VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"caguccccaaccuccaaucacu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
4784
.
Total Genes with multiple seed matches:
1011
.
Genes with at least one seed match:
NM_000028 NM_000038 NM_000046 NM_000049 NM_000051 NM_000071 NM_000079 NM_000084 NM_000088 NM_000093 NM_000097 NM_000104 NM_000112 NM_000115 NM_000126 NM_000133 NM_000139 NM_000140 NM_000150 NM_000151 NM_000163 NM_000165 NM_000170 NM_000188 NM_000189 NM_000211 NM_000212 NM_000214 NM_000218 NM_000219 NM_000222 NM_000231 NM_000232 NM_000239 NM_000240 NM_000242 NM_000245 NM_000254 NM_000270 NM_000272 NM_000275 NM_000276 NM_000282 NM_000283 NM_000288 NM_000297 NM_000313 NM_000317 NM_000318 NM_000320 NM_000321 NM_000329 NM_000332 NM_000333 NM_000335 NM_000337 NM_000349 NM_000351 NM_000352 NM_000360 NM_000367 NM_000368 NM_000373 NM_000383 NM_000388 NM_000391 NM_000393 NM_000395 NM_000397 NM_000398 NM_000399 NM_000408 NM_000409 NM_000410 NM_000411 NM_000430 NM_000434 NM_000437 NM_000439 NM_000448 NM_000449 NM_000450 NM_000451 NM_000454 NM_000462 NM_000466 NM_000477 NM_000480 NM_000489 NM_000492 NM_000495 NM_000511 NM_000516 NM_000529 NM_000547 NM_000550 NM_000551 NM_000554 NM_000555 NM_000557 NM_000560 NM_000574 NM_000611 NM_000614 NM_000616 NM_000617 NM_000618 NM_000620 NM_000623 NM_000625 NM_000627 NM_000629 NM_000632 NM_000635 NM_000637 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000647 NM_000663 NM_000664 NM_000670 NM_000681 NM_000682 NM_000694 NM_000696 NM_000698 NM_000702 NM_000706 NM_000728 NM_000729 NM_000743 NM_000747 NM_000786 NM_000787 NM_000791 NM_000792 NM_000793 NM_000806 NM_000809 NM_000814 NM_000821 NM_000828 NM_000838 NM_000843 NM_000845 NM_000849 NM_000853 NM_000859 NM_000868 NM_000869 NM_000877 NM_000878 NM_000890 NM_000891 NM_000896 NM_000898 NM_000899 NM_000901 NM_000903 NM_000908 NM_000910 NM_000913 NM_000916 NM_000919 NM_000921 NM_000923 NM_000935 NM_000947 NM_000950 NM_000957 NM_000963 NM_000965 NM_000997 NM_000998 NM_001001323 NM_001001343 NM_001001394 NM_001001395 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001438 NM_001001502 NM_001001503 NM_001001557 NM_001001661 NM_001001662 NM_001001664 NM_001001675 NM_001001677 NM_001001679 NM_001001681 NM_001001684 NM_001001685 NM_001001687 NM_001001690 NM_001001691 NM_001001693 NM_001001695 NM_001001698 NM_001001702 NM_001001703 NM_001001704 NM_001001706 NM_001001707 NM_001001709 NM_001001873 NM_001001890 NM_001001928 NM_001001929 NM_001001930 NM_001001935 NM_001001937 NM_001001938 NM_001001976 NM_001002021 NM_001002032 NM_001002033 NM_001002034 NM_001002233 NM_001002265 NM_001002266 NM_001002799 NM_001002800 NM_001002814 NM_001002838 NM_001002847 NM_001002860 NM_001002914 NM_001003407 NM_001003408 NM_001003665 NM_001003679 NM_001003681 NM_001003690 NM_001003712 NM_001003794 NM_001003800 NM_001003812 NM_001004126 NM_001004297 NM_001004299 NM_001004300 NM_001004301 NM_001004308 NM_001004314 NM_001004317 NM_001004322 NM_001004326 NM_001004328 NM_001004336 NM_001004349 NM_001004360 NM_001004440 NM_001004441 NM_001005303 NM_001005373 NM_001005374 NM_001005375 NM_001005387 NM_001005388 NM_001005404 NM_001005409 NM_001005463 NM_001005473 NM_001005474 NM_001005505 NM_001005609 NM_001005736 NM_001005737 NM_001005766 NM_001005785 NM_001005786 NM_001006116 NM_001006606 NM_001006610 NM_001006615 NM_001006623 NM_001006639 NM_001006640 NM_001006655 NM_001006657 NM_001006658 NM_001006932 NM_001007023 NM_001007024 NM_001007025 NM_001007067 NM_001007068 NM_001007069 NM_001007070 NM_001007094 NM_001007156 NM_001007169 NM_001007188 NM_001007214 NM_001007224 NM_001007243 NM_001007247 NM_001007248 NM_001007250 NM_001007257 NM_001007267 NM_001007271 NM_001007274 NM_001007275 NM_001007466 NM_001007525 NM_001007536 NM_001007545 NM_001008211 NM_001008212 NM_001008213 NM_001008215 NM_001008224 NM_001008226 NM_001008228 NM_001008229 NM_001008239 NM_001008388 NM_001008390 NM_001008396 NM_001008401 NM_001008406 NM_001008409 NM_001008410 NM_001008493 NM_001008536 NM_001008537 NM_001008539 NM_001008540 NM_001008541 NM_001008564 NM_001008693 NM_001008699 NM_001008707 NM_001008745 NM_001008756 NM_001008777 NM_001008781 NM_001008801 NM_001008860 NM_001008892 NM_001008894 NM_001008910 NM_001008917 NM_001008925 NM_001009181 NM_001009185 NM_001009555 NM_001009571 NM_001009584 NM_001009880 NM_001009922 NM_001009932 NM_001009933 NM_001009934 NM_001009956 NM_001009960 NM_001010000 NM_001010846 NM_001010851 NM_001010853 NM_001010856 NM_001010861 NM_001010867 NM_001010871 NM_001010877 NM_001010882 NM_001010883 NM_001010913 NM_001010914 NM_001010915 NM_001010938 NM_001010942 NM_001010980 NM_001010986 NM_001011513 NM_001011514 NM_001011554 NM_001011664 NM_001011666 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011705 NM_001011720 NM_001011885 NM_001012239 NM_001012278 NM_001012279 NM_001012320 NM_001012361 NM_001012398 NM_001012410 NM_001012412 NM_001012420 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012452 NM_001012503 NM_001012511 NM_001012515 NM_001012626 NM_001012651 NM_001012659 NM_001012665 NM_001012707 NM_001012709 NM_001012714 NM_001012717 NM_001012729 NM_001012732 NM_001012753 NM_001012755 NM_001012756 NM_001012763 NM_001012961 NM_001012977 NM_001012981 NM_001012982 NM_001012986 NM_001012987 NM_001012988 NM_001013000 NM_001013005 NM_001013257 NM_001013403 NM_001013406 NM_001013415 NM_001013629 NM_001013634 NM_001013644 NM_001013645 NM_001013650 NM_001013651 NM_001013655 NM_001013656 NM_001013659 NM_001013673 NM_001013675 NM_001013678 NM_001013681 NM_001013682 NM_001013685 NM_001013687 NM_001013696 NM_001013697 NM_001013701 NM_001013702 NM_001013713 NM_001013717 NM_001013718 NM_001013721 NM_001013724 NM_001013746 NM_001014380 NM_001014797 NM_001014809 NM_001015045 NM_001015877 NM_001015883 NM_001015886 NM_001015891 NM_001017368 NM_001017371 NM_001017372 NM_001017392 NM_001017396 NM_001017434 NM_001017924 NM_001017926 NM_001017929 NM_001017930 NM_001017961 NM_001017967 NM_001017970 NM_001017992 NM_001017995 NM_001017998 NM_001018008 NM_001018025 NM_001018029 NM_001018041 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018056 NM_001018057 NM_001018058 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018071 NM_001018081 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018100 NM_001018101 NM_001018102 NM_001018111 NM_001018116 NM_001023563 NM_001023567 NM_001024 NM_001024372 NM_001024380 NM_001024381 NM_001024401 NM_001024463 NM_001024657 NM_001024660 NM_001024676 NM_001024680 NM_001024733 NM_001024843 NM_001024847 NM_001024855 NM_001024912 NM_001024933 NM_001024947 NM_001024948 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025100 NM_001025105 NM_001025107 NM_001025108 NM_001025233 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001034 NM_001035 NM_001046 NM_001049 NM_001050 NM_001056 NM_001058 NM_001080 NM_001083 NM_001089 NM_001093 NM_001094 NM_001095 NM_001103 NM_001105 NM_001111 NM_001112 NM_001116 NM_001119 NM_001121 NM_001123 NM_001127 NM_001142 NM_001143 NM_001148 NM_001149 NM_001153 NM_001156 NM_001167 NM_001174 NM_001177 NM_001185 NM_001198 NM_001204 NM_001206 NM_001218 NM_001219 NM_001222 NM_001226 NM_001227 NM_001230 NM_001231 NM_001232 NM_001233 NM_001237 NM_001241 NM_001259 NM_001268 NM_001271 NM_001286 NM_001303 NM_001313 NM_001316 NM_001325 NM_001329 NM_001351 NM_001360 NM_001378 NM_001383 NM_001390 NM_001396 NM_001399 NM_001401 NM_001406 NM_001419 NM_001420 NM_001422 NM_001430 NM_001432 NM_001448 NM_001457 NM_001468 NM_001481 NM_001483 NM_001490 NM_001497 NM_001498 NM_001500 NM_001503 NM_001521 NM_001526 NM_001532 NM_001545 NM_001546 NM_001547 NM_001548 NM_001555 NM_001557 NM_001559 NM_001562 NM_001570 NM_001587 NM_001609 NM_001621 NM_001624 NM_001627 NM_001632 NM_001636 NM_001638 NM_001641 NM_001650 NM_001668 NM_001678 NM_001682 NM_001690 NM_001712 NM_001713 NM_001717 NM_001741 NM_001742 NM_001748 NM_001753 NM_001754 NM_001759 NM_001775 NM_001789 NM_001796 NM_001804 NM_001814 NM_001830 NM_001845 NM_001846 NM_001851 NM_001854 NM_001858 NM_001859 NM_001860 NM_001877 NM_001892 NM_001904 NM_001908 NM_001913 NM_001921 NM_001942 NM_001946 NM_001952 NM_001954 NM_001957 NM_001963 NM_001981 NM_001984 NM_001991 NM_002006 NM_002015 NM_002017 NM_002032 NM_002033 NM_002056 NM_002063 NM_002064 NM_002073 NM_002077 NM_002092 NM_002095 NM_002111 NM_002119 NM_002127 NM_002128 NM_002139 NM_002156 NM_002158 NM_002166 NM_002177 NM_002182 NM_002190 NM_002192 NM_002210 NM_002222 NM_002228 NM_002235 NM_002239 NM_002241 NM_002251 NM_002254 NM_002255 NM_002265 NM_002268 NM_002285 NM_002291 NM_002309 NM_002313 NM_002340 NM_002353 NM_002364 NM_002367 NM_002402 NM_002408 NM_002414 NM_002416 NM_002429 NM_002433 NM_002467 NM_002473 NM_002474 NM_002483 NM_002487 NM_002500 NM_002504 NM_002514 NM_002519 NM_002538 NM_002547 NM_002552 NM_002556 NM_002562 NM_002577 NM_002581 NM_002589 NM_002590 NM_002609 NM_002610 NM_002612 NM_002626 NM_002634 NM_002637 NM_002639 NM_002640 NM_002641 NM_002644 NM_002655 NM_002656 NM_002657 NM_002667 NM_002670 NM_002698 NM_002703 NM_002704 NM_002709 NM_002711 NM_002717 NM_002719 NM_002725 NM_002737 NM_002740 NM_002758 NM_002760 NM_002765 NM_002780 NM_002781 NM_002816 NM_002822 NM_002825 NM_002827 NM_002829 NM_002833 NM_002842 NM_002847 NM_002857 NM_002858 NM_002867 NM_002875 NM_002879 NM_002886 NM_002888 NM_002906 NM_002918 NM_002937 NM_002938 NM_002940 NM_002941 NM_002986 NM_002990 NM_002993 NM_002994 NM_002999 NM_003002 NM_003003 NM_003004 NM_003012 NM_003014 NM_003029 NM_003031 NM_003036 NM_003038 NM_003046 NM_003051 NM_003060 NM_003084 NM_003085 NM_003101 NM_003108 NM_003111 NM_003118 NM_003121 NM_003137 NM_003139 NM_003144 NM_003149 NM_003154 NM_003159 NM_003161 NM_003177 NM_003180 NM_003183 NM_003189 NM_003202 NM_003203 NM_003205 NM_003215 NM_003227 NM_003236 NM_003239 NM_003242 NM_003262 NM_003266 NM_003281 NM_003288 NM_003296 NM_003304 NM_003311 NM_003328 NM_003338 NM_003342 NM_003347 NM_003349 NM_003362 NM_003369 NM_003373 NM_003374 NM_003379 NM_003381 NM_003383 NM_003390 NM_003404 NM_003405 NM_003406 NM_003409 NM_003419 NM_003421 NM_003423 NM_003431 NM_003433 NM_003436 NM_003439 NM_003444 NM_003445 NM_003450 NM_003463 NM_003467 NM_003471 NM_003473 NM_003474 NM_003478 NM_003483 NM_003484 NM_003489 NM_003496 NM_003506 NM_003511 NM_003528 NM_003558 NM_003565 NM_003574 NM_003575 NM_003576 NM_003597 NM_003601 NM_003605 NM_003609 NM_003617 NM_003618 NM_003622 NM_003629 NM_003630 NM_003631 NM_003633 NM_003640 NM_003644 NM_003649 NM_003654 NM_003663 NM_003666 NM_003668 NM_003671 NM_003672 NM_003676 NM_003679 NM_003684 NM_003687 NM_003691 NM_003705 NM_003706 NM_003713 NM_003719 NM_003728 NM_003733 NM_003734 NM_003757 NM_003758 NM_003760 NM_003763 NM_003764 NM_003774 NM_003777 NM_003783 NM_003805 NM_003822 NM_003824 NM_003831 NM_003837 NM_003838 NM_003848 NM_003850 NM_003851 NM_003855 NM_003856 NM_003873 NM_003898 NM_003908 NM_003909 NM_003918 NM_003929 NM_003933 NM_003939 NM_003941 NM_003945 NM_003947 NM_003951 NM_003953 NM_003955 NM_003981 NM_003983 NM_003991 NM_003994 NM_003998 NM_004028 NM_004032 NM_004034 NM_004035 NM_004046 NM_004054 NM_004060 NM_004061 NM_004064 NM_004080 NM_004081 NM_004090 NM_004091 NM_004099 NM_004101 NM_004124 NM_004125 NM_004133 NM_004155 NM_004162 NM_004171 NM_004177 NM_004184 NM_004210 NM_004216 NM_004227 NM_004229 NM_004232 NM_004262 NM_004267 NM_004270 NM_004271 NM_004272 NM_004282 NM_004285 NM_004287 NM_004290 NM_004291 NM_004293 NM_004296 NM_004300 NM_004302 NM_004315 NM_004329 NM_004336 NM_004337 NM_004342 NM_004356 NM_004360 NM_004362 NM_004370 NM_004380 NM_004407 NM_004412 NM_004414 NM_004426 NM_004434 NM_004437 NM_004440 NM_004444 NM_004449 NM_004454 NM_004455 NM_004464 NM_004475 NM_004481 NM_004487 NM_004488 NM_004499 NM_004503 NM_004504 NM_004505 NM_004513 NM_004514 NM_004518 NM_004523 NM_004536 NM_004539 NM_004554 NM_004560 NM_004570 NM_004571 NM_004586 NM_004595 NM_004598 NM_004606 NM_004612 NM_004613 NM_004620 NM_004626 NM_004627 NM_004650 NM_004655 NM_004660 NM_004664 NM_004687 NM_004703 NM_004705 NM_004707 NM_004711 NM_004727 NM_004731 NM_004734 NM_004736 NM_004741 NM_004744 NM_004766 NM_004772 NM_004775 NM_004776 NM_004778 NM_004780 NM_004781 NM_004782 NM_004795 NM_004797 NM_004798 NM_004804 NM_004811 NM_004816 NM_004820 NM_004824 NM_004826 NM_004827 NM_004840 NM_004842 NM_004856 NM_004863 NM_004866 NM_004869 NM_004871 NM_004872 NM_004878 NM_004891 NM_004904 NM_004907 NM_004912 NM_004915 NM_004921 NM_004924 NM_004926 NM_004947 NM_004949 NM_004953 NM_004956 NM_004983 NM_004985 NM_004992 NM_004999 NM_005027 NM_005032 NM_005036 NM_005042 NM_005044 NM_005047 NM_005054 NM_005057 NM_005063 NM_005067 NM_005079 NM_005090 NM_005093 NM_005109 NM_005112 NM_005116 NM_005126 NM_005146 NM_005156 NM_005168 NM_005173 NM_005188 NM_005189 NM_005191 NM_005197 NM_005201 NM_005204 NM_005206 NM_005226 NM_005229 NM_005231 NM_005233 NM_005238 NM_005242 NM_005263 NM_005271 NM_005277 NM_005279 NM_005296 NM_005327 NM_005333 NM_005338 NM_005347 NM_005368 NM_005376 NM_005385 NM_005387 NM_005393 NM_005397 NM_005399 NM_005409 NM_005413 NM_005419 NM_005437 NM_005446 NM_005460 NM_005461 NM_005467 NM_005468 NM_005472 NM_005486 NM_005487 NM_005491 NM_005495 NM_005496 NM_005502 NM_005504 NM_005506 NM_005513 NM_005518 NM_005539 NM_005540 NM_005543 NM_005554 NM_005556 NM_005565 NM_005573 NM_005574 NM_005578 NM_005583 NM_005588 NM_005596 NM_005599 NM_005611 NM_005625 NM_005647 NM_005651 NM_005670 NM_005671 NM_005674 NM_005682 NM_005699 NM_005714 NM_005717 NM_005721 NM_005723 NM_005732 NM_005737 NM_005738 NM_005739 NM_005748 NM_005752 NM_005768 NM_005779 NM_005781 NM_005789 NM_005797 NM_005800 NM_005807 NM_005814 NM_005819 NM_005826 NM_005840 NM_005841 NM_005856 NM_005863 NM_005868 NM_005877 NM_005883 NM_005889 NM_005898 NM_005903 NM_005905 NM_005909 NM_005910 NM_005915 NM_005920 NM_005922 NM_005925 NM_005926 NM_005928 NM_005935 NM_005938 NM_005942 NM_005943 NM_005957 NM_005962 NM_005965 NM_005966 NM_005986 NM_005999 NM_006007 NM_006011 NM_006017 NM_006020 NM_006030 NM_006031 NM_006035 NM_006045 NM_006047 NM_006060 NM_006061 NM_006065 NM_006091 NM_006100 NM_006106 NM_006122 NM_006136 NM_006138 NM_006139 NM_006147 NM_006151 NM_006153 NM_006154 NM_006159 NM_006179 NM_006187 NM_006188 NM_006193 NM_006196 NM_006206 NM_006209 NM_006212 NM_006224 NM_006237 NM_006238 NM_006239 NM_006240 NM_006241 NM_006242 NM_006253 NM_006257 NM_006265 NM_006275 NM_006279 NM_006282 NM_006286 NM_006293 NM_006306 NM_006311 NM_006313 NM_006315 NM_006320 NM_006321 NM_006324 NM_006338 NM_006345 NM_006348 NM_006358 NM_006361 NM_006371 NM_006375 NM_006389 NM_006393 NM_006404 NM_006408 NM_006413 NM_006421 NM_006439 NM_006444 NM_006457 NM_006459 NM_006460 NM_006464 NM_006476 NM_006479 NM_006492 NM_006493 NM_006499 NM_006500 NM_006502 NM_006505 NM_006521 NM_006526 NM_006538 NM_006544 NM_006546 NM_006547 NM_006551 NM_006552 NM_006559 NM_006561 NM_006572 NM_006576 NM_006585 NM_006588 NM_006595 NM_006599 NM_006602 NM_006606 NM_006618 NM_006620 NM_006626 NM_006628 NM_006633 NM_006651 NM_006656 NM_006663 NM_006669 NM_006674 NM_006675 NM_006691 NM_006694 NM_006699 NM_006707 NM_006708 NM_006710 NM_006713 NM_006718 NM_006720 NM_006721 NM_006724 NM_006727 NM_006730 NM_006731 NM_006737 NM_006738 NM_006746 NM_006761 NM_006762 NM_006763 NM_006775 NM_006777 NM_006778 NM_006820 NM_006823 NM_006827 NM_006832 NM_006843 NM_006846 NM_006850 NM_006855 NM_006856 NM_006857 NM_006859 NM_006861 NM_006868 NM_006873 NM_006875 NM_006890 NM_006895 NM_006902 NM_006915 NM_006916 NM_006919 NM_006922 NM_006926 NM_006927 NM_006948 NM_006952 NM_006955 NM_006959 NM_006969 NM_006974 NM_006979 NM_006984 NM_006988 NM_006989 NM_006995 NM_007006 NM_007007 NM_007015 NM_007018 NM_007026 NM_007027 NM_007030 NM_007034 NM_007041 NM_007043 NM_007045 NM_007048 NM_007050 NM_007064 NM_007071 NM_007073 NM_007085 NM_007086 NM_007099 NM_007107 NM_007108 NM_007126 NM_007130 NM_007131 NM_007146 NM_007150 NM_007173 NM_007175 NM_007176 NM_007177 NM_007186 NM_007189 NM_007191 NM_007198 NM_007200 NM_007207 NM_007208 NM_007210 NM_007211 NM_007222 NM_007231 NM_007237 NM_007240 NM_007249 NM_007259 NM_007261 NM_007276 NM_007283 NM_007292 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007312 NM_007325 NM_007326 NM_007332 NM_007338 NM_007345 NM_007347 NM_007353 NM_007359 NM_007373 NM_012069 NM_012072 NM_012084 NM_012089 NM_012090 NM_012092 NM_012096 NM_012104 NM_012105 NM_012118 NM_012126 NM_012134 NM_012137 NM_012156 NM_012164 NM_012174 NM_012193 NM_012197 NM_012208 NM_012223 NM_012224 NM_012229 NM_012233 NM_012234 NM_012241 NM_012243 NM_012248 NM_012249 NM_012252 NM_012257 NM_012258 NM_012262 NM_012271 NM_012275 NM_012279 NM_012280 NM_012287 NM_012296 NM_012301 NM_012304 NM_012308 NM_012309 NM_012312 NM_012313 NM_012314 NM_012323 NM_012327 NM_012333 NM_012346 NM_012384 NM_012388 NM_012397 NM_012399 NM_012400 NM_012405 NM_012420 NM_012425 NM_012430 NM_012431 NM_012434 NM_012446 NM_012448 NM_012460 NM_012465 NM_012471 NM_012479 NM_013231 NM_013238 NM_013243 NM_013245 NM_013246 NM_013247 NM_013252 NM_013253 NM_013257 NM_013260 NM_013261 NM_013276 NM_013282 NM_013286 NM_013289 NM_013302 NM_013313 NM_013326 NM_013328 NM_013330 NM_013357 NM_013374 NM_013375 NM_013380 NM_013381 NM_013390 NM_013396 NM_013403 NM_013423 NM_013427 NM_013437 NM_013440 NM_013443 NM_013989 NM_013993 NM_013994 NM_013995 NM_014000 NM_014001 NM_014011 NM_014021 NM_014023 NM_014028 NM_014031 NM_014056 NM_014058 NM_014066 NM_014078 NM_014089 NM_014096 NM_014106 NM_014112 NM_014141 NM_014154 NM_014159 NM_014165 NM_014168 NM_014182 NM_014189 NM_014190 NM_014212 NM_014218 NM_014219 NM_014220 NM_014240 NM_014242 NM_014243 NM_014245 NM_014246 NM_014250 NM_014252 NM_014263 NM_014265 NM_014271 NM_014283 NM_014285 NM_014289 NM_014294 NM_014296 NM_014309 NM_014313 NM_014314 NM_014325 NM_014338 NM_014342 NM_014345 NM_014353 NM_014354 NM_014375 NM_014381 NM_014384 NM_014388 NM_014393 NM_014395 NM_014396 NM_014398 NM_014406 NM_014408 NM_014410 NM_014412 NM_014429 NM_014447 NM_014456 NM_014458 NM_014462 NM_014472 NM_014479 NM_014480 NM_014481 NM_014495 NM_014506 NM_014511 NM_014512 NM_014513 NM_014518 NM_014521 NM_014548 NM_014552 NM_014553 NM_014556 NM_014569 NM_014574 NM_014578 NM_014584 NM_014585 NM_014586 NM_014600 NM_014604 NM_014607 NM_014612 NM_014613 NM_014615 NM_014616 NM_014628 NM_014631 NM_014633 NM_014635 NM_014636 NM_014648 NM_014653 NM_014655 NM_014659 NM_014667 NM_014677 NM_014683 NM_014686 NM_014693 NM_014697 NM_014703 NM_014707 NM_014720 NM_014721 NM_014724 NM_014728 NM_014729 NM_014732 NM_014733 NM_014734 NM_014744 NM_014746 NM_014747 NM_014751 NM_014762 NM_014765 NM_014766 NM_014773 NM_014776 NM_014787 NM_014788 NM_014793 NM_014797 NM_014801 NM_014803 NM_014810 NM_014811 NM_014820 NM_014821 NM_014822 NM_014827 NM_014835 NM_014838 NM_014841 NM_014848 NM_014857 NM_014860 NM_014861 NM_014867 NM_014873 NM_014874 NM_014879 NM_014880 NM_014883 NM_014884 NM_014888 NM_014890 NM_014893 NM_014897 NM_014898 NM_014900 NM_014901 NM_014902 NM_014904 NM_014905 NM_014906 NM_014914 NM_014916 NM_014917 NM_014919 NM_014923 NM_014924 NM_014930 NM_014934 NM_014936 NM_014942 NM_014947 NM_014949 NM_014950 NM_014951 NM_014953 NM_014957 NM_014959 NM_014962 NM_014978 NM_014990 NM_014991 NM_015003 NM_015011 NM_015017 NM_015020 NM_015025 NM_015035 NM_015044 NM_015045 NM_015049 NM_015053 NM_015055 NM_015060 NM_015061 NM_015074 NM_015076 NM_015077 NM_015082 NM_015087 NM_015088 NM_015090 NM_015092 NM_015097 NM_015100 NM_015101 NM_015124 NM_015138 NM_015143 NM_015148 NM_015151 NM_015155 NM_015170 NM_015179 NM_015187 NM_015192 NM_015203 NM_015206 NM_015214 NM_015224 NM_015225 NM_015234 NM_015247 NM_015250 NM_015251 NM_015253 NM_015256 NM_015257 NM_015262 NM_015264 NM_015265 NM_015274 NM_015275 NM_015277 NM_015282 NM_015285 NM_015286 NM_015288 NM_015296 NM_015310 NM_015313 NM_015314 NM_015315 NM_015317 NM_015322 NM_015323 NM_015326 NM_015338 NM_015339 NM_015352 NM_015355 NM_015358 NM_015359 NM_015367 NM_015375 NM_015383 NM_015393 NM_015394 NM_015398 NM_015411 NM_015426 NM_015436 NM_015443 NM_015453 NM_015455 NM_015458 NM_015460 NM_015478 NM_015509 NM_015526 NM_015530 NM_015532 NM_015545 NM_015550 NM_015553 NM_015557 NM_015560 NM_015564 NM_015569 NM_015575 NM_015576 NM_015578 NM_015584 NM_015621 NM_015622 NM_015626 NM_015630 NM_015640 NM_015646 NM_015651 NM_015654 NM_015657 NM_015660 NM_015687 NM_015691 NM_015696 NM_015702 NM_015833 NM_015836 NM_015840 NM_015841 NM_015849 NM_015866 NM_015868 NM_015878 NM_015881 NM_015886 NM_015891 NM_015898 NM_015902 NM_015907 NM_015915 NM_015925 NM_015931 NM_015980 NM_015981 NM_016019 NM_016021 NM_016040 NM_016046 NM_016060 NM_016062 NM_016074 NM_016076 NM_016080 NM_016094 NM_016096 NM_016097 NM_016114 NM_016120 NM_016121 NM_016133 NM_016141 NM_016142 NM_016152 NM_016173 NM_016176 NM_016183 NM_016185 NM_016195 NM_016200 NM_016206 NM_016210 NM_016212 NM_016220 NM_016221 NM_016224 NM_016227 NM_016230 NM_016235 NM_016239 NM_016240 NM_016247 NM_016248 NM_016252 NM_016255 NM_016256 NM_016258 NM_016260 NM_016264 NM_016269 NM_016271 NM_016272 NM_016275 NM_016277 NM_016280 NM_016281 NM_016283 NM_016284 NM_016293 NM_016297 NM_016300 NM_016308 NM_016322 NM_016327 NM_016331 NM_016332 NM_016338 NM_016351 NM_016352 NM_016354 NM_016373 NM_016377 NM_016382 NM_016388 NM_016390 NM_016396 NM_016433 NM_016436 NM_016440 NM_016453 NM_016454 NM_016472 NM_016474 NM_016481 NM_016485 NM_016518 NM_016522 NM_016529 NM_016530 NM_016531 NM_016536 NM_016540 NM_016546 NM_016547 NM_016548 NM_016553 NM_016587 NM_016589 NM_016590 NM_016592 NM_016598 NM_016604 NM_016613 NM_016620 NM_016621 NM_016622 NM_016626 NM_016639 NM_016643 NM_016644 NM_016652 NM_016653 NM_016818 NM_016823 NM_016824 NM_016834 NM_016835 NM_016841 NM_017412 NM_017413 NM_017415 NM_017424 NM_017431 NM_017434 NM_017437 NM_017444 NM_017460 NM_017482 NM_017484 NM_017487 NM_017491 NM_017510 NM_017540 NM_017545 NM_017551 NM_017575 NM_017583 NM_017590 NM_017592 NM_017594 NM_017611 NM_017613 NM_017628 NM_017643 NM_017645 NM_017649 NM_017656 NM_017660 NM_017664 NM_017671 NM_017672 NM_017679 NM_017684 NM_017688 NM_017692 NM_017694 NM_017697 NM_017703 NM_017704 NM_017705 NM_017709 NM_017715 NM_017728 NM_017736 NM_017737 NM_017742 NM_017744 NM_017750 NM_017755 NM_017773 NM_017774 NM_017781 NM_017789 NM_017799 NM_017801 NM_017804 NM_017811 NM_017821 NM_017824 NM_017828 NM_017831 NM_017833 NM_017847 NM_017851 NM_017866 NM_017873 NM_017875 NM_017905 NM_017907 NM_017910 NM_017919 NM_017924 NM_017928 NM_017929 NM_017936 NM_017939 NM_017943 NM_017946 NM_017952 NM_017954 NM_017966 NM_017988 NM_018003 NM_018013 NM_018014 NM_018017 NM_018018 NM_018023 NM_018030 NM_018035 NM_018036 NM_018037 NM_018069 NM_018073 NM_018084 NM_018089 NM_018091 NM_018092 NM_018103 NM_018106 NM_018112 NM_018117 NM_018121 NM_018128 NM_018129 NM_018137 NM_018153 NM_018154 NM_018155 NM_018159 NM_018168 NM_018170 NM_018172 NM_018176 NM_018178 NM_018191 NM_018201 NM_018210 NM_018211 NM_018212 NM_018223 NM_018229 NM_018230 NM_018234 NM_018241 NM_018245 NM_018247 NM_018260 NM_018263 NM_018269 NM_018273 NM_018279 NM_018281 NM_018287 NM_018292 NM_018295 NM_018302 NM_018304 NM_018315 NM_018327 NM_018347 NM_018348 NM_018362 NM_018364 NM_018367 NM_018370 NM_018371 NM_018374 NM_018375 NM_018383 NM_018384 NM_018385 NM_018390 NM_018398 NM_018409 NM_018425 NM_018433 NM_018439 NM_018440 NM_018443 NM_018449 NM_018450 NM_018452 NM_018482 NM_018490 NM_018498 NM_018509 NM_018518 NM_018555 NM_018593 NM_018602 NM_018607 NM_018640 NM_018643 NM_018644 NM_018646 NM_018652 NM_018655 NM_018656 NM_018667 NM_018669 NM_018684 NM_018689 NM_018698 NM_018704 NM_018706 NM_018710 NM_018715 NM_018727 NM_018833 NM_018836 NM_018841 NM_018845 NM_018891 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018930 NM_018933 NM_018938 NM_018947 NM_018959 NM_018970 NM_018981 NM_018982 NM_018987 NM_018997 NM_018999 NM_019007 NM_019008 NM_019009 NM_019011 NM_019014 NM_019021 NM_019024 NM_019045 NM_019051 NM_019062 NM_019063 NM_019069 NM_019087 NM_019089 NM_019094 NM_019098 NM_019106 NM_019117 NM_019118 NM_019119 NM_019556 NM_019557 NM_019558 NM_019594 NM_019604 NM_019610 NM_019846 NM_019857 NM_019903 NM_020039 NM_020116 NM_020120 NM_020122 NM_020125 NM_020139 NM_020143 NM_020161 NM_020162 NM_020163 NM_020177 NM_020182 NM_020198 NM_020223 NM_020228 NM_020231 NM_020245 NM_020335 NM_020336 NM_020338 NM_020341 NM_020342 NM_020363 NM_020364 NM_020374 NM_020384 NM_020390 NM_020397 NM_020398 NM_020400 NM_020403 NM_020405 NM_020420 NM_020431 NM_020436 NM_020443 NM_020447 NM_020453 NM_020456 NM_020463 NM_020465 NM_020466 NM_020469 NM_020472 NM_020473 NM_020474 NM_020482 NM_020524 NM_020535 NM_020546 NM_020640 NM_020647 NM_020651 NM_020657 NM_020663 NM_020673 NM_020682 NM_020683 NM_020686 NM_020689 NM_020696 NM_020698 NM_020701 NM_020704 NM_020708 NM_020728 NM_020737 NM_020739 NM_020748 NM_020760 NM_020761 NM_020762 NM_020766 NM_020768 NM_020771 NM_020772 NM_020773 NM_020774 NM_020776 NM_020779 NM_020781 NM_020782 NM_020784 NM_020786 NM_020787 NM_020795 NM_020801 NM_020804 NM_020809 NM_020810 NM_020813 NM_020821 NM_020824 NM_020825 NM_020826 NM_020828 NM_020831 NM_020834 NM_020841 NM_020856 NM_020858 NM_020863 NM_020867 NM_020868 NM_020870 NM_020871 NM_020875 NM_020899 NM_020901 NM_020909 NM_020917 NM_020922 NM_020933 NM_020935 NM_020936 NM_020940 NM_020944 NM_020954 NM_020965 NM_020970 NM_020977 NM_020987 NM_021003 NM_021030 NM_021035 NM_021038 NM_021067 NM_021075 NM_021083 NM_021088 NM_021101 NM_021104 NM_021116 NM_021133 NM_021135 NM_021143 NM_021145 NM_021148 NM_021151 NM_021155 NM_021181 NM_021183 NM_021190 NM_021200 NM_021201 NM_021213 NM_021215 NM_021229 NM_021230 NM_021240 NM_021251 NM_021255 NM_021572 NM_021615 NM_021620 NM_021635 NM_021637 NM_021642 NM_021723 NM_021735 NM_021736 NM_021737 NM_021783 NM_021809 NM_021810 NM_021813 NM_021814 NM_021823 NM_021832 NM_021912 NM_021935 NM_021943 NM_021945 NM_021947 NM_021959 NM_021965 NM_021970 NM_021977 NM_021980 NM_021988 NM_021999 NM_022048 NM_022049 NM_022054 NM_022063 NM_022066 NM_022071 NM_022079 NM_022083 NM_022085 NM_022093 NM_022097 NM_022102 NM_022106 NM_022114 NM_022133 NM_022135 NM_022138 NM_022150 NM_022333 NM_022341 NM_022346 NM_022349 NM_022351 NM_022442 NM_022444 NM_022458 NM_022459 NM_022464 NM_022468 NM_022473 NM_022475 NM_022476 NM_022483 NM_022487 NM_022491 NM_022652 NM_022658 NM_022716 NM_022718 NM_022725 NM_022726 NM_022731 NM_022735 NM_022736 NM_022744 NM_022753 NM_022756 NM_022758 NM_022763 NM_022767 NM_022770 NM_022777 NM_022780 NM_022781 NM_022787 NM_022791 NM_022792 NM_022802 NM_022810 NM_022818 NM_022822 NM_022825 NM_022829 NM_022831 NM_022832 NM_022837 NM_022844 NM_022894 NM_022898 NM_022901 NM_022905 NM_022910 NM_022912 NM_022917 NM_023016 NM_023075 NM_023079 NM_023083 NM_023084 NM_023085 NM_023086 NM_023087 NM_023088 NM_023914 NM_023927 NM_023929 NM_023938 NM_024007 NM_024015 NM_024028 NM_024033 NM_024035 NM_024052 NM_024063 NM_024074 NM_024080 NM_024090 NM_024092 NM_024095 NM_024102 NM_024103 NM_024106 NM_024107 NM_024116 NM_024119 NM_024120 NM_024294 NM_024300 NM_024306 NM_024312 NM_024345 NM_024408 NM_024430 NM_024503 NM_024512 NM_024513 NM_024523 NM_024525 NM_024533 NM_024539 NM_024551 NM_024556 NM_024560 NM_024561 NM_024563 NM_024569 NM_024570 NM_024574 NM_024595 NM_024607 NM_024611 NM_024614 NM_024635 NM_024636 NM_024641 NM_024646 NM_024647 NM_024652 NM_024656 NM_024664 NM_024665 NM_024670 NM_024672 NM_024674 NM_024677 NM_024678 NM_024684 NM_024686 NM_024689 NM_024699 NM_024709 NM_024711 NM_024719 NM_024733 NM_024745 NM_024746 NM_024761 NM_024763 NM_024768 NM_024771 NM_024779 NM_024791 NM_024793 NM_024800 NM_024810 NM_024812 NM_024830 NM_024834 NM_024843 NM_024845 NM_024850 NM_024854 NM_024859 NM_024860 NM_024881 NM_024893 NM_024896 NM_024899 NM_024900 NM_024902 NM_024909 NM_024924 NM_024930 NM_024938 NM_024940 NM_024941 NM_024943 NM_024944 NM_024953 NM_024955 NM_024960 NM_024974 NM_024986 NM_024993 NM_025019 NM_025027 NM_025030 NM_025057 NM_025059 NM_025061 NM_025076 NM_025104 NM_025125 NM_025133 NM_025135 NM_025146 NM_025151 NM_025155 NM_025168 NM_025180 NM_025181 NM_025194 NM_025203 NM_025208 NM_025217 NM_025220 NM_025225 NM_025230 NM_025235 NM_025237 NM_025238 NM_030571 NM_030577 NM_030621 NM_030622 NM_030625 NM_030637 NM_030641 NM_030758 NM_030762 NM_030763 NM_030772 NM_030780 NM_030781 NM_030787 NM_030796 NM_030799 NM_030805 NM_030806 NM_030810 NM_030817 NM_030824 NM_030883 NM_030891 NM_030895 NM_030911 NM_030915 NM_030916 NM_030918 NM_030919 NM_030922 NM_030924 NM_030934 NM_030936 NM_030939 NM_030945 NM_030953 NM_030968 NM_030972 NM_031211 NM_031266 NM_031271 NM_031282 NM_031295 NM_031296 NM_031305 NM_031306 NM_031411 NM_031417 NM_031418 NM_031419 NM_031422 NM_031435 NM_031436 NM_031438 NM_031439 NM_031442 NM_031444 NM_031453 NM_031455 NM_031461 NM_031465 NM_031469 NM_031474 NM_031490 NM_031849 NM_031857 NM_031860 NM_031886 NM_031889 NM_031901 NM_031905 NM_031910 NM_031911 NM_031912 NM_031916 NM_031940 NM_031988 NM_032010 NM_032017 NM_032023 NM_032042 NM_032047 NM_032102 NM_032116 NM_032121 NM_032143 NM_032151 NM_032164 NM_032165 NM_032174 NM_032186 NM_032192 NM_032208 NM_032211 NM_032217 NM_032226 NM_032228 NM_032246 NM_032257 NM_032264 NM_032268 NM_032281 NM_032287 NM_032294 NM_032295 NM_032303 NM_032333 NM_032347 NM_032350 NM_032351 NM_032364 NM_032371 NM_032373 NM_032374 NM_032377 NM_032382 NM_032385 NM_032410 NM_032423 NM_032424 NM_032435 NM_032445 NM_032446 NM_032457 NM_032458 NM_032485 NM_032499 NM_032501 NM_032505 NM_032552 NM_032556 NM_032564 NM_032574 NM_032578 NM_032584 NM_032588 NM_032603 NM_032607 NM_032622 NM_032638 NM_032649 NM_032679 NM_032680 NM_032689 NM_032710 NM_032717 NM_032718 NM_032727 NM_032737 NM_032783 NM_032784 NM_032787 NM_032788 NM_032804 NM_032806 NM_032811 NM_032815 NM_032818 NM_032825 NM_032826 NM_032849 NM_032853 NM_032866 NM_032869 NM_032875 NM_032876 NM_032899 NM_032900 NM_032918 NM_032924 NM_032927 NM_032932 NM_032933 NM_032936 NM_032949 NM_032961 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032980 NM_032992 NM_032998 NM_033044 NM_033064 NM_033084 NM_033089 NM_033090 NM_033109 NM_033117 NM_033135 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033159 NM_033161 NM_033185 NM_033188 NM_033207 NM_033211 NM_033220 NM_033222 NM_033224 NM_033238 NM_033261 NM_033262 NM_033266 NM_033272 NM_033285 NM_033288 NM_033331 NM_033332 NM_033338 NM_033339 NM_033340 NM_033345 NM_033346 NM_033360 NM_033375 NM_033380 NM_033381 NM_033389 NM_033394 NM_033405 NM_033419 NM_033421 NM_033426 NM_033429 NM_033430 NM_033437 NM_033450 NM_033456 NM_033496 NM_033497 NM_033498 NM_033500 NM_033505 NM_033512 NM_033513 NM_033542 NM_033551 NM_033632 NM_033637 NM_033640 NM_033671 NM_052816 NM_052822 NM_052828 NM_052832 NM_052834 NM_052845 NM_052848 NM_052864 NM_052876 NM_052879 NM_052885 NM_052886 NM_052887 NM_052890 NM_052900 NM_052932 NM_052936 NM_052937 NM_052941 NM_052943 NM_052947 NM_052949 NM_052956 NM_052961 NM_052964 NM_052966 NM_052978 NM_053023 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053050 NM_053279 NM_054016 NM_054025 NM_054114 NM_057159 NM_057169 NM_057170 NM_057175 NM_057178 NM_058217 NM_058240 NM_058242 NM_058246 NM_078469 NM_078473 NM_078483 NM_078485 NM_078625 NM_079420 NM_079422 NM_080387 NM_080425 NM_080426 NM_080491 NM_080597 NM_080612 NM_080616 NM_080628 NM_080629 NM_080630 NM_080631 NM_080645 NM_080648 NM_080649 NM_080654 NM_080657 NM_080679 NM_080680 NM_080681 NM_080704 NM_080705 NM_080706 NM_080725 NM_080737 NM_080740 NM_080764 NM_080817 NM_080821 NM_080829 NM_080832 NM_080867 NM_080872 NM_080876 NM_080878 NM_080911 NM_080923 NM_080927 NM_101395 NM_130386 NM_130436 NM_130437 NM_130438 NM_130439 NM_130463 NM_130469 NM_130768 NM_130781 NM_130788 NM_130790 NM_130792 NM_130793 NM_130807 NM_130809 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130842 NM_130843 NM_130898 NM_131915 NM_133170 NM_133264 NM_133265 NM_133268 NM_133279 NM_133280 NM_133329 NM_133330 NM_133331 NM_133332 NM_133333 NM_133335 NM_133367 NM_133371 NM_133446 NM_133448 NM_133451 NM_133459 NM_133463 NM_133468 NM_133473 NM_133474 NM_133477 NM_133480 NM_133481 NM_133482 NM_133487 NM_133490 NM_133496 NM_133631 NM_133645 NM_133646 NM_134264 NM_134265 NM_134422 NM_134423 NM_134424 NM_134433 NM_134434 NM_138270 NM_138271 NM_138280 NM_138282 NM_138292 NM_138294 NM_138295 NM_138323 NM_138324 NM_138333 NM_138338 NM_138342 NM_138357 NM_138361 NM_138390 NM_138408 NM_138423 NM_138441 NM_138444 NM_138447 NM_138450 NM_138457 NM_138458 NM_138468 NM_138484 NM_138492 NM_138494 NM_138553 NM_138554 NM_138555 NM_138556 NM_138559 NM_138565 NM_138576 NM_138608 NM_138619 NM_138620 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138633 NM_138640 NM_138706 NM_138713 NM_138714 NM_138718 NM_138727 NM_138728 NM_138731 NM_138766 NM_138771 NM_138775 NM_138793 NM_138809 NM_138810 NM_138811 NM_138813 NM_138821 NM_138822 NM_138923 NM_138928 NM_138962 NM_138966 NM_138969 NM_138971 NM_138972 NM_138973 NM_138991 NM_138992 NM_138994 NM_139004 NM_139076 NM_139078 NM_139131 NM_139160 NM_139168 NM_139235 NM_139246 NM_139265 NM_139283 NM_139312 NM_139319 NM_139323 NM_144498 NM_144570 NM_144573 NM_144578 NM_144597 NM_144600 NM_144609 NM_144635 NM_144644 NM_144646 NM_144661 NM_144664 NM_144682 NM_144684 NM_144693 NM_144701 NM_144706 NM_144711 NM_144721 NM_144728 NM_144729 NM_144736 NM_144767 NM_144778 NM_144780 NM_144949 NM_144964 NM_144968 NM_144969 NM_144973 NM_144975 NM_144982 NM_144991 NM_144992 NM_145016 NM_145018 NM_145021 NM_145025 NM_145033 NM_145035 NM_145041 NM_145048 NM_145055 NM_145074 NM_145102 NM_145115 NM_145117 NM_145174 NM_145177 NM_145178 NM_145185 NM_145201 NM_145203 NM_145212 NM_145234 NM_145241 NM_145244 NM_145257 NM_145261 NM_145263 NM_145268 NM_145276 NM_145279 NM_145282 NM_145284 NM_145292 NM_145301 NM_145305 NM_145307 NM_145310 NM_145311 NM_145314 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145328 NM_145330 NM_145341 NM_145646 NM_145652 NM_145690 NM_145693 NM_145728 NM_145730 NM_145733 NM_145734 NM_145735 NM_145753 NM_145756 NM_145794 NM_145795 NM_145803 NM_145804 NM_145808 NM_145858 NM_145864 NM_145865 NM_145906 NM_145910 NM_146388 NM_147134 NM_147147 NM_147180 NM_147190 NM_147192 NM_147193 NM_147194 NM_147200 NM_147686 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_148171 NM_148174 NM_148175 NM_148903 NM_148912 NM_148913 NM_148915 NM_148960 NM_148962 NM_152133 NM_152223 NM_152224 NM_152225 NM_152226 NM_152235 NM_152247 NM_152253 NM_152257 NM_152261 NM_152266 NM_152272 NM_152289 NM_152305 NM_152315 NM_152332 NM_152335 NM_152348 NM_152350 NM_152361 NM_152362 NM_152375 NM_152376 NM_152380 NM_152385 NM_152406 NM_152407 NM_152412 NM_152417 NM_152421 NM_152424 NM_152428 NM_152434 NM_152435 NM_152439 NM_152440 NM_152441 NM_152449 NM_152450 NM_152460 NM_152464 NM_152466 NM_152484 NM_152487 NM_152488 NM_152495 NM_152498 NM_152504 NM_152507 NM_152509 NM_152519 NM_152545 NM_152546 NM_152551 NM_152554 NM_152563 NM_152568 NM_152569 NM_152571 NM_152583 NM_152588 NM_152590 NM_152594 NM_152595 NM_152603 NM_152609 NM_152614 NM_152615 NM_152624 NM_152628 NM_152632 NM_152636 NM_152641 NM_152643 NM_152653 NM_152655 NM_152666 NM_152675 NM_152678 NM_152684 NM_152686 NM_152687 NM_152701 NM_152715 NM_152722 NM_152724 NM_152729 NM_152731 NM_152750 NM_152754 NM_152757 NM_152774 NM_152785 NM_152793 NM_152831 NM_152835 NM_152836 NM_152837 NM_152838 NM_152860 NM_152878 NM_152897 NM_152900 NM_152902 NM_152908 NM_152933 NM_152934 NM_152999 NM_153023 NM_153028 NM_153033 NM_153042 NM_153046 NM_153181 NM_153184 NM_153202 NM_153207 NM_153215 NM_153217 NM_153218 NM_153220 NM_153226 NM_153228 NM_153229 NM_153235 NM_153238 NM_153256 NM_153259 NM_153281 NM_153282 NM_153283 NM_153284 NM_153285 NM_153286 NM_153292 NM_153328 NM_153331 NM_153332 NM_153337 NM_153338 NM_153343 NM_153346 NM_153347 NM_153348 NM_153354 NM_153355 NM_153362 NM_153375 NM_153380 NM_153442 NM_153453 NM_153456 NM_153487 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153634 NM_153637 NM_153638 NM_153639 NM_153640 NM_153641 NM_153683 NM_153686 NM_153688 NM_153691 NM_153693 NM_153697 NM_153705 NM_153706 NM_153707 NM_153711 NM_153712 NM_153717 NM_153718 NM_153719 NM_153757 NM_153810 NM_153812 NM_153825 NM_153834 NM_153837 NM_170601 NM_170607 NM_170686 NM_170694 NM_170705 NM_170709 NM_170710 NM_170711 NM_170721 NM_170725 NM_170740 NM_170751 NM_170752 NM_170768 NM_170781 NM_171825 NM_171998 NM_172000 NM_172024 NM_172037 NM_172070 NM_172127 NM_172128 NM_172159 NM_172160 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172206 NM_172217 NM_172225 NM_172250 NM_172344 NM_172346 NM_172364 NM_172375 NM_173042 NM_173043 NM_173044 NM_173076 NM_173092 NM_173161 NM_173162 NM_173164 NM_173170 NM_173178 NM_173214 NM_173355 NM_173359 NM_173459 NM_173463 NM_173464 NM_173468 NM_173473 NM_173476 NM_173488 NM_173491 NM_173497 NM_173501 NM_173508 NM_173511 NM_173519 NM_173521 NM_173531 NM_173539 NM_173545 NM_173552 NM_173555 NM_173562 NM_173563 NM_173572 NM_173580 NM_173582 NM_173602 NM_173607 NM_173610 NM_173613 NM_173616 NM_173617 NM_173621 NM_173622 NM_173629 NM_173632 NM_173638 NM_173639 NM_173641 NM_173644 NM_173646 NM_173648 NM_173653 NM_173654 NM_173666 NM_173671 NM_173673 NM_173675 NM_173677 NM_173678 NM_173683 NM_173687 NM_173694 NM_173698 NM_173701 NM_173797 NM_173811 NM_173812 NM_173825 NM_173829 NM_173851 NM_173854 NM_174871 NM_174898 NM_174914 NM_174917 NM_174937 NM_174939 NM_174953 NM_174954 NM_174955 NM_174956 NM_174957 NM_174963 NM_174964 NM_174965 NM_174966 NM_174967 NM_174968 NM_174969 NM_174970 NM_174971 NM_174972 NM_174976 NM_175047 NM_175052 NM_175056 NM_175058 NM_175061 NM_175069 NM_175071 NM_175072 NM_175073 NM_175085 NM_175571 NM_175607 NM_175612 NM_175709 NM_175719 NM_175721 NM_175722 NM_175739 NM_175767 NM_175852 NM_175859 NM_175864 NM_175885 NM_175887 NM_175888 NM_175898 NM_175901 NM_175907 NM_175908 NM_175921 NM_175924 NM_175940 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176787 NM_176801 NM_176806 NM_176811 NM_176815 NM_176816 NM_176823 NM_176825 NM_176863 NM_176891 NM_176894 NM_177405 NM_177414 NM_177427 NM_177434 NM_177436 NM_177438 NM_177439 NM_177441 NM_177453 NM_177478 NM_177524 NM_177525 NM_177532 NM_177554 NM_177924 NM_177937 NM_177951 NM_177952 NM_177963 NM_177965 NM_177968 NM_177974 NM_177980 NM_177990 NM_177996 NM_177999 NM_178012 NM_178034 NM_178122 NM_178128 NM_178130 NM_178145 NM_178151 NM_178152 NM_178153 NM_178177 NM_178228 NM_178238 NM_178270 NM_178271 NM_178313 NM_178338 NM_178353 NM_178426 NM_178427 NM_178454 NM_178491 NM_178498 NM_178505 NM_178509 NM_178523 NM_178540 NM_178550 NM_178585 NM_178586 NM_178812 NM_178818 NM_178826 NM_178832 NM_178857 NM_178867 NM_180989 NM_181041 NM_181076 NM_181077 NM_181265 NM_181291 NM_181314 NM_181339 NM_181354 NM_181356 NM_181357 NM_181358 NM_181430 NM_181431 NM_181435 NM_181441 NM_181442 NM_181443 NM_181453 NM_181454 NM_181455 NM_181456 NM_181462 NM_181463 NM_181464 NM_181465 NM_181500 NM_181501 NM_181502 NM_181505 NM_181531 NM_181533 NM_181558 NM_181571 NM_181598 NM_181643 NM_181654 NM_181670 NM_181672 NM_181673 NM_181705 NM_181706 NM_181712 NM_181714 NM_181723 NM_181733 NM_181740 NM_181741 NM_181742 NM_181783 NM_181785 NM_181786 NM_181789 NM_181797 NM_181798 NM_181814 NM_181836 NM_181839 NM_182314 NM_182398 NM_182485 NM_182499 NM_182501 NM_182503 NM_182518 NM_182533 NM_182537 NM_182540 NM_182559 NM_182568 NM_182570 NM_182580 NM_182584 NM_182596 NM_182597 NM_182605 NM_182606 NM_182607 NM_182621 NM_182626 NM_182645 NM_182646 NM_182647 NM_182680 NM_182681 NM_182682 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182734 NM_182751 NM_182757 NM_182759 NM_182767 NM_182769 NM_182770 NM_182771 NM_182772 NM_182802 NM_182827 NM_182830 NM_182832 NM_182848 NM_182850 NM_182853 NM_182898 NM_182899 NM_182907 NM_182909 NM_182915 NM_182917 NM_182918 NM_182920 NM_182931 NM_182932 NM_182933 NM_182934 NM_182935 NM_182936 NM_182943 NM_182960 NM_182964 NM_182974 NM_182977 NM_183002 NM_183006 NM_183011 NM_183012 NM_183013 NM_183050 NM_183059 NM_183060 NM_183063 NM_183075 NM_183227 NM_183237 NM_183353 NM_183372 NM_183373 NM_183376 NM_183377 NM_183387 NM_183398 NM_183399 NM_183400 NM_183401 NM_184231 NM_194071 NM_194279 NM_194282 NM_194285 NM_194286 NM_194287 NM_194291 NM_194293 NM_194295 NM_194299 NM_194301 NM_194303 NM_194314 NM_194317 NM_194318 NM_194319 NM_194320 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194429 NM_194430 NM_194431 NM_194434 NM_194435 NM_194449 NM_194451 NM_194454 NM_194455 NM_194456 NM_194463 NM_197941 NM_197972 NM_197975 NM_197976 NM_198047 NM_198056 NM_198066 NM_198081 NM_198086 NM_198089 NM_198123 NM_198124 NM_198128 NM_198150 NM_198151 NM_198154 NM_198156 NM_198157 NM_198181 NM_198182 NM_198189 NM_198194 NM_198204 NM_198205 NM_198212 NM_198213 NM_198241 NM_198242 NM_198244 NM_198256 NM_198257 NM_198258 NM_198266 NM_198268 NM_198269 NM_198271 NM_198279 NM_198282 NM_198321 NM_198325 NM_198327 NM_198328 NM_198353 NM_198381 NM_198392 NM_198399 NM_198400 NM_198449 NM_198457 NM_198458 NM_198459 NM_198461 NM_198465 NM_198466 NM_198474 NM_198476 NM_198480 NM_198493 NM_198496 NM_198501 NM_198506 NM_198545 NM_198549 NM_198550 NM_198554 NM_198557 NM_198576 NM_198581 NM_198584 NM_198593 NM_198594 NM_198682 NM_198686 NM_198712 NM_198713 NM_198714 NM_198716 NM_198717 NM_198797 NM_198833 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198843 NM_198844 NM_198887 NM_198889 NM_198893 NM_198968 NM_198974 NM_198993 NM_199040 NM_199045 NM_199050 NM_199052 NM_199072 NM_199076 NM_199126 NM_199131 NM_199132 NM_199144 NM_199162 NM_199167 NM_199169 NM_199170 NM_199171 NM_199182 NM_199188 NM_199190 NM_199203 NM_199229 NM_199246 NM_199286 NM_199292 NM_199293 NM_199324 NM_199327 NM_199329 NM_199351 NM_199355 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199413 NM_199414 NM_199421 NM_199423 NM_199425 NM_199437 NM_199438 NM_199439 NM_199440 NM_199451 NM_199452 NM_199454 NM_199462 NM_201259 NM_201260 NM_201261 NM_201263 NM_201269 NM_201280 NM_201348 NM_201400 NM_201403 NM_201431 NM_201432 NM_201433 NM_201524 NM_201525 NM_201543 NM_201544 NM_201545 NM_201548 NM_201550 NM_201567 NM_201591 NM_201592 NM_201598 NM_201624 NM_201628 NM_201630 NM_201632 NM_201634 NM_201636 NM_201994 NM_203282 NM_203307 NM_203327 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_203377 NM_203378 NM_203381 NM_203395 NM_203405 NM_203406 NM_203417 NM_203418 NM_203438 NM_203439 NM_203440 NM_203441 NM_203446 NM_203447 NM_203451 NM_203452 NM_203453 NM_203463 NM_203473 NM_203474 NM_203475 NM_203476 NM_203481 NM_203487 NM_203488 NM_205543 NM_205548 NM_205833 NM_205834 NM_205835 NM_205846 NM_205852 NM_205857 NM_205860 NM_206809 NM_206810 NM_206811 NM_206812 NM_206813 NM_206814 NM_206827 NM_206832 NM_206834 NM_206835 NM_206853 NM_206854 NM_206855 NM_206876 NM_206877 NM_206887 NM_206892 NM_206893 NM_206894 NM_206909 NM_206910 NM_206911 NM_206925 NM_206938 NM_206939 NM_206940 NM_206943 NM_206998 NM_207003 NM_207036 NM_207037 NM_207038 NM_207040 NM_207111 NM_207113 NM_207116 NM_207171 NM_207174 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207306 NM_207313 NM_207327 NM_207331 NM_207332 NM_207333 NM_207337 NM_207344 NM_207352 NM_207366 NM_207380 NM_207381 NM_207383 NM_207387 NM_207394 NM_207400 NM_207401 NM_207404 NM_207406 NM_207410 NM_207412 NM_207422 NM_207428 NM_207430 NM_207434 NM_207435 NM_207439 NM_207446 NM_207460 NM_207467 NM_207471 NM_207472 NM_207479 NM_207481 NM_207483 NM_207485 NM_207486 NM_207488 NM_207498 NM_207500 NM_207503 NM_207507 NM_207509 NM_207511 NM_207514 NM_207517 NM_207578 NM_207582 NM_207627 NM_207628 NM_207629 NM_207630 NM_207645 NM_207647 NM_212460 NM_212464 NM_212540 NM_212558 NM_212559 NM_213566 NM_213589 NM_213593 NM_213597 NM_213604 NM_213605 NM_213606 NM_213609 NM_213621 NM_213633 NM_213645 NM_213646 NM_213648 NM_213649 NM_213650 NM_213654 NM_213723 XM_027236 XM_031009 XM_031553 XM_031689 XM_032571 XM_032945 XM_032996 XM_034274 XM_035299 XM_037557 XM_038436 XM_039515 XM_039627 XM_039676 XM_041126 XM_042301 XM_042698 XM_042833 XM_043493 XM_044178 XM_044434 XM_047355 XM_047550 XM_047554 XM_047610 XM_047995 XM_048592 XM_048898 XM_049078 XM_051081 XM_051862 XM_054313 XM_056455 XM_057296 XM_058628 XM_059318 XM_059689 XM_062872 XM_067585 XM_084529 XM_084868 XM_085367 XM_085463 XM_087137 XM_093839 XM_097351 XM_113743 XM_113947 XM_114303 XM_117117 XM_117239 XM_166140 XM_166320 XM_167147 XM_167152 XM_170597 XM_170842 XM_171054 XM_172801 XM_172874 XM_173160 XM_208333 XM_208545 XM_208658 XM_208835 XM_208930 XM_208990 XM_209234 XM_209429 XM_209500 XM_209700 XM_211287 XM_211367 XM_211805 XM_212061 XM_212170 XM_290546 XM_290597 XM_290734 XM_290737 XM_290809 XM_290842 XM_291020 XM_291028 XM_291095 XM_291128 XM_292357 XM_293828 XM_293918 XM_294521 XM_294765 XM_298045 XM_298151 XM_350880 XM_370636 XM_370654 XM_370665 XM_370837 XM_370839 XM_370840 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_371074 XM_371116 XM_371132 XM_371176 XM_371181 XM_371302 XM_371304 XM_371369 XM_371461 XM_371476 XM_371486 XM_371511 XM_371569 XM_371655 XM_371664 XM_371714 XM_371783 XM_371837 XM_371838 XM_372045 XM_372090 XM_372097 XM_372110 XM_372118 XM_372227 XM_372267 XM_372273 XM_372592 XM_373030 XM_373446 XM_373509 XM_373583 XM_373594 XM_373606 XM_373690 XM_373704 XM_373765 XM_373771 XM_373788 XM_373808 XM_373865 XM_373908 XM_374035 XM_374051 XM_374086 XM_374094 XM_374169 XM_374248 XM_374341 XM_374343 XM_374766 XM_374801 XM_374803 XM_374915 XM_374983 XM_375018 XM_375029 XM_375033 XM_375042 XM_375152 XM_375163 XM_375174 XM_375183 XM_375272 XM_375357 XM_375373 XM_375443 XM_375491 XM_375527 XM_375589 XM_375590 XM_375629 XM_375646 XM_375697 XM_375698 XM_375803 XM_375816 XM_375853 XM_375935 XM_376018 XM_376049 XM_376062 XM_376212 XM_376254 XM_376278 XM_376284 XM_376303 XM_376334 XM_376386 XM_376412 XM_376423 XM_376436 XM_376560 XM_376586 XM_376602 XM_376652 XM_376679 XM_376720 XM_376722 XM_376727 XM_376783 XM_376784 XM_376795 XM_376821 XM_376822 XM_376843 XM_376902 XM_376905 XM_376981 XM_377002 XM_377033 XM_378178 XM_378202 XM_378208 XM_378223 XM_378228 XM_378236 XM_378238 XM_378247 XM_378259 XM_378280 XM_378301 XM_378316 XM_378321 XM_378327 XM_378331 XM_378356 XM_378367 XM_378394 XM_378430 XM_378434 XM_378436 XM_378437 XM_378452 XM_378453 XM_378454 XM_378456 XM_378462 XM_378472 XM_378487 XM_378516 XM_378544 XM_378546 XM_378550 XM_378567 XM_378589 XM_378606 XM_378608 XM_378617 XM_378648 XM_378667 XM_378678 XM_378703 XM_378712 XM_378743 XM_378746 XM_378747 XM_378753 XM_378758 XM_378783 XM_378786 XM_378842 XM_378852 XM_378883 XM_378886 XM_378897 XM_378914 XM_378925 XM_378964 XM_378970 XM_378982 XM_378983 XM_378985 XM_378993 XM_379023 XM_379029 XM_379041 XM_379060 XM_379065 XM_379075 XM_379079 XM_379096 XM_379097 XM_379100 XM_379102 XM_379114 XM_379121 XM_379154 XM_379156 XM_379173 XM_379189 XM_379204 XM_379205 XM_379207 XM_379260 XM_379267 XM_379276 XM_379295 XM_379371 XM_379373 XM_379378 XM_379380 XM_379391 XM_379395 XM_379398 XM_379406 XM_379433 XM_379437 XM_379438 XM_379454 XM_379456 XM_379458 XM_379459 XM_379477 XM_379482 XM_379510 XM_379515 XM_379534 XM_379547 XM_379573 XM_379582 XM_379586 XM_379592 XM_379595 XM_379603 XM_379619 XM_379622 XM_379629 XM_379696 XM_379720 XM_379722 XM_379798 XM_379820 XM_379892 XM_379933 XM_379967 XM_379977 XM_379979 XM_380092 XM_380098 XM_380131 XM_380139 XM_380159 XM_495830 XM_495848 XM_495877 XM_495886 XM_495888 XM_495916 XM_495920 XM_495939 XM_495950 XM_495996 XM_496041 XM_496044 XM_496048 XM_496049 XM_496070 XM_496076 XM_496081 XM_496088 XM_496092 XM_496093 XM_496096 XM_496103 XM_496134 XM_496145 XM_496158 XM_496191 XM_496239 XM_496251 XM_496335 XM_496351 XM_496358 XM_496388 XM_496390 XM_496391 XM_496394 XM_496399 XM_496401 XM_496436 XM_496437 XM_496467 XM_496539 XM_496549 XM_496575 XM_496581 XM_496584 XM_496603 XM_496608 XM_496618 XM_496637 XM_496688 XM_496836 XM_496877 XM_496879 XM_496882 XM_496907 XM_496943 XM_496959 XM_496966 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_496987 XM_497012 XM_497080 XM_497140 XM_498427 XM_498437 XM_498442 XM_498446 XM_498449 XM_498451 XM_498452 XM_498454 XM_498459 XM_498466 XM_498467 XM_498469 XM_498481 XM_498483 XM_498490 XM_498500 XM_498506 XM_498511 XM_498545 XM_498553 XM_498557 XM_498559 XM_498567 XM_498596 XM_498614 XM_498618 XM_498624 XM_498632 XM_498644 XM_498647 XM_498649 XM_498655 XM_498660 XM_498677 XM_498683 XM_498704 XM_498736 XM_498737 XM_498744 XM_498748 XM_498754 XM_498825 XM_498829 XM_498831 XM_498852 XM_498883 XM_498884 XM_498889 XM_498894 XM_498901 XM_498902 XM_498907 XM_498913 XM_498932 XM_498943 XM_498945 XM_498946 XM_498962 XM_498988 XM_499005 XM_499008 XM_499010 XM_499012 XM_499015 XM_499022 XM_499044 XM_499047 XM_499051 XM_499063 XM_499082 XM_499085 XM_499103 XM_499104 XM_499105 XM_499118 XM_499130 XM_499147 XM_499176 XM_499182 XM_499272 XM_499295 XM_499298 XM_499343 XM_499391 XM_499392 XM_499512 XM_499536 XM_499572 XM_499579 XM_499581 XM_499583 XM_499589 XM_499596 XM_499597 XM_499602 XR_000167 XR_000182 XR_000216 XR_000227 XR_000273 XR_000275 XR_000293
Genes with multiple seed matches:
NM_000038 NM_000046 NM_000071 NM_000115 NM_000139 NM_000219 NM_000245 NM_000337 NM_000349 NM_000351 NM_000367 NM_000368 NM_000391 NM_000411 NM_000430 NM_000434 NM_000437 NM_000448 NM_000449 NM_000451 NM_000489 NM_000492 NM_000511 NM_000529 NM_000550 NM_000555 NM_000557 NM_000616 NM_000618 NM_000647 NM_000664 NM_000706 NM_000743 NM_000809 NM_000899 NM_000916 NM_001001419 NM_001001420 NM_001001677 NM_001001681 NM_001001684 NM_001001691 NM_001001709 NM_001001928 NM_001001929 NM_001001930 NM_001002814 NM_001002860 NM_001003679 NM_001003712 NM_001004299 NM_001004349 NM_001005387 NM_001005404 NM_001005473 NM_001005474 NM_001006615 NM_001006657 NM_001007024 NM_001007025 NM_001007188 NM_001007214 NM_001007243 NM_001007525 NM_001008226 NM_001008239 NM_001008390 NM_001008401 NM_001008409 NM_001008493 NM_001008537 NM_001008539 NM_001008781 NM_001008801 NM_001009932 NM_001009933 NM_001009934 NM_001010000 NM_001010846 NM_001010883 NM_001010913 NM_001010986 NM_001011666 NM_001012278 NM_001012320 NM_001012361 NM_001012420 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012452 NM_001012626 NM_001012651 NM_001012659 NM_001012707 NM_001012714 NM_001012961 NM_001013000 NM_001013005 NM_001013645 NM_001013656 NM_001013687 NM_001013718 NM_001013721 NM_001013724 NM_001014797 NM_001015045 NM_001015886 NM_001017992 NM_001018050 NM_001018051 NM_001018052 NM_001018057 NM_001018067 NM_001018068 NM_001018069 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018111 NM_001023563 NM_001023567 NM_001024372 NM_001024380 NM_001024381 NM_001024401 NM_001024657 NM_001024660 NM_001024843 NM_001025076 NM_001025077 NM_001025108 NM_001025233 NM_001025247 NM_001025252 NM_001025253 NM_001049 NM_001050 NM_001083 NM_001103 NM_001112 NM_001149 NM_001153 NM_001167 NM_001174 NM_001204 NM_001206 NM_001218 NM_001227 NM_001259 NM_001268 NM_001329 NM_001419 NM_001422 NM_001430 NM_001432 NM_001481 NM_001483 NM_001498 NM_001548 NM_001557 NM_001621 NM_001627 NM_001650 NM_001668 NM_001742 NM_001753 NM_001845 NM_001859 NM_001963 NM_002006 NM_002033 NM_002156 NM_002210 NM_002285 NM_002309 NM_002500 NM_002504 NM_002634 NM_002655 NM_002656 NM_002737 NM_002758 NM_002760 NM_002858 NM_002886 NM_003029 NM_003046 NM_003084 NM_003101 NM_003108 NM_003161 NM_003189 NM_003205 NM_003281 NM_003347 NM_003373 NM_003419 NM_003433 NM_003439 NM_003444 NM_003445 NM_003463 NM_003471 NM_003478 NM_003483 NM_003489 NM_003574 NM_003597 NM_003617 NM_003640 NM_003663 NM_003679 NM_003687 NM_003705 NM_003728 NM_003760 NM_003783 NM_003822 NM_003898 NM_003909 NM_003929 NM_003953 NM_003983 NM_003994 NM_004028 NM_004101 NM_004124 NM_004171 NM_004227 NM_004282 NM_004290 NM_004302 NM_004342 NM_004360 NM_004370 NM_004426 NM_004454 NM_004481 NM_004518 NM_004523 NM_004571 NM_004586 NM_004598 NM_004627 NM_004731 NM_004734 NM_004744 NM_004804 NM_004826 NM_004827 NM_004840 NM_004842 NM_004863 NM_004866 NM_004871 NM_004904 NM_004947 NM_004956 NM_004985 NM_004992 NM_005036 NM_005044 NM_005047 NM_005079 NM_005126 NM_005206 NM_005226 NM_005271 NM_005279 NM_005338 NM_005385 NM_005397 NM_005399 NM_005518 NM_005574 NM_005596 NM_005732 NM_005748 NM_005797 NM_005840 NM_005898 NM_005903 NM_005910 NM_005935 NM_005986 NM_006045 NM_006122 NM_006136 NM_006179 NM_006188 NM_006206 NM_006212 NM_006306 NM_006315 NM_006345 NM_006499 NM_006544 NM_006547 NM_006561 NM_006572 NM_006599 NM_006626 NM_006699 NM_006718 NM_006730 NM_006731 NM_006763 NM_006775 NM_006778 NM_006827 NM_006846 NM_006873 NM_006895 NM_006916 NM_006969 NM_007030 NM_007050 NM_007064 NM_007073 NM_007085 NM_007107 NM_007175 NM_007176 NM_007177 NM_007231 NM_007306 NM_007332 NM_007373 NM_012084 NM_012096 NM_012118 NM_012137 NM_012193 NM_012223 NM_012224 NM_012296 NM_012304 NM_012312 NM_012314 NM_012388 NM_012430 NM_012434 NM_013231 NM_013252 NM_013253 NM_013257 NM_013260 NM_013276 NM_013313 NM_013374 NM_013423 NM_013427 NM_013995 NM_014000 NM_014028 NM_014058 NM_014078 NM_014141 NM_014240 NM_014314 NM_014342 NM_014353 NM_014396 NM_014412 NM_014506 NM_014513 NM_014521 NM_014553 NM_014556 NM_014636 NM_014648 NM_014724 NM_014744 NM_014801 NM_014811 NM_014835 NM_014860 NM_014873 NM_014883 NM_014888 NM_014897 NM_014898 NM_014900 NM_014904 NM_014919 NM_014947 NM_014950 NM_015003 NM_015074 NM_015082 NM_015087 NM_015088 NM_015092 NM_015097 NM_015100 NM_015138 NM_015143 NM_015151 NM_015170 NM_015192 NM_015265 NM_015277 NM_015296 NM_015310 NM_015313 NM_015314 NM_015352 NM_015383 NM_015394 NM_015532 NM_015553 NM_015560 NM_015564 NM_015569 NM_015578 NM_015621 NM_015640 NM_015833 NM_015878 NM_015881 NM_015886 NM_015891 NM_016021 NM_016060 NM_016114 NM_016120 NM_016173 NM_016206 NM_016248 NM_016264 NM_016271 NM_016280 NM_016297 NM_016338 NM_016377 NM_016433 NM_016485 NM_016518 NM_016530 NM_016590 NM_016823 NM_016834 NM_016835 NM_016841 NM_017413 NM_017460 NM_017510 NM_017594 NM_017656 NM_017671 NM_017684 NM_017694 NM_017736 NM_017744 NM_017750 NM_017847 NM_017952 NM_018037 NM_018121 NM_018129 NM_018170 NM_018212 NM_018247 NM_018260 NM_018269 NM_018302 NM_018327 NM_018362 NM_018374 NM_018383 NM_018443 NM_018555 NM_018602 NM_018704 NM_018715 NM_018933 NM_018999 NM_019098 NM_019106 NM_019117 NM_020116 NM_020125 NM_020161 NM_020182 NM_020342 NM_020374 NM_020390 NM_020397 NM_020403 NM_020443 NM_020456 NM_020469 NM_020640 NM_020682 NM_020683 NM_020689 NM_020704 NM_020748 NM_020761 NM_020768 NM_020772 NM_020774 NM_020779 NM_020781 NM_020782 NM_020784 NM_020801 NM_020809 NM_020810 NM_020821 NM_020825 NM_020841 NM_020863 NM_020870 NM_020899 NM_020909 NM_020917 NM_020935 NM_020940 NM_020954 NM_020987 NM_021067 NM_021083 NM_021642 NM_021813 NM_021965 NM_021977 NM_022049 NM_022079 NM_022138 NM_022458 NM_022459 NM_022473 NM_022491 NM_022658 NM_022725 NM_022735 NM_022756 NM_022763 NM_022767 NM_022777 NM_022780 NM_022802 NM_022818 NM_022898 NM_023016 NM_024007 NM_024080 NM_024090 NM_024103 NM_024345 NM_024512 NM_024556 NM_024563 NM_024569 NM_024607 NM_024611 NM_024641 NM_024646 NM_024647 NM_024665 NM_024689 NM_024733 NM_024793 NM_024812 NM_024893 NM_024924 NM_024930 NM_024941 NM_024953 NM_024955 NM_025104 NM_025203 NM_025230 NM_030621 NM_030762 NM_030772 NM_030787 NM_030796 NM_030805 NM_030806 NM_030817 NM_030883 NM_030911 NM_030953 NM_030968 NM_031211 NM_031296 NM_031306 NM_031418 NM_031419 NM_031435 NM_031469 NM_031886 NM_031889 NM_031911 NM_031940 NM_031988 NM_032042 NM_032174 NM_032208 NM_032264 NM_032333 NM_032373 NM_032374 NM_032385 NM_032410 NM_032446 NM_032485 NM_032584 NM_032689 NM_032718 NM_032804 NM_032818 NM_032826 NM_033089 NM_033138 NM_033139 NM_033140 NM_033157 NM_033224 NM_033261 NM_033338 NM_033339 NM_033340 NM_033346 NM_033360 NM_033389 NM_033394 NM_033430 NM_033437 NM_033505 NM_033542 NM_052822 NM_052848 NM_052886 NM_052937 NM_053023 NM_053279 NM_078473 NM_080491 NM_080612 NM_080645 NM_080829 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_133170 NM_133265 NM_133329 NM_133332 NM_133333 NM_133477 NM_133482 NM_133490 NM_133646 NM_134434 NM_138270 NM_138271 NM_138338 NM_138390 NM_138457 NM_138458 NM_138468 NM_138576 NM_138633 NM_138706 NM_138713 NM_138714 NM_138727 NM_138728 NM_138731 NM_139283 NM_144498 NM_144609 NM_144682 NM_144693 NM_144778 NM_144991 NM_145055 NM_145174 NM_145177 NM_145241 NM_145307 NM_145693 NM_147134 NM_147147 NM_147180 NM_147194 NM_148171 NM_148174 NM_152305 NM_152332 NM_152350 NM_152484 NM_152519 NM_152588 NM_152595 NM_152609 NM_152624 NM_152653 NM_152678 NM_152701 NM_152754 NM_152793 NM_152933 NM_152934 NM_152999 NM_153023 NM_153207 NM_153226 NM_153228 NM_153337 NM_153346 NM_153453 NM_153686 NM_153688 NM_153705 NM_153717 NM_170686 NM_170694 NM_170709 NM_172024 NM_172070 NM_172127 NM_172128 NM_172159 NM_172160 NM_172344 NM_172346 NM_173214 NM_173468 NM_173473 NM_173519 NM_173582 NM_173613 NM_173632 NM_173638 NM_173654 NM_173675 NM_173677 NM_173694 NM_173698 NM_173812 NM_173825 NM_173851 NM_173854 NM_175052 NM_175056 NM_175607 NM_175612 NM_175924 NM_176811 NM_177438 NM_177453 NM_177532 NM_178012 NM_178151 NM_178152 NM_178153 NM_178228 NM_178426 NM_178427 NM_178491 NM_178509 NM_181041 NM_181076 NM_181077 NM_181357 NM_181533 NM_181705 NM_181814 NM_182503 NM_182533 NM_182540 NM_182606 NM_182645 NM_182734 NM_182802 NM_182898 NM_182899 NM_182909 NM_183050 NM_183353 NM_183372 NM_183398 NM_183399 NM_183400 NM_183401 NM_194071 NM_194295 NM_194434 NM_197941 NM_197976 NM_198066 NM_198089 NM_198128 NM_198157 NM_198181 NM_198327 NM_198328 NM_198381 NM_198392 NM_198449 NM_198480 NM_198550 NM_198593 NM_198594 NM_198682 NM_198835 NM_198887 NM_199052 NM_199132 NM_199169 NM_199170 NM_199171 NM_199229 NM_199440 NM_201280 NM_201431 NM_201543 NM_201544 NM_201545 NM_201994 NM_203406 NM_203447 NM_203487 NM_205852 NM_205857 NM_205860 NM_206855 NM_206892 NM_206909 NM_206910 NM_206911 NM_206925 NM_207036 NM_207037 NM_207038 NM_207040 NM_207171 NM_207304 NM_207344 NM_207366 NM_207400 NM_207406 NM_207410 NM_207428 NM_207430 NM_207434 NM_207479 NM_207481 NM_207507 NM_207514 NM_207517 NM_207647 NM_212464 NM_212558 NM_213589 XM_031689 XM_032571 XM_038436 XM_039627 XM_039676 XM_042698 XM_043493 XM_044178 XM_044434 XM_047550 XM_047554 XM_047995 XM_048592 XM_059689 XM_087137 XM_113743 XM_171054 XM_208990 XM_212170 XM_290597 XM_290737 XM_290809 XM_291028 XM_291095 XM_291128 XM_294765 XM_370837 XM_370839 XM_370843 XM_370899 XM_370917 XM_371116 XM_371369 XM_372267 XM_373030 XM_373690 XM_374766 XM_374803 XM_374915 XM_374983 XM_375033 XM_375152 XM_375357 XM_375491 XM_375527 XM_375590 XM_375816 XM_375853 XM_375935 XM_376018 XM_376278 XM_376303 XM_376334 XM_376386 XM_376412 XM_376423 XM_376679 XM_376905 XM_376981 XM_377002 XM_378259 XM_378316 XM_378321 XM_378516 XM_378544 XM_378567 XM_378678 XM_378712 XM_378786 XM_379075 XM_379096 XM_379102 XM_379114 XM_379154 XM_379156 XM_379189 XM_379276 XM_379295 XM_379378 XM_379380 XM_379391 XM_379395 XM_379438 XM_379456 XM_379458 XM_379459 XM_379515 XM_379595 XM_379933 XM_380139 XM_495848 XM_495950 XM_496049 XM_496081 XM_496088 XM_496103 XM_496145 XM_496158 XM_496351 XM_496391 XM_496394 XM_496399 XM_496401 XM_496436 XM_496467 XM_496549 XM_496688 XM_496836 XM_496907 XM_497080 XM_497140 XM_498437 XM_498449 XM_498459 XM_498469 XM_498559 XM_498647 XM_498649 XM_498829 XM_498852 XM_498883 XM_498901 XM_498902 XM_498932 XM_498946 XM_499047 XM_499051 XM_499063 XM_499118 XM_499130 XM_499147 XM_499182 XM_499272 XM_499343 XM_499512 XM_499579 XM_499589 XR_000182 XR_000216 XR_000275
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)