NM_022497 NM_022564 NM_022570 NM_022658 NM_022720 NM_022726 NM_022737 NM_022745 NM_022749 NM_022751 NM_022754 NM_022755 NM_022756 NM_022758 NM_022760 NM_022767 NM_022778 NM_022780 NM_022781 NM_022791 NM_022792 NM_022817 NM_022819 NM_022829 NM_022831 NM_022836 NM_022838 NM_022842 NM_022893 NM_022897 NM_022898 NM_022900 NM_022910 NM_022912 NM_022969 NM_022970 NM_022971 NM_022972 NM_022975 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023032 NM_023073 NM_023075 NM_023079 NM_023112 NM_023914 NM_023923 NM_023929 NM_023930 NM_023939 NM_023942 NM_024006 NM_024013 NM_024015 NM_024019 NM_024021 NM_024022 NM_024040 NM_024043 NM_024051 NM_024052 NM_024067 NM_024072 NM_024076 NM_024077 NM_024080 NM_024086 NM_024091 NM_024092 NM_024094 NM_024102 NM_024109 NM_024293 NM_024294 NM_024295 NM_024320 NM_024329 NM_024334 NM_024342 NM_024411 NM_024421 NM_024422 NM_024492 NM_024496 NM_024501 NM_024508 NM_024512 NM_024532 NM_024544 NM_024546 NM_024551 NM_024563 NM_024584 NM_024587 NM_024591 NM_024593 NM_024594 NM_024602 NM_024611 NM_024612 NM_024613 NM_024614 NM_024620 NM_024624 NM_024627 NM_024628 NM_024629 NM_024633 NM_024649 NM_024652 NM_024654 NM_024656 NM_024665 NM_024669 NM_024674 NM_024675 NM_024676 NM_024681 NM_024698 NM_024709 NM_024711 NM_024726 NM_024733 NM_024735 NM_024738 NM_024753 NM_024759 NM_024761 NM_024772 NM_024774 NM_024783 NM_024787 NM_024789 NM_024795 NM_024798 NM_024800 NM_024811 NM_024812 NM_024817 NM_024824 NM_024828 NM_024833 NM_024835 NM_024837 NM_024841 NM_024847 NM_024852 NM_024854 NM_024861 NM_024863 NM_024864 NM_024866 NM_024896 NM_024900 NM_024906 NM_024915 NM_024918 NM_024921 NM_024923 NM_024944 NM_024946 NM_024949 NM_024955 NM_024959 NM_024969 NM_024993 NM_025019 NM_025023 NM_025027 NM_025058 NM_025059 NM_025073 NM_025076 NM_025106 NM_025133 NM_025152 NM_025159 NM_025160 NM_025163 NM_025164 NM_025168 NM_025182 NM_025187 NM_025194 NM_025201 NM_025203 NM_025208 NM_025215 NM_025219 NM_025240 NM_025244 NM_025247 NM_030569 NM_030571 NM_030574 NM_030579 NM_030583 NM_030615 NM_030623 NM_030626 NM_030627 NM_030636 NM_030639 NM_030641 NM_030645 NM_030648 NM_030650 NM_030660 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030759 NM_030760 NM_030762 NM_030764 NM_030774 NM_030777 NM_030785 NM_030796 NM_030797 NM_030803 NM_030805 NM_030806 NM_030813 NM_030816 NM_030817 NM_030820 NM_030878 NM_030881 NM_030884 NM_030906 NM_030915 NM_030916 NM_030918 NM_030919 NM_030922 NM_030926 NM_030935 NM_030941 NM_030949 NM_030950 NM_030952 NM_030953 NM_030958 NM_030965 NM_031157 NM_031203 NM_031205 NM_031211 NM_031217 NM_031226 NM_031231 NM_031232 NM_031246 NM_031266 NM_031268 NM_031281 NM_031284 NM_031289 NM_031290 NM_031303 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031369 NM_031370 NM_031407 NM_031411 NM_031417 NM_031418 NM_031419 NM_031420 NM_031426 NM_031431 NM_031432 NM_031438 NM_031442 NM_031445 NM_031448 NM_031449 NM_031450 NM_031452 NM_031454 NM_031459 NM_031462 NM_031463 NM_031468 NM_031469 NM_031473 NM_031476 NM_031484 NM_031485 NM_031486 NM_031490 NM_031496 NM_031845 NM_031846 NM_031847 NM_031849 NM_031857 NM_031860 NM_031866 NM_031889 NM_031904 NM_031905 NM_031908 NM_031924 NM_031954 NM_031961 NM_031962 NM_031966 NM_031992 NM_032012 NM_032016 NM_032018 NM_032021 NM_032028 NM_032034 NM_032039 NM_032041 NM_032102 NM_032105 NM_032109 NM_032121 NM_032124 NM_032128 NM_032131 NM_032138 NM_032139 NM_032144 NM_032145 NM_032148 NM_032153 NM_032160 NM_032174 NM_032177 NM_032186 NM_032189 NM_032195 NM_032196 NM_032217 NM_032222 NM_032242 NM_032268 NM_032271 NM_032281 NM_032287 NM_032289 NM_032294 NM_032295 NM_032300 NM_032317 NM_032322 NM_032325 NM_032329 NM_032330 NM_032353 NM_032354 NM_032367 NM_032373 NM_032379 NM_032380 NM_032401 NM_032404 NM_032409 NM_032410 NM_032412 NM_032423 NM_032429 NM_032431 NM_032432 NM_032435 NM_032440 NM_032444 NM_032446 NM_032447 NM_032449 NM_032458 NM_032463 NM_032464 NM_032466 NM_032467 NM_032468 NM_032471 NM_032486 NM_032487 NM_032490 NM_032494 NM_032499 NM_032509 NM_032514 NM_032515 NM_032524 NM_032528 NM_032529 NM_032538 NM_032552 NM_032554 NM_032557 NM_032558 NM_032560 NM_032578 NM_032579 NM_032588 NM_032590 NM_032592 NM_032597 NM_032599 NM_032620 NM_032632 NM_032644 NM_032647 NM_032664 NM_032681 NM_032682 NM_032706 NM_032710 NM_032711 NM_032728 NM_032735 NM_032750 NM_032753 NM_032783 NM_032784 NM_032785 NM_032797 NM_032800 NM_032810 NM_032811 NM_032815 NM_032817 NM_032826 NM_032832 NM_032833 NM_032836 NM_032842 NM_032844 NM_032859 NM_032863 NM_032865 NM_032869 NM_032871 NM_032883 NM_032886 NM_032926 NM_032927 NM_032933 NM_032943 NM_032947 NM_032949 NM_032957 NM_032959 NM_032961 NM_032968 NM_032969 NM_032973 NM_032978 NM_032979 NM_032981 NM_032983 NM_032984 NM_032985 NM_032986 NM_032995 NM_032998 NM_033012 NM_033017 NM_033018 NM_033027 NM_033028 NM_033030 NM_033053 NM_033069 NM_033082 NM_033083 NM_033087 NM_033089 NM_033090 NM_033091 NM_033092 NM_033100 NM_033106 NM_033109 NM_033114 NM_033125 NM_033135 NM_033138 NM_033139 NM_033140 NM_033141 NM_033143 NM_033157 NM_033181 NM_033191 NM_033199 NM_033201 NM_033206 NM_033220 NM_033224 NM_033262 NM_033274 NM_033285 NM_033305 NM_033318 NM_033326 NM_033331 NM_033332 NM_033338 NM_033340 NM_033346 NM_033360 NM_033364 NM_033386 NM_033389 NM_033392 NM_033397 NM_033419 NM_033425 NM_033430 NM_033437 NM_033439 NM_033446 NM_033480 NM_033481 NM_033505 NM_033512 NM_033514 NM_033516 NM_033542 NM_033544 NM_033548 NM_033550 NM_033551 NM_033624 NM_033637 NM_033644 NM_033645 NM_033655 NM_033656 NM_033661 NM_052818 NM_052822 NM_052827 NM_052830 NM_052832 NM_052840 NM_052847 NM_052851 NM_052862 NM_052864 NM_052874 NM_052879 NM_052880 NM_052882 NM_052886 NM_052896 NM_052898 NM_052901 NM_052903 NM_052905 NM_052906 NM_052909 NM_052918 NM_052925 NM_052934 NM_052939 NM_052941 NM_052943 NM_052949 NM_052950 NM_052954 NM_052957 NM_052958 NM_052966 NM_052978 NM_052987 NM_052988 NM_052996 NM_053002 NM_053005 NM_053023 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053055 NM_053064 NM_053279 NM_053282 NM_054013 NM_054026 NM_057158 NM_057159 NM_057164 NM_057165 NM_057166 NM_057167 NM_057169 NM_057170 NM_057178 NM_058004 NM_058166 NM_058178 NM_058183 NM_058237 NM_058240 NM_078471 NM_078483 NM_078487 NM_078625 NM_078628 NM_080390 NM_080391 NM_080422 NM_080423 NM_080429 NM_080546 NM_080591 NM_080610 NM_080612 NM_080652 NM_080661 NM_080672 NM_080679 NM_080680 NM_080681 NM_080717 NM_080730 NM_080731 NM_080740 NM_080753 NM_080758 NM_080759 NM_080760 NM_080789 NM_080790 NM_080818 NM_080862 NM_080871 NM_080872 NM_080911 NM_080928 NM_101395 NM_130435 NM_130437 NM_130439 NM_130465 NM_130466 NM_130468 NM_130772 NM_130809 NM_130811 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130847 NM_130852 NM_131915 NM_133170 NM_133175 NM_133176 NM_133177 NM_133178 NM_133261 NM_133265 NM_133329 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133369 NM_133371 NM_133378 NM_133432 NM_133437 NM_133443 NM_133444 NM_133445 NM_133450 NM_133451 NM_133459 NM_133464 NM_133465 NM_133474 NM_133477 NM_133493 NM_133496 NM_133509 NM_133625 NM_133627 NM_133628 NM_133630 NM_134264 NM_134269 NM_134323 NM_134324 NM_134325 NM_134434 NM_134442 NM_134444 NM_138270 NM_138271 NM_138287 NM_138298 NM_138299 NM_138317 NM_138318 NM_138322 NM_138333 NM_138338 NM_138340 NM_138347 NM_138355 NM_138358 NM_138360 NM_138362 NM_138372 NM_138375 NM_138384 NM_138390 NM_138395 NM_138402 NM_138431 NM_138434 NM_138440 NM_138444 NM_138450 NM_138457 NM_138459 NM_138467 NM_138468 NM_138473 NM_138494 NM_138566 NM_138571 NM_138572 NM_138576 NM_138608 NM_138614 NM_138619 NM_138634 NM_138635 NM_138694 NM_138706 NM_138713 NM_138714 NM_138715 NM_138716 NM_138726 NM_138727 NM_138728 NM_138740 NM_138771 NM_138781 NM_138782 NM_138799 NM_138806 NM_138809 NM_138811 NM_138813 NM_138925 NM_138926 NM_138927 NM_138928 NM_138931 NM_138967 NM_138970 NM_138991 NM_138992 NM_138998 NM_139012 NM_139014 NM_139028 NM_139030 NM_139035 NM_139068 NM_139069 NM_139070 NM_139071 NM_139072 NM_139073 NM_139131 NM_139132 NM_139136 NM_139162 NM_139168 NM_139207 NM_139246 NM_139277 NM_139278 NM_139280 NM_139321 NM_139323 NM_139353 NM_144497 NM_144501 NM_144502 NM_144503 NM_144504 NM_144566 NM_144567 NM_144576 NM_144578 NM_144596 NM_144599 NM_144600 NM_144609 NM_144613 NM_144617 NM_144628 NM_144635 NM_144636 NM_144662 NM_144665 NM_144669 NM_144682 NM_144712 NM_144717 NM_144718 NM_144721 NM_144726 NM_144767 NM_144769 NM_144781 NM_144949 NM_144973 NM_144974 NM_144975 NM_144982 NM_144991 NM_144995 NM_144996 NM_145012 NM_145026 NM_145037 NM_145055 NM_145058 NM_145060 NM_145065 NM_145159 NM_145166 NM_145177 NM_145206 NM_145207 NM_145214 NM_145244 NM_145245 NM_145246 NM_145250 NM_145257 NM_145259 NM_145263 NM_145278 NM_145280 NM_145283 NM_145284 NM_145287 NM_145295 NM_145300 NM_145307 NM_145310 NM_145323 NM_145324 NM_145325 NM_145331 NM_145332 NM_145333 NM_145342 NM_145646 NM_145648 NM_145649 NM_145655 NM_145658 NM_145686 NM_145687 NM_145690 NM_145691 NM_145693 NM_145728 NM_145731 NM_145753 NM_145799 NM_145809 NM_145868 NM_145869 NM_145891 NM_145892 NM_145893 NM_145896 NM_145897 NM_145906 NM_145912 NM_146388 NM_147129 NM_147131 NM_147132 NM_147134 NM_147160 NM_147161 NM_147180 NM_147188 NM_147190 NM_147202 NM_147203 NM_148170 NM_148171 NM_148174 NM_148886 NM_148975 NM_148979 NM_152219 NM_152222 NM_152253 NM_152257 NM_152261 NM_152264 NM_152265 NM_152272 NM_152274 NM_152284 NM_152292 NM_152295 NM_152306 NM_152309 NM_152314 NM_152330 NM_152333 NM_152336 NM_152339 NM_152341 NM_152344 NM_152357 NM_152361 NM_152365 NM_152374 NM_152376 NM_152380 NM_152382 NM_152383 NM_152391 NM_152395 NM_152400 NM_152405 NM_152409 NM_152410 NM_152412 NM_152414 NM_152415 NM_152423 NM_152429 NM_152433 NM_152436 NM_152446 NM_152448 NM_152449 NM_152450 NM_152451 NM_152457 NM_152496 NM_152498 NM_152506 NM_152510 NM_152522 NM_152524 NM_152527 NM_152529 NM_152536 NM_152538 NM_152545 NM_152546 NM_152554 NM_152570 NM_152583 NM_152588 NM_152608 NM_152609 NM_152619 NM_152624 NM_152625 NM_152629 NM_152641 NM_152643 NM_152660 NM_152665 NM_152678 NM_152680 NM_152682 NM_152695 NM_152701 NM_152702 NM_152706 NM_152715 NM_152718 NM_152721 NM_152723 NM_152724 NM_152729 NM_152731 NM_152737 NM_152738 NM_152739 NM_152755 NM_152758 NM_152765 NM_152774 NM_152776 NM_152780 NM_152785 NM_152793 NM_152796 NM_152835 NM_152840 NM_152842 NM_152857 NM_152858 NM_152860 NM_152879 NM_152890 NM_152903 NM_152906 NM_152909 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152989 NM_152995 NM_152999 NM_153008 NM_153012 NM_153013 NM_153020 NM_153022 NM_153032 NM_153033 NM_153034 NM_153035 NM_153036 NM_153041 NM_153042 NM_153043 NM_153046 NM_153191 NM_153207 NM_153208 NM_153232 NM_153235 NM_153244 NM_153254 NM_153256 NM_153261 NM_153263 NM_153268 NM_153270 NM_153289 NM_153330 NM_153331 NM_153337 NM_153338 NM_153344 NM_153345 NM_153348 NM_153370 NM_153454 NM_153456 NM_153462 NM_153487 NM_153610 NM_153634 NM_153646 NM_153647 NM_153648 NM_153649 NM_153683 NM_153685 NM_153687 NM_153688 NM_153689 NM_153703 NM_153705 NM_153711 NM_153714 NM_153717 NM_153748 NM_153754 NM_153768 NM_153810 NM_153815 NM_153823 NM_153825 NM_153831 NM_170601 NM_170602 NM_170603 NM_170686 NM_170691 NM_170696 NM_170697 NM_170706 NM_170709 NM_170710 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170721 NM_170724 NM_170725 NM_170740 NM_170751 NM_170752 NM_170768 NM_170773 NM_170774 NM_170780 NM_172006 NM_172058 NM_172059 NM_172060 NM_172087 NM_172089 NM_172097 NM_172099 NM_172130 NM_172131 NM_172174 NM_172175 NM_172177 NM_172178 NM_172206 NM_172211 NM_172217 NM_172230 NM_172234 NM_172236 NM_172239 NM_172240 NM_172318 NM_172337 NM_172344 NM_172370 NM_172386 NM_172387 NM_172388 NM_172389 NM_173075 NM_173076 NM_173079 NM_173080 NM_173083 NM_173156 NM_173157 NM_173174 NM_173175 NM_173176 NM_173214 NM_173216 NM_173217 NM_173459 NM_173460 NM_173462 NM_173463 NM_173468 NM_173470 NM_173473 NM_173477 NM_173484 NM_173505 NM_173510 NM_173511 NM_173529 NM_173536 NM_173547 NM_173551 NM_173552 NM_173557 NM_173561 NM_173567 NM_173570 NM_173576 NM_173578 NM_173580 NM_173588 NM_173589 NM_173599 NM_173602 NM_173611 NM_173617 NM_173631 NM_173632 NM_173643 NM_173644 NM_173653 NM_173663 NM_173666 NM_173667 NM_173670 NM_173675 NM_173677 NM_173682 NM_173683 NM_173688 NM_173689 NM_173694 NM_173698 NM_173701 NM_173728 NM_173797 NM_173801 NM_173803 NM_173805 NM_173812 NM_173822 NM_173829 NM_173831 NM_173833 NM_173834 NM_173851 NM_173854 NM_173859 NM_173872 NM_174891 NM_174892 NM_174911 NM_174921 NM_174927 NM_174929 NM_174934 NM_174936 NM_174953 NM_174954 NM_174955 NM_174956 NM_174957 NM_175053 NM_175056 NM_175062 NM_175064 NM_175068 NM_175078 NM_175609 NM_175630 NM_175634 NM_175635 NM_175636 NM_175709 NM_175733 NM_175736 NM_175745 NM_175834 NM_175852 NM_175864 NM_175866 NM_175872 NM_175874 NM_175876 NM_175883 NM_175892 NM_175901 NM_175907 NM_175908 NM_175911 NM_175913 NM_176071 NM_176072 NM_176084 NM_176085 NM_176086 NM_176786 NM_176813 NM_176814 NM_176816 NM_176823 NM_176824 NM_176853 NM_176863 NM_176871 NM_176874 NM_176894 NM_177403 NM_177405 NM_177414 NM_177422 NM_177424 NM_177436 NM_177452 NM_177453 NM_177454 NM_177549 NM_177551 NM_177552 NM_177553 NM_177925 NM_177926 NM_177947 NM_177948 NM_177952 NM_177967 NM_177968 NM_177972 NM_177977 NM_177986 NM_177996 NM_178006 NM_178007 NM_178010 NM_178011 NM_178019 NM_178026 NM_178122 NM_178129 NM_178140 NM_178151 NM_178152 NM_178153 NM_178329 NM_178353 NM_178426 NM_178427 NM_178448 NM_178498 NM_178502 NM_178505 NM_178514 NM_178516 NM_178519 NM_178532 NM_178536 NM_178540 NM_178550 NM_178562 NM_178565 NM_178566 NM_178814 NM_178832 NM_178836 NM_178839 NM_178842 NM_178850 NM_178861 NM_180991 NM_181041 NM_181076 NM_181077 NM_181078 NM_181079 NM_181265 NM_181336 NM_181356 NM_181358 NM_181361 NM_181443 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181502 NM_181504 NM_181509 NM_181523 NM_181524 NM_181531 NM_181534 NM_181535 NM_181572 NM_181618 NM_181643 NM_181659 NM_181701 NM_181703 NM_181704 NM_181705 NM_181720 NM_181724 NM_181727 NM_181741 NM_181742 NM_181776 NM_181783 NM_181785 NM_181787 NM_181794 NM_181795 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181846 NM_181847 NM_181870 NM_181872 NM_181874 NM_181876 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_181900 NM_182481 NM_182482 NM_182483 NM_182484 NM_182485 NM_182494 NM_182495 NM_182500 NM_182501 NM_182507 NM_182508 NM_182509 NM_182524 NM_182526 NM_182533 NM_182540 NM_182548 NM_182551 NM_182557 NM_182558 NM_182560 NM_182562 NM_182564 NM_182565 NM_182568 NM_182569 NM_182579 NM_182580 NM_182583 NM_182585 NM_182586 NM_182596 NM_182598 NM_182640 NM_182641 NM_182646 NM_182647 NM_182682 NM_182686 NM_182734 NM_182744 NM_182752 NM_182757 NM_182760 NM_182765 NM_182767 NM_182775 NM_182779 NM_182810 NM_182830 NM_182832 NM_182848 NM_182894 NM_182896 NM_182898 NM_182899 NM_182907 NM_182911 NM_182915 NM_182918 NM_182931 NM_182932 NM_182933 NM_182936 NM_182962 NM_182970 NM_182975 NM_183002 NM_183004 NM_183010 NM_183050 NM_183065 NM_183078 NM_183079 NM_183227 NM_183228 NM_183229 NM_183230 NM_183231 NM_183232 NM_183234 NM_183235 NM_183236 NM_183244 NM_183246 NM_183376 NM_183382 NM_183398 NM_183399 NM_183400 NM_183401 NM_183414 NM_183415 NM_183416 NM_183422 NM_184231 NM_184234 NM_184237 NM_184241 NM_184244 NM_194071 NM_194252 NM_194255 NM_194272 NM_194278 NM_194283 NM_194285 NM_194286 NM_194294 NM_194300 NM_194303 NM_194309 NM_194310 NM_194314 NM_194317 NM_194319 NM_194327 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194356 NM_194358 NM_194359 NM_194430 NM_194431 NM_194439 NM_194442 NM_194447 NM_194448 NM_194450 NM_194451 NM_194454 NM_194455 NM_194456 NM_197939 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197968 NM_197970 NM_197973 NM_197976 NM_198053 NM_198056 NM_198066 NM_198076 NM_198079 NM_198087 NM_198088 NM_198120 NM_198155 NM_198157 NM_198181 NM_198194 NM_198217 NM_198218 NM_198219 NM_198225 NM_198236 NM_198240 NM_198256 NM_198257 NM_198258 NM_198268 NM_198269 NM_198270 NM_198274 NM_198287 NM_198291 NM_198309 NM_198310 NM_198325 NM_198327 NM_198328 NM_198353 NM_198391 NM_198394 NM_198395 NM_198399 NM_198401 NM_198402 NM_198404 NM_198439 NM_198440 NM_198459 NM_198460 NM_198465 NM_198474 NM_198479 NM_198480 NM_198484 NM_198488 NM_198490 NM_198504 NM_198507 NM_198510 NM_198511 NM_198525 NM_198545 NM_198549 NM_198553 NM_198562 NM_198568 NM_198569 NM_198570 NM_198586 NM_198686 NM_198694 NM_198715 NM_198723 NM_198793 NM_198833 NM_198835 NM_198843 NM_198847 NM_198850 NM_198851 NM_198859 NM_198868 NM_198889 NM_198890 NM_198896 NM_198897 NM_198900 NM_198902 NM_198904 NM_198920 NM_198935 NM_198947 NM_198968 NM_198974 NM_198989 NM_198990 NM_198991 NM_198992 NM_199003 NM_199039 NM_199040 NM_199044 NM_199045 NM_199050 NM_199071 NM_199078 NM_199139 NM_199163 NM_199169 NM_199170 NM_199171 NM_199182 NM_199188 NM_199189 NM_199190 NM_199245 NM_199265 NM_199280 NM_199283 NM_199296 NM_199329 NM_199344 NM_199345 NM_199415 NM_199423 NM_199437 NM_199438 NM_199439 NM_199443 NM_199454 NM_199461 NM_199462 NM_199483 NM_199484 NM_199485 NM_201224 NM_201269 NM_201274 NM_201278 NM_201281 NM_201348 NM_201413 NM_201414 NM_201428 NM_201429 NM_201430 NM_201436 NM_201516 NM_201517 NM_201550 NM_201552 NM_201553 NM_201559 NM_201565 NM_201568 NM_201569 NM_201574 NM_201591 NM_201592 NM_201624 NM_201649 NM_201994 NM_202002 NM_202003 NM_203282 NM_203287 NM_203290 NM_203318 NM_203329 NM_203330 NM_203331 NM_203341 NM_203344 NM_203349 NM_203351 NM_203354 NM_203355 NM_203356 NM_203357 NM_203372 NM_203390 NM_203406 NM_203425 NM_203426 NM_203436 NM_203437 NM_203438 NM_203439 NM_203440 NM_203441 NM_203444 NM_203445 NM_203446 NM_203453 NM_203457 NM_203458 NM_203463 NM_203497 NM_203499 NM_203500 NM_203506 NM_205548 NM_205768 NM_205833 NM_205842 NM_205848 NM_205857 NM_205862 NM_206594 NM_206595 NM_206824 NM_206834 NM_206835 NM_206836 NM_206839 NM_206866 NM_206876 NM_206877 NM_206892 NM_206909 NM_206914 NM_206925 NM_206926 NM_206927 NM_206928 NM_206929 NM_206930 NM_206938 NM_206939 NM_206940 NM_206953 NM_206954 NM_206955 NM_206956 NM_207005 NM_207007 NM_207012 NM_207032 NM_207033 NM_207034 NM_207035 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207111 NM_207113 NM_207116 NM_207119 NM_207123 NM_207285 NM_207289 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207306 NM_207309 NM_207325 NM_207335 NM_207337 NM_207348 NM_207370 NM_207372 NM_207376 NM_207379 NM_207390 NM_207391 NM_207394 NM_207404 NM_207405 NM_207406 NM_207411 NM_207422 NM_207428 NM_207438 NM_207443 NM_207444 NM_207445 NM_207446 NM_207451 NM_207454 NM_207462 NM_207463 NM_207470 NM_207472 NM_207474 NM_207479 NM_207484 NM_207486 NM_207488 NM_207491 NM_207495 NM_207497 NM_207498 NM_207499 NM_207501 NM_207502 NM_207504 NM_207506 NM_207513 NM_207577 NM_207585 NM_207645 NM_207660 NM_207661 NM_207662 NM_207672 NM_212464 NM_212469 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212540 NM_212556 NM_212558 NM_213589 NM_213600 NM_213602 NM_213609 NM_213612 NM_213645 NM_213646 NM_213651 NM_213720 NM_213723 NM_213724 XM_030378 XM_031104 XM_031553 XM_032571 XM_032901 XM_032945 XM_032996 XM_034274 XM_034872 XM_036936 XM_036942 XM_038436 XM_039393 XM_039515 XM_039570 XM_039676 XM_039877 XM_042066 XM_042301 XM_042698 XM_042936 XM_043493 XM_044178 XM_046581 XM_047355 XM_047357 XM_047610 XM_048592 XM_049078 XM_049237 XM_051017 XM_051081 XM_055636 XM_055866 XM_056455 XM_057107 XM_057296 XM_058332 XM_059482 XM_059689 XM_059929 XM_061890 XM_062872 XM_067585 XM_084529 XM_084852 XM_085367 XM_085634 XM_086409 XM_086761 XM_087137 XM_087490 XM_088768 XM_096885 XM_097265 XM_097351 XM_097580 XM_113743 XM_113825 XM_113947 XM_114611 XM_117117 XM_166140 XM_166320 XM_168530 XM_168578 XM_171165 XM_172801 XM_172874 XM_173140 XM_208545 XM_208847 XM_209178 XM_209429 XM_209500 XM_209569 XM_209604 XM_209607 XM_209700 XM_209824 XM_211086 XM_212061 XM_212319 XM_290546 XM_290597 XM_290615 XM_290809 XM_291016 XM_291019 XM_291020 XM_291028 XM_291095 XM_291154 XM_291344 XM_291671 XM_291729 XM_292357 XM_294521 XM_294765 XM_294993 XM_298151 XM_350880 XM_351948 XM_370603 XM_370654 XM_370833 XM_370837 XM_370839 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_370965 XM_370995 XM_371074 XM_371116 XM_371117 XM_371132 XM_371196 XM_371285 XM_371302 XM_371304 XM_371312 XM_371369 XM_371374 XM_371416 XM_371429 XM_371461 XM_371474 XM_371486 XM_371542 XM_371575 XM_371590 XM_371655 XM_371706 XM_371760 XM_371761 XM_371769 XM_371781 XM_371801 XM_371838 XM_371943 XM_372004 XM_372035 XM_372038 XM_372039 XM_372050 XM_372090 XM_372097 XM_372118 XM_372128 XM_372193 XM_372205 XM_372584 XM_372723 XM_373030 XM_373451 XM_373453 XM_373456 XM_373489 XM_373513 XM_373561 XM_373636 XM_373639 XM_373750 XM_373765 XM_373821 XM_373823 XM_373848 XM_373883 XM_373915 XM_373973 XM_374013 XM_374048 XM_374132 XM_374236 XM_374249 XM_374399 XM_374414 XM_374460 XM_374484 XM_374502 XM_374589 XM_374767 XM_374803 XM_374912 XM_374915 XM_374945 XM_374973 XM_375018 XM_375065 XM_375081 XM_375152 XM_375307 XM_375333 XM_375353 XM_375357 XM_375424 XM_375443 XM_375491 XM_375669 XM_375697 XM_375713 XM_375821 XM_375838 XM_375912 XM_376018 XM_376049 XM_376062 XM_376186 XM_376212 XM_376241 XM_376247 XM_376269 XM_376320 XM_376350 XM_376386 XM_376412 XM_376436 XM_376550 XM_376558 XM_376560 XM_376567 XM_376587 XM_376602 XM_376607 XM_376677 XM_376680 XM_376720 XM_376727 XM_376784 XM_376795 XM_376869 XM_376902 XM_376905 XM_377002 XM_377028 XM_378178 XM_378203 XM_378223 XM_378240 XM_378250 XM_378259 XM_378272 XM_378273 XM_378279 XM_378299 XM_378301 XM_378329 XM_378350 XM_378362 XM_378368 XM_378389 XM_378390 XM_378392 XM_378394 XM_378430 XM_378434 XM_378454 XM_378472 XM_378506 XM_378507 XM_378516 XM_378517 XM_378542 XM_378550 XM_378573 XM_378606 XM_378608 XM_378620 XM_378625 XM_378639 XM_378650 XM_378655 XM_378661 XM_378667 XM_378678 XM_378686 XM_378692 XM_378698 XM_378703 XM_378706 XM_378708 XM_378712 XM_378735 XM_378738 XM_378746 XM_378777 XM_378786 XM_378787 XM_378791 XM_378795 XM_378799 XM_378843 XM_378866 XM_378876 XM_378879 XM_378914 XM_378921 XM_378973 XM_378982 XM_378983 XM_378985 XM_379060 XM_379075 XM_379100 XM_379106 XM_379114 XM_379118 XM_379141 XM_379146 XM_379163 XM_379171 XM_379204 XM_379207 XM_379215 XM_379231 XM_379267 XM_379276 XM_379280 XM_379295 XM_379306 XM_379309 XM_379318 XM_379322 XM_379339 XM_379355 XM_379373 XM_379391 XM_379395 XM_379398 XM_379402 XM_379417 XM_379434 XM_379437 XM_379438 XM_379452 XM_379454 XM_379456 XM_379458 XM_379482 XM_379498 XM_379510 XM_379534 XM_379535 XM_379582 XM_379594 XM_379595 XM_379637 XM_379639 XM_379650 XM_379668 XM_379684 XM_379702 XM_379720 XM_379722 XM_379730 XM_379774 XM_379820 XM_379827 XM_379840 XM_379858 XM_379927 XM_379931 XM_379934 XM_379967 XM_379979 XM_380098 XM_380103 XM_380117 XM_380131 XM_380159 XM_380160 XM_495798 XM_495803 XM_495844 XM_495874 XM_495886 XM_495888 XM_495890 XM_495891 XM_495950 XM_495961 XM_495970 XM_496054 XM_496070 XM_496076 XM_496081 XM_496088 XM_496103 XM_496134 XM_496156 XM_496227 XM_496268 XM_496299 XM_496328 XM_496351 XM_496405 XM_496434 XM_496436 XM_496467 XM_496519 XM_496539 XM_496549 XM_496575 XM_496608 XM_496622 XM_496650 XM_496726 XM_496793 XM_496844 XM_496873 XM_496879 XM_496892 XM_496894 XM_496898 XM_496899 XM_496901 XM_496905 XM_496907 XM_496912 XM_496965 XM_496976 XM_496981 XM_496983 XM_496984 XM_496985 XM_497000 XM_497080 XM_497134 XM_497185 XM_498429 XM_498441 XM_498445 XM_498452 XM_498454 XM_498457 XM_498460 XM_498467 XM_498473 XM_498478 XM_498490 XM_498494 XM_498507 XM_498516 XM_498534 XM_498537 XM_498540 XM_498545 XM_498546 XM_498555 XM_498589 XM_498611 XM_498646 XM_498655 XM_498662 XM_498683 XM_498704 XM_498723 XM_498724 XM_498739 XM_498761 XM_498802 XM_498804 XM_498826 XM_498829 XM_498841 XM_498849 XM_498861 XM_498862 XM_498883 XM_498884 XM_498901 XM_498902 XM_498933 XM_498935 XM_498944 XM_498949 XM_498962 XM_499039 XM_499046 XM_499047 XM_499048 XM_499051 XM_499057 XM_499093 XM_499102 XM_499122 XM_499125 XM_499130 XM_499140 XM_499147 XM_499152 XM_499165 XM_499170 XM_499288 XM_499298 XM_499309 XM_499314 XM_499317 XM_499321 XM_499328 XM_499330 XM_499333 XM_499338 XM_499343 XM_499348 XM_499354 XM_499356 XM_499362 XM_499363 XM_499392 XM_499495 XM_499502 XM_499505 XM_499514 XM_499558 XM_499571 XM_499575 XM_499583 XM_499586 XM_499590 XM_499597 XM_499602 XR_000190 XR_000192 XR_000194 XR_000195 XR_000217 XR_000227 XR_000265 XR_000266 XR_000272
Genes with multiple seed matches:
NM_000087 NM_000091 NM_000125 NM_000138 NM_000189 NM_000192 NM_000199 NM_000216 NM_000240 NM_000246 NM_000250 NM_000299 NM_000332 NM_000368 NM_000428 NM_000430 NM_000450 NM_000462 NM_000476 NM_000497 NM_000503 NM_000555 NM_000599 NM_000610 NM_000614 NM_000632 NM_000633 NM_000634 NM_000664 NM_000693 NM_000749 NM_000793 NM_000814 NM_000838 NM_000849 NM_000861 NM_000899 NM_000913 NM_000944 NM_000959 NM_000961 NM_000963 NM_000991 NM_000997 NM_001001323 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001549 NM_001001550 NM_001001555 NM_001001669 NM_001001698 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001002257 NM_001002881 NM_001002926 NM_001003407 NM_001003408 NM_001003674 NM_001003675 NM_001003679 NM_001003716 NM_001004285 NM_001004286 NM_001004356 NM_001004358 NM_001005337 NM_001005340 NM_001005387 NM_001005404 NM_001005473 NM_001005753 NM_001006600 NM_001006603 NM_001006932 NM_001007023 NM_001007024 NM_001007025 NM_001007246 NM_001007247 NM_001007248 NM_001007535 NM_001008211 NM_001008212 NM_001008213 NM_001008226 NM_001008239 NM_001008396 NM_001008407 NM_001008408 NM_001008493 NM_001008494 NM_001008564 NM_001008781 NM_001009612 NM_001009899 NM_001009913 NM_001010000 NM_001010854 NM_001010879 NM_001010888 NM_001010891 NM_001010898 NM_001010903 NM_001010913 NM_001010917 NM_001010934 NM_001010986 NM_001011513 NM_001011514 NM_001011552 NM_001011666 NM_001011720 NM_001012267 NM_001012329 NM_001012420 NM_001012423 NM_001012452 NM_001012626 NM_001012651 NM_001012733 NM_001012734 NM_001012754 NM_001012979 NM_001013438 NM_001013439 NM_001013629 NM_001013635 NM_001013677 NM_001013680 NM_001013681 NM_001013682 NM_001013704 NM_001014374 NM_001017370 NM_001017440 NM_001017916 NM_001017917 NM_001017918 NM_001017919 NM_001017980 NM_001017998 NM_001018021 NM_001018065 NM_001018066 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001023563 NM_001023565 NM_001023567 NM_001024372 NM_001024843 NM_001024845 NM_001025077 NM_001025079 NM_001025080 NM_001025108 NM_001025252 NM_001025253 NM_001071 NM_001080 NM_001123 NM_001198 NM_001204 NM_001218 NM_001259 NM_001271 NM_001286 NM_001394 NM_001406 NM_001419 NM_001432 NM_001438 NM_001458 NM_001470 NM_001497 NM_001650 NM_001654 NM_001682 NM_001684 NM_001767 NM_001777 NM_001781 NM_001798 NM_001826 NM_001915 NM_001935 NM_001949 NM_001969 NM_001980 NM_001982 NM_001987 NM_001999 NM_002006 NM_002015 NM_002025 NM_002026 NM_002039 NM_002063 NM_002099 NM_002108 NM_002111 NM_002126 NM_002221 NM_002239 NM_002285 NM_002304 NM_002313 NM_002340 NM_002375 NM_002376 NM_002449 NM_002481 NM_002510 NM_002547 NM_002577 NM_002604 NM_002612 NM_002627 NM_002631 NM_002640 NM_002677 NM_002702 NM_002709 NM_002738 NM_002745 NM_002755 NM_002827 NM_002876 NM_002877 NM_002891 NM_002919 NM_002928 NM_002957 NM_002959 NM_003003 NM_003010 NM_003014 NM_003016 NM_003024 NM_003026 NM_003038 NM_003052 NM_003081 NM_003112 NM_003139 NM_003152 NM_003178 NM_003274 NM_003325 NM_003417 NM_003458 NM_003463 NM_003565 NM_003580 NM_003590 NM_003615 NM_003629 NM_003633 NM_003643 NM_003681 NM_003713 NM_003759 NM_003846 NM_003888 NM_003898 NM_003909 NM_003926 NM_003929 NM_003939 NM_003943 NM_003994 NM_004028 NM_004050 NM_004090 NM_004093 NM_004125 NM_004170 NM_004171 NM_004263 NM_004273 NM_004302 NM_004311 NM_004338 NM_004342 NM_004384 NM_004386 NM_004392 NM_004438 NM_004449 NM_004459 NM_004464 NM_004485 NM_004505 NM_004566 NM_004571 NM_004586 NM_004588 NM_004603 NM_004612 NM_004613 NM_004622 NM_004624 NM_004645 NM_004660 NM_004711 NM_004738 NM_004745 NM_004776 NM_004840 NM_004845 NM_004863 NM_004866 NM_004871 NM_004898 NM_004904 NM_005036 NM_005075 NM_005079 NM_005081 NM_005087 NM_005093 NM_005100 NM_005109 NM_005156 NM_005188 NM_005207 NM_005219 NM_005257 NM_005311 NM_005358 NM_005399 NM_005578 NM_005638 NM_005658 NM_005665 NM_005670 NM_005683 NM_005725 NM_005730 NM_005779 NM_005789 NM_005819 NM_005828 NM_005829 NM_005840 NM_005842 NM_005902 NM_005935 NM_005938 NM_005943 NM_005984 NM_006007 NM_006033 NM_006055 NM_006067 NM_006106 NM_006141 NM_006201 NM_006281 NM_006282 NM_006306 NM_006313 NM_006315 NM_006371 NM_006373 NM_006387 NM_006390 NM_006407 NM_006418 NM_006457 NM_006464 NM_006485 NM_006504 NM_006520 NM_006526 NM_006557 NM_006572 NM_006599 NM_006606 NM_006620 NM_006628 NM_006643 NM_006667 NM_006699 NM_006720 NM_006721 NM_006731 NM_006734 NM_006738 NM_006742 NM_006803 NM_006822 NM_006888 NM_006926 NM_006931 NM_006934 NM_006995 NM_006996 NM_007007 NM_007038 NM_007050 NM_007086 NM_007122 NM_007123 NM_007175 NM_007189 NM_007200 NM_007203 NM_007218 NM_007249 NM_007257 NM_007371 NM_007372 NM_007373 NM_009586 NM_012096 NM_012160 NM_012174 NM_012231 NM_012249 NM_012320 NM_012398 NM_012409 NM_012425 NM_012448 NM_012464 NM_012479 NM_013232 NM_013255 NM_013281 NM_013286 NM_013322 NM_013375 NM_013447 NM_013989 NM_013995 NM_014011 NM_014028 NM_014048 NM_014050 NM_014079 NM_014089 NM_014112 NM_014231 NM_014243 NM_014283 NM_014382 NM_014504 NM_014553 NM_014574 NM_014615 NM_014631 NM_014682 NM_014686 NM_014702 NM_014706 NM_014732 NM_014734 NM_014737 NM_014743 NM_014746 NM_014747 NM_014755 NM_014765 NM_014766 NM_014767 NM_014776 NM_014784 NM_014786 NM_014787 NM_014813 NM_014819 NM_014820 NM_014824 NM_014829 NM_014844 NM_014860 NM_014873 NM_014897 NM_014903 NM_014905 NM_014906 NM_014912 NM_014919 NM_014920 NM_014934 NM_014942 NM_014950 NM_014974 NM_014997 NM_015003 NM_015032 NM_015035 NM_015040 NM_015051 NM_015055 NM_015065 NM_015071 NM_015076 NM_015084 NM_015088 NM_015092 NM_015148 NM_015149 NM_015163 NM_015192 NM_015205 NM_015206 NM_015215 NM_015225 NM_015226 NM_015246 NM_015254 NM_015266 NM_015282 NM_015286 NM_015288 NM_015310 NM_015313 NM_015315 NM_015328 NM_015329 NM_015340 NM_015345 NM_015347 NM_015353 NM_015385 NM_015417 NM_015432 NM_015438 NM_015458 NM_015532 NM_015553 NM_015554 NM_015564 NM_015569 NM_015576 NM_015691 NM_015967 NM_016018 NM_016034 NM_016061 NM_016079 NM_016083 NM_016114 NM_016131 NM_016132 NM_016173 NM_016201 NM_016206 NM_016210 NM_016227 NM_016240 NM_016257 NM_016275 NM_016282 NM_016322 NM_016338 NM_016376 NM_016436 NM_016442 NM_016458 NM_016474 NM_016513 NM_016540 NM_016577 NM_016583 NM_016652 NM_016830 NM_016936 NM_016946 NM_017415 NM_017424 NM_017526 NM_017554 NM_017586 NM_017607 NM_017623 NM_017629 NM_017645 NM_017778 NM_017779 NM_017811 NM_017905 NM_017928 NM_017944 NM_017966 NM_018013 NM_018057 NM_018086 NM_018098 NM_018108 NM_018178 NM_018184 NM_018209 NM_018211 NM_018212 NM_018247 NM_018254 NM_018304 NM_018330 NM_018342 NM_018361 NM_018374 NM_018388 NM_018425 NM_018439 NM_018440 NM_018555 NM_018650 NM_018652 NM_018689 NM_018695 NM_018715 NM_018836 NM_018841 NM_018847 NM_018963 NM_018999 NM_019001 NM_019012 NM_019027 NM_019094 NM_019555 NM_020038 NM_020133 NM_020179 NM_020182 NM_020207 NM_020208 NM_020215 NM_020248 NM_020337 NM_020390 NM_020421 NM_020431 NM_020440 NM_020448 NM_020451 NM_020465 NM_020467 NM_020647 NM_020648 NM_020657 NM_020673 NM_020675 NM_020702 NM_020708 NM_020715 NM_020768 NM_020771 NM_020772 NM_020782 NM_020783 NM_020795 NM_020807 NM_020825 NM_020850 NM_020936 NM_020956 NM_021038 NM_021083 NM_021116 NM_021132 NM_021135 NM_021161 NM_021190 NM_021629 NM_021648 NM_021735 NM_021736 NM_021737 NM_021813 NM_021815 NM_021903 NM_021904 NM_021905 NM_021912 NM_021923 NM_021945 NM_021957 NM_021961 NM_021977 NM_021980 NM_022106 NM_022143 NM_022170 NM_022308 NM_022343 NM_022405 NM_022444 NM_022469 NM_022473 NM_022474 NM_022482 NM_022491 NM_022726 NM_022737 NM_022758 NM_022831 NM_022842 NM_022893 NM_022910 NM_022912 NM_023032 NM_023914 NM_023923 NM_024021 NM_024294 NM_024501 NM_024512 NM_024551 NM_024611 NM_024614 NM_024620 NM_024627 NM_024665 NM_024738 NM_024761 NM_024812 NM_024841 NM_024847 NM_024854 NM_024861 NM_024866 NM_024896 NM_024946 NM_025160 NM_025187 NM_025201 NM_030623 NM_030764 NM_030774 NM_030806 NM_030817 NM_030884 NM_030918 NM_031211 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031418 NM_031448 NM_031459 NM_031463 NM_031468 NM_031469 NM_031484 NM_031490 NM_031954 NM_031992 NM_032105 NM_032139 NM_032153 NM_032174 NM_032189 NM_032268 NM_032289 NM_032295 NM_032373 NM_032440 NM_032446 NM_032449 NM_032464 NM_032515 NM_032552 NM_032554 NM_032557 NM_032578 NM_032579 NM_032710 NM_032735 NM_032783 NM_032797 NM_032833 NM_032859 NM_032871 NM_032933 NM_032968 NM_032969 NM_032973 NM_033018 NM_033083 NM_033092 NM_033109 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033181 NM_033285 NM_033346 NM_033364 NM_033389 NM_033439 NM_033505 NM_033544 NM_033551 NM_033637 NM_052822 NM_052827 NM_052851 NM_052906 NM_052941 NM_052954 NM_052958 NM_052978 NM_053023 NM_057158 NM_057169 NM_057170 NM_080717 NM_080730 NM_080731 NM_080759 NM_080760 NM_080872 NM_080928 NM_130435 NM_130809 NM_130811 NM_130838 NM_130839 NM_130847 NM_130852 NM_133170 NM_133265 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133444 NM_133477 NM_138317 NM_138318 NM_138322 NM_138347 NM_138434 NM_138450 NM_138473 NM_138706 NM_138713 NM_138714 NM_138782 NM_139028 NM_139168 NM_144497 NM_144502 NM_144503 NM_144504 NM_144567 NM_144635 NM_144717 NM_144767 NM_144949 NM_145055 NM_145058 NM_145177 NM_145206 NM_145284 NM_145307 NM_145693 NM_145728 NM_145809 NM_146388 NM_147131 NM_147132 NM_147160 NM_148975 NM_152222 NM_152253 NM_152261 NM_152292 NM_152374 NM_152383 NM_152414 NM_152433 NM_152446 NM_152583 NM_152609 NM_152641 NM_152678 NM_152680 NM_152695 NM_152723 NM_152724 NM_152758 NM_152774 NM_152776 NM_152835 NM_152890 NM_152903 NM_152906 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152999 NM_153035 NM_153263 NM_153348 NM_153370 NM_153456 NM_153487 NM_153646 NM_153647 NM_153648 NM_153815 NM_170696 NM_170697 NM_170716 NM_170740 NM_170768 NM_170773 NM_170774 NM_172058 NM_172059 NM_172060 NM_172177 NM_172178 NM_172240 NM_173079 NM_173214 NM_173463 NM_173484 NM_173505 NM_173551 NM_173576 NM_173578 NM_173580 NM_173588 NM_173643 NM_173677 NM_173688 NM_173694 NM_173801 NM_173829 NM_173851 NM_174911 NM_175609 NM_175852 NM_175864 NM_175872 NM_175876 NM_175908 NM_176863 NM_176894 NM_177405 NM_177414 NM_177453 NM_178006 NM_178007 NM_178151 NM_178152 NM_178153 NM_178505 NM_178514 NM_178566 NM_178832 NM_181076 NM_181077 NM_181358 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181504 NM_181523 NM_181524 NM_181531 NM_181704 NM_181776 NM_181847 NM_182484 NM_182485 NM_182509 NM_182540 NM_182551 NM_182565 NM_182568 NM_182596 NM_182641 NM_182646 NM_182647 NM_182686 NM_182734 NM_182752 NM_182760 NM_182898 NM_182899 NM_182907 NM_182918 NM_183004 NM_183050 NM_183376 NM_194071 NM_194285 NM_194286 NM_194294 NM_194303 NM_194309 NM_194317 NM_194356 NM_197941 NM_198236 NM_198268 NM_198269 NM_198270 NM_198274 NM_198391 NM_198394 NM_198401 NM_198439 NM_198465 NM_198545 NM_198562 NM_198686 NM_198715 NM_198793 NM_198833 NM_198835 NM_198968 NM_198990 NM_199040 NM_199044 NM_199050 NM_199078 NM_199169 NM_199170 NM_199171 NM_199182 NM_199245 NM_199265 NM_199280 NM_199296 NM_201649 NM_201994 NM_203439 NM_203453 NM_203458 NM_203463 NM_203499 NM_205833 NM_205857 NM_206594 NM_206595 NM_206876 NM_206877 NM_206892 NM_206909 NM_206925 NM_206926 NM_207005 NM_207032 NM_207033 NM_207034 NM_207035 NM_207113 NM_207123 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207335 NM_207391 NM_207405 NM_207474 NM_207484 NM_207491 NM_207497 NM_207506 NM_212464 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212556 NM_213589 NM_213723 XM_031553 XM_032571 XM_032996 XM_036936 XM_036942 XM_039877 XM_042301 XM_042698 XM_044178 XM_047355 XM_048592 XM_049237 XM_056455 XM_067585 XM_084529 XM_097351 XM_113743 XM_113947 XM_168530 XM_172874 XM_208847 XM_209607 XM_209700 XM_209824 XM_290546 XM_291095 XM_291671 XM_292357 XM_351948 XM_370654 XM_370837 XM_370843 XM_370876 XM_370878 XM_370917 XM_370995 XM_371312 XM_371429 XM_371461 XM_371486 XM_371760 XM_371801 XM_371838 XM_372038 XM_372097 XM_372584 XM_373513 XM_373561 XM_373639 XM_373848 XM_374399 XM_374414 XM_374484 XM_374803 XM_374915 XM_375065 XM_375152 XM_375307 XM_375491 XM_375697 XM_376018 XM_376062 XM_376269 XM_376412 XM_376436 XM_376558 XM_376560 XM_376587 XM_376795 XM_376869 XM_378203 XM_378240 XM_378279 XM_378301 XM_378389 XM_378661 XM_378678 XM_378708 XM_378795 XM_378843 XM_378921 XM_379060 XM_379075 XM_379100 XM_379114 XM_379141 XM_379267 XM_379438 XM_379452 XM_379456 XM_379458 XM_379650 XM_379702 XM_379722 XM_495803 XM_495886 XM_495888 XM_495950 XM_496054 XM_496070 XM_496076 XM_496519 XM_497080 XM_498452 XM_498454 XM_498467 XM_498507 XM_498534 XM_498545 XM_498683 XM_498829 XM_498861 XM_498862 XM_498902 XM_499046 XM_499047 XM_499048 XM_499051 XM_499125 XM_499309 XM_499502 XM_499583 XM_499597 XM_499602 XR_000190 XR_000195 XR_000227
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)