VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"gcccauuacaauauuguaac"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
8255
.
Total Genes with multiple seed matches:
3256
.
Genes with at least one seed match:
NM_000016 NM_000017 NM_000024 NM_000027 NM_000028 NM_000031 NM_000038 NM_000046 NM_000048 NM_000050 NM_000052 NM_000056 NM_000066 NM_000067 NM_000072 NM_000074 NM_000081 NM_000089 NM_000090 NM_000091 NM_000092 NM_000097 NM_000104 NM_000109 NM_000110 NM_000112 NM_000114 NM_000115 NM_000116 NM_000118 NM_000123 NM_000125 NM_000128 NM_000132 NM_000133 NM_000134 NM_000138 NM_000140 NM_000141 NM_000142 NM_000144 NM_000152 NM_000153 NM_000158 NM_000161 NM_000163 NM_000167 NM_000176 NM_000183 NM_000192 NM_000194 NM_000195 NM_000199 NM_000210 NM_000212 NM_000213 NM_000214 NM_000216 NM_000219 NM_000223 NM_000230 NM_000232 NM_000235 NM_000237 NM_000240 NM_000242 NM_000245 NM_000246 NM_000248 NM_000250 NM_000252 NM_000253 NM_000262 NM_000264 NM_000266 NM_000267 NM_000268 NM_000274 NM_000275 NM_000277 NM_000289 NM_000293 NM_000297 NM_000299 NM_000303 NM_000311 NM_000313 NM_000314 NM_000317 NM_000326 NM_000328 NM_000330 NM_000332 NM_000341 NM_000342 NM_000343 NM_000346 NM_000348 NM_000349 NM_000351 NM_000352 NM_000358 NM_000361 NM_000362 NM_000367 NM_000369 NM_000372 NM_000373 NM_000376 NM_000378 NM_000379 NM_000381 NM_000382 NM_000385 NM_000388 NM_000391 NM_000393 NM_000406 NM_000410 NM_000411 NM_000415 NM_000416 NM_000418 NM_000428 NM_000430 NM_000433 NM_000434 NM_000435 NM_000437 NM_000438 NM_000441 NM_000448 NM_000450 NM_000451 NM_000452 NM_000457 NM_000458 NM_000459 NM_000466 NM_000474 NM_000484 NM_000489 NM_000495 NM_000499 NM_000503 NM_000508 NM_000510 NM_000511 NM_000512 NM_000522 NM_000529 NM_000533 NM_000538 NM_000539 NM_000547 NM_000551 NM_000553 NM_000555 NM_000565 NM_000569 NM_000570 NM_000573 NM_000574 NM_000575 NM_000577 NM_000579 NM_000586 NM_000593 NM_000599 NM_000609 NM_000610 NM_000611 NM_000614 NM_000617 NM_000618 NM_000620 NM_000621 NM_000623 NM_000627 NM_000629 NM_000631 NM_000633 NM_000635 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000647 NM_000651 NM_000661 NM_000662 NM_000663 NM_000668 NM_000670 NM_000672 NM_000673 NM_000675 NM_000682 NM_000683 NM_000685 NM_000686 NM_000693 NM_000694 NM_000701 NM_000702 NM_000705 NM_000706 NM_000724 NM_000726 NM_000732 NM_000734 NM_000745 NM_000756 NM_000759 NM_000760 NM_000774 NM_000775 NM_000779 NM_000782 NM_000786 NM_000788 NM_000791 NM_000793 NM_000794 NM_000798 NM_000800 NM_000801 NM_000809 NM_000814 NM_000817 NM_000821 NM_000824 NM_000826 NM_000838 NM_000840 NM_000844 NM_000845 NM_000847 NM_000849 NM_000859 NM_000860 NM_000861 NM_000865 NM_000868 NM_000872 NM_000880 NM_000885 NM_000891 NM_000896 NM_000899 NM_000901 NM_000903 NM_000908 NM_000909 NM_000910 NM_000916 NM_000919 NM_000924 NM_000933 NM_000934 NM_000935 NM_000942 NM_000944 NM_000945 NM_000947 NM_000950 NM_000952 NM_000953 NM_000956 NM_000957 NM_000958 NM_000959 NM_000961 NM_000962 NM_000978 NM_000983 NM_000989 NM_000994 NM_000997 NM_000998 NM_001001323 NM_001001342 NM_001001344 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001394 NM_001001395 NM_001001396 NM_001001414 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001483 NM_001001484 NM_001001547 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001557 NM_001001561 NM_001001586 NM_001001653 NM_001001654 NM_001001660 NM_001001665 NM_001001669 NM_001001675 NM_001001681 NM_001001684 NM_001001692 NM_001001695 NM_001001696 NM_001001697 NM_001001699 NM_001001704 NM_001001706 NM_001001707 NM_001001709 NM_001001715 NM_001001789 NM_001001790 NM_001001791 NM_001001851 NM_001001870 NM_001001871 NM_001001873 NM_001001877 NM_001001878 NM_001001890 NM_001001895 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001933 NM_001001935 NM_001001937 NM_001001938 NM_001001971 NM_001001973 NM_001001974 NM_001001976 NM_001001994 NM_001001995 NM_001001996 NM_001002006 NM_001002009 NM_001002010 NM_001002014 NM_001002015 NM_001002019 NM_001002020 NM_001002026 NM_001002233 NM_001002256 NM_001002258 NM_001002260 NM_001002265 NM_001002266 NM_001002295 NM_001002799 NM_001002800 NM_001002811 NM_001002812 NM_001002814 NM_001002838 NM_001002843 NM_001002860 NM_001002862 NM_001002881 NM_001002924 NM_001002926 NM_001003652 NM_001003674 NM_001003675 NM_001003679 NM_001003681 NM_001003688 NM_001003694 NM_001003712 NM_001003725 NM_001003818 NM_001003845 NM_001003945 NM_001003954 NM_001004019 NM_001004051 NM_001004054 NM_001004056 NM_001004057 NM_001004196 NM_001004197 NM_001004285 NM_001004286 NM_001004300 NM_001004301 NM_001004303 NM_001004305 NM_001004313 NM_001004317 NM_001004322 NM_001004323 NM_001004326 NM_001004329 NM_001004330 NM_001004332 NM_001004339 NM_001004348 NM_001004351 NM_001004355 NM_001004360 NM_001004417 NM_001004421 NM_001004422 NM_001004430 NM_001004433 NM_001004434 NM_001004441 NM_001004707 NM_001004720 NM_001004722 NM_001005337 NM_001005339 NM_001005340 NM_001005353 NM_001005354 NM_001005355 NM_001005359 NM_001005364 NM_001005366 NM_001005372 NM_001005386 NM_001005388 NM_001005404 NM_001005409 NM_001005463 NM_001005473 NM_001005474 NM_001005476 NM_001005502 NM_001005505 NM_001005619 NM_001005731 NM_001005738 NM_001005743 NM_001005744 NM_001005745 NM_001005746 NM_001005747 NM_001005753 NM_001005781 NM_001005782 NM_001005849 NM_001005852 NM_001005861 NM_001005909 NM_001005910 NM_001005911 NM_001005912 NM_001005913 NM_001006115 NM_001006600 NM_001006610 NM_001006612 NM_001006613 NM_001006614 NM_001006615 NM_001006623 NM_001006624 NM_001006625 NM_001006639 NM_001006640 NM_001006657 NM_001006658 NM_001006667 NM_001006684 NM_001006932 NM_001006933 NM_001006935 NM_001006936 NM_001006937 NM_001006938 NM_001006939 NM_001006945 NM_001006947 NM_001007023 NM_001007024 NM_001007025 NM_001007072 NM_001007073 NM_001007074 NM_001007075 NM_001007097 NM_001007098 NM_001007102 NM_001007139 NM_001007156 NM_001007157 NM_001007176 NM_001007214 NM_001007224 NM_001007225 NM_001007226 NM_001007227 NM_001007228 NM_001007229 NM_001007230 NM_001007234 NM_001007237 NM_001007243 NM_001007245 NM_001007246 NM_001007257 NM_001007267 NM_001007277 NM_001007466 NM_001007469 NM_001007525 NM_001007534 NM_001007536 NM_001007538 NM_001007542 NM_001007543 NM_001007545 NM_001007546 NM_001007553 NM_001007559 NM_001007793 NM_001007794 NM_001008211 NM_001008212 NM_001008213 NM_001008224 NM_001008226 NM_001008235 NM_001008236 NM_001008239 NM_001008390 NM_001008391 NM_001008392 NM_001008393 NM_001008394 NM_001008396 NM_001008408 NM_001008411 NM_001008493 NM_001008495 NM_001008536 NM_001008537 NM_001008539 NM_001008544 NM_001008564 NM_001008568 NM_001008569 NM_001008570 NM_001008571 NM_001008693 NM_001008703 NM_001008704 NM_001008710 NM_001008711 NM_001008726 NM_001008738 NM_001008779 NM_001008781 NM_001008800 NM_001008801 NM_001008844 NM_001008883 NM_001008895 NM_001008917 NM_001008925 NM_001008938 NM_001009551 NM_001009553 NM_001009554 NM_001009555 NM_001009566 NM_001009567 NM_001009569 NM_001009570 NM_001009571 NM_001009584 NM_001009598 NM_001009611 NM_001009812 NM_001009880 NM_001009894 NM_001009899 NM_001009909 NM_001009913 NM_001009922 NM_001009923 NM_001009924 NM_001009925 NM_001009954 NM_001009957 NM_001009958 NM_001009959 NM_001009993 NM_001009994 NM_001009996 NM_001010000 NM_001010850 NM_001010852 NM_001010853 NM_001010864 NM_001010867 NM_001010871 NM_001010882 NM_001010883 NM_001010888 NM_001010890 NM_001010891 NM_001010892 NM_001010913 NM_001010915 NM_001010923 NM_001010924 NM_001010934 NM_001010942 NM_001010971 NM_001010980 NM_001010983 NM_001010984 NM_001010986 NM_001011513 NM_001011514 NM_001011515 NM_001011516 NM_001011537 NM_001011539 NM_001011544 NM_001011545 NM_001011546 NM_001011551 NM_001011553 NM_001011554 NM_001011656 NM_001011657 NM_001011658 NM_001011663 NM_001011666 NM_001011708 NM_001011709 NM_001011713 NM_001011720 NM_001011885 NM_001012239 NM_001012264 NM_001012267 NM_001012274 NM_001012276 NM_001012300 NM_001012320 NM_001012329 NM_001012339 NM_001012361 NM_001012393 NM_001012410 NM_001012412 NM_001012414 NM_001012418 NM_001012419 NM_001012420 NM_001012421 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012452 NM_001012506 NM_001012511 NM_001012515 NM_001012643 NM_001012651 NM_001012715 NM_001012729 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012754 NM_001012755 NM_001012756 NM_001012761 NM_001012763 NM_001012968 NM_001012979 NM_001012980 NM_001012981 NM_001012989 NM_001012993 NM_001013406 NM_001013407 NM_001013436 NM_001013437 NM_001013438 NM_001013439 NM_001013440 NM_001013442 NM_001013615 NM_001013633 NM_001013655 NM_001013659 NM_001013670 NM_001013674 NM_001013675 NM_001013676 NM_001013679 NM_001013680 NM_001013681 NM_001013688 NM_001013690 NM_001013691 NM_001013695 NM_001013696 NM_001013697 NM_001013698 NM_001013699 NM_001013701 NM_001013707 NM_001013710 NM_001013711 NM_001013712 NM_001013713 NM_001013715 NM_001013718 NM_001013719 NM_001013721 NM_001013727 NM_001013734 NM_001013743 NM_001013839 NM_001013842 NM_001013843 NM_001014342 NM_001014380 NM_001014439 NM_001014765 NM_001014797 NM_001014809 NM_001014812 NM_001014972 NM_001015045 NM_001015048 NM_001015049 NM_001015051 NM_001015053 NM_001015877 NM_001015880 NM_001015881 NM_001015882 NM_001015883 NM_001015885 NM_001015886 NM_001015887 NM_001017368 NM_001017370 NM_001017371 NM_001017388 NM_001017392 NM_001017395 NM_001017396 NM_001017405 NM_001017408 NM_001017420 NM_001017424 NM_001017425 NM_001017434 NM_001017440 NM_001017524 NM_001017526 NM_001017535 NM_001017916 NM_001017917 NM_001017918 NM_001017920 NM_001017923 NM_001017926 NM_001017927 NM_001017928 NM_001017963 NM_001017972 NM_001017975 NM_001017979 NM_001017980 NM_001017989 NM_001017995 NM_001017998 NM_001018009 NM_001018037 NM_001018053 NM_001018054 NM_001018055 NM_001018056 NM_001018057 NM_001018058 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018080 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018108 NM_001018109 NM_001018111 NM_001018113 NM_001018122 NM_001018159 NM_001018160 NM_001018676 NM_001018677 NM_001020658 NM_001023562 NM_001023563 NM_001023567 NM_001023582 NM_001024024 NM_001024070 NM_001024071 NM_001024094 NM_001024216 NM_001024226 NM_001024227 NM_001024228 NM_001024380 NM_001024381 NM_001024401 NM_001024455 NM_001024592 NM_001024593 NM_001024596 NM_001024630 NM_001024646 NM_001024649 NM_001024660 NM_001024667 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024680 NM_001024683 NM_001024688 NM_001024736 NM_001024843 NM_001024845 NM_001024847 NM_001024855 NM_001024912 NM_001024921 NM_001024943 NM_001024944 NM_001024946 NM_001024948 NM_001024956 NM_001025 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025105 NM_001025107 NM_001025108 NM_001025109 NM_001025201 NM_001025231 NM_001025232 NM_001025247 NM_001025252 NM_001025253 NM_001025266 NM_001034 NM_001036 NM_001041 NM_001047 NM_001049 NM_001050 NM_001067 NM_001069 NM_001078 NM_001080 NM_001083 NM_001084 NM_001093 NM_001095 NM_001096 NM_001099 NM_001100 NM_001103 NM_001110 NM_001111 NM_001112 NM_001114 NM_001117 NM_001122 NM_001123 NM_001124 NM_001125 NM_001126 NM_001128 NM_001133 NM_001144 NM_001146 NM_001148 NM_001149 NM_001153 NM_001154 NM_001156 NM_001157 NM_001158 NM_001159 NM_001160 NM_001165 NM_001167 NM_001172 NM_001174 NM_001177 NM_001178 NM_001181 NM_001186 NM_001187 NM_001189 NM_001198 NM_001204 NM_001205 NM_001206 NM_001211 NM_001218 NM_001219 NM_001224 NM_001233 NM_001238 NM_001241 NM_001242 NM_001245 NM_001246 NM_001259 NM_001268 NM_001269 NM_001270 NM_001273 NM_001274 NM_001278 NM_001282 NM_001286 NM_001290 NM_001293 NM_001299 NM_001304 NM_001305 NM_001310 NM_001313 NM_001315 NM_001316 NM_001324 NM_001326 NM_001329 NM_001330 NM_001332 NM_001334 NM_001337 NM_001343 NM_001347 NM_001351 NM_001356 NM_001358 NM_001363 NM_001379 NM_001382 NM_001385 NM_001386 NM_001387 NM_001389 NM_001390 NM_001393 NM_001395 NM_001396 NM_001401 NM_001407 NM_001412 NM_001414 NM_001417 NM_001419 NM_001420 NM_001422 NM_001423 NM_001427 NM_001429 NM_001430 NM_001432 NM_001438 NM_001439 NM_001440 NM_001448 NM_001449 NM_001450 NM_001451 NM_001452 NM_001457 NM_001460 NM_001462 NM_001463 NM_001470 NM_001480 NM_001483 NM_001490 NM_001494 NM_001495 NM_001497 NM_001498 NM_001503 NM_001511 NM_001518 NM_001530 NM_001532 NM_001542 NM_001543 NM_001546 NM_001547 NM_001550 NM_001554 NM_001556 NM_001557 NM_001559 NM_001560 NM_001570 NM_001584 NM_001616 NM_001619 NM_001620 NM_001621 NM_001623 NM_001624 NM_001627 NM_001632 NM_001633 NM_001634 NM_001642 NM_001650 NM_001655 NM_001656 NM_001657 NM_001658 NM_001663 NM_001668 NM_001670 NM_001678 NM_001679 NM_001681 NM_001682 NM_001684 NM_001688 NM_001689 NM_001690 NM_001704 NM_001706 NM_001709 NM_001712 NM_001713 NM_001718 NM_001723 NM_001725 NM_001730 NM_001731 NM_001735 NM_001736 NM_001742 NM_001743 NM_001745 NM_001746 NM_001748 NM_001752 NM_001754 NM_001755 NM_001757 NM_001759 NM_001763 NM_001766 NM_001768 NM_001769 NM_001773 NM_001777 NM_001779 NM_001781 NM_001788 NM_001789 NM_001791 NM_001797 NM_001798 NM_001799 NM_001800 NM_001806 NM_001809 NM_001812 NM_001814 NM_001821 NM_001822 NM_001830 NM_001831 NM_001845 NM_001854 NM_001855 NM_001858 NM_001859 NM_001860 NM_001872 NM_001874 NM_001877 NM_001880 NM_001882 NM_001884 NM_001889 NM_001892 NM_001893 NM_001894 NM_001895 NM_001901 NM_001904 NM_001915 NM_001918 NM_001929 NM_001931 NM_001933 NM_001935 NM_001941 NM_001945 NM_001946 NM_001949 NM_001950 NM_001951 NM_001952 NM_001957 NM_001963 NM_001964 NM_001965 NM_001966 NM_001968 NM_001969 NM_001980 NM_001981 NM_001982 NM_001984 NM_001987 NM_001995 NM_001997 NM_001998 NM_001999 NM_002001 NM_002006 NM_002009 NM_002013 NM_002014 NM_002015 NM_002017 NM_002024 NM_002025 NM_002026 NM_002027 NM_002028 NM_002030 NM_002033 NM_002035 NM_002039 NM_002042 NM_002044 NM_002049 NM_002051 NM_002054 NM_002055 NM_002063 NM_002064 NM_002065 NM_002066 NM_002069 NM_002074 NM_002076 NM_002077 NM_002089 NM_002092 NM_002094 NM_002099 NM_002104 NM_002106 NM_002108 NM_002111 NM_002126 NM_002127 NM_002128 NM_002129 NM_002130 NM_002135 NM_002137 NM_002139 NM_002140 NM_002142 NM_002147 NM_002158 NM_002164 NM_002166 NM_002182 NM_002187 NM_002199 NM_002210 NM_002211 NM_002222 NM_002226 NM_002228 NM_002232 NM_002233 NM_002234 NM_002239 NM_002240 NM_002241 NM_002242 NM_002243 NM_002247 NM_002250 NM_002259 NM_002260 NM_002265 NM_002267 NM_002268 NM_002271 NM_002285 NM_002293 NM_002296 NM_002306 NM_002310 NM_002312 NM_002332 NM_002333 NM_002335 NM_002342 NM_002345 NM_002349 NM_002351 NM_002353 NM_002354 NM_002355 NM_002356 NM_002357 NM_002358 NM_002359 NM_002363 NM_002364 NM_002365 NM_002374 NM_002375 NM_002380 NM_002381 NM_002388 NM_002389 NM_002397 NM_002398 NM_002408 NM_002416 NM_002417 NM_002432 NM_002438 NM_002439 NM_002440 NM_002444 NM_002449 NM_002451 NM_002460 NM_002463 NM_002469 NM_002473 NM_002478 NM_002479 NM_002480 NM_002482 NM_002485 NM_002489 NM_002490 NM_002494 NM_002499 NM_002500 NM_002501 NM_002505 NM_002509 NM_002510 NM_002514 NM_002515 NM_002518 NM_002519 NM_002522 NM_002523 NM_002524 NM_002532 NM_002539 NM_002540 NM_002545 NM_002552 NM_002561 NM_002563 NM_002564 NM_002568 NM_002569 NM_002576 NM_002577 NM_002578 NM_002581 NM_002586 NM_002594 NM_002595 NM_002599 NM_002600 NM_002601 NM_002604 NM_002608 NM_002609 NM_002610 NM_002612 NM_002613 NM_002614 NM_002623 NM_002627 NM_002628 NM_002631 NM_002639 NM_002640 NM_002641 NM_002649 NM_002655 NM_002656 NM_002657 NM_002658 NM_002660 NM_002662 NM_002667 NM_002677 NM_002687 NM_002697 NM_002703 NM_002706 NM_002709 NM_002710 NM_002711 NM_002713 NM_002715 NM_002716 NM_002718 NM_002719 NM_002725 NM_002730 NM_002731 NM_002736 NM_002737 NM_002738 NM_002740 NM_002742 NM_002745 NM_002755 NM_002758 NM_002760 NM_002767 NM_002768 NM_002772 NM_002781 NM_002783 NM_002785 NM_002789 NM_002792 NM_002796 NM_002800 NM_002803 NM_002806 NM_002811 NM_002813 NM_002816 NM_002819 NM_002822 NM_002823 NM_002827 NM_002828 NM_002831 NM_002833 NM_002834 NM_002835 NM_002836 NM_002838 NM_002839 NM_002841 NM_002844 NM_002845 NM_002847 NM_002848 NM_002849 NM_002851 NM_002852 NM_002853 NM_002857 NM_002858 NM_002862 NM_002868 NM_002869 NM_002873 NM_002874 NM_002886 NM_002888 NM_002890 NM_002892 NM_002895 NM_002897 NM_002898 NM_002901 NM_002902 NM_002906 NM_002912 NM_002913 NM_002915 NM_002916 NM_002918 NM_002922 NM_002925 NM_002928 NM_002937 NM_002940 NM_002941 NM_002942 NM_002946 NM_002947 NM_002948 NM_002957 NM_002958 NM_002967 NM_002968 NM_002971 NM_002973 NM_002977 NM_002982 NM_002983 NM_002986 NM_002989 NM_002995 NM_002998 NM_002999 NM_003003 NM_003010 NM_003011 NM_003012 NM_003013 NM_003014 NM_003016 NM_003017 NM_003021 NM_003022 NM_003023 NM_003025 NM_003031 NM_003036 NM_003038 NM_003042 NM_003043 NM_003045 NM_003046 NM_003048 NM_003062 NM_003068 NM_003070 NM_003071 NM_003074 NM_003077 NM_003079 NM_003081 NM_003088 NM_003090 NM_003096 NM_003101 NM_003103 NM_003104 NM_003106 NM_003107 NM_003108 NM_003110 NM_003111 NM_003112 NM_003113 NM_003114 NM_003118 NM_003130 NM_003133 NM_003136 NM_003137 NM_003142 NM_003144 NM_003150 NM_003151 NM_003152 NM_003155 NM_003157 NM_003161 NM_003165 NM_003174 NM_003176 NM_003178 NM_003181 NM_003182 NM_003183 NM_003185 NM_003189 NM_003192 NM_003198 NM_003199 NM_003200 NM_003203 NM_003205 NM_003206 NM_003211 NM_003212 NM_003215 NM_003216 NM_003217 NM_003218 NM_003223 NM_003234 NM_003238 NM_003240 NM_003242 NM_003243 NM_003246 NM_003247 NM_003251 NM_003252 NM_003255 NM_003257 NM_003262 NM_003265 NM_003269 NM_003270 NM_003274 NM_003281 NM_003286 NM_003290 NM_003291 NM_003304 NM_003309 NM_003317 NM_003318 NM_003320 NM_003325 NM_003326 NM_003329 NM_003335 NM_003336 NM_003337 NM_003339 NM_003340 NM_003341 NM_003342 NM_003347 NM_003349 NM_003350 NM_003352 NM_003356 NM_003359 NM_003363 NM_003371 NM_003372 NM_003374 NM_003378 NM_003379 NM_003381 NM_003383 NM_003387 NM_003388 NM_003390 NM_003391 NM_003392 NM_003400 NM_003403 NM_003404 NM_003405 NM_003406 NM_003407 NM_003411 NM_003412 NM_003413 NM_003415 NM_003417 NM_003420 NM_003423 NM_003425 NM_003434 NM_003435 NM_003438 NM_003440 NM_003447 NM_003449 NM_003453 NM_003457 NM_003458 NM_003462 NM_003463 NM_003468 NM_003472 NM_003473 NM_003474 NM_003476 NM_003478 NM_003483 NM_003487 NM_003488 NM_003489 NM_003490 NM_003496 NM_003498 NM_003503 NM_003504 NM_003505 NM_003506 NM_003507 NM_003558 NM_003559 NM_003563 NM_003565 NM_003574 NM_003581 NM_003583 NM_003589 NM_003590 NM_003591 NM_003602 NM_003603 NM_003605 NM_003607 NM_003610 NM_003611 NM_003615 NM_003617 NM_003618 NM_003620 NM_003621 NM_003622 NM_003626 NM_003627 NM_003628 NM_003629 NM_003633 NM_003637 NM_003640 NM_003643 NM_003647 NM_003648 NM_003656 NM_003657 NM_003660 NM_003662 NM_003663 NM_003664 NM_003666 NM_003668 NM_003670 NM_003671 NM_003672 NM_003679 NM_003681 NM_003686 NM_003701 NM_003705 NM_003712 NM_003713 NM_003714 NM_003715 NM_003716 NM_003718 NM_003720 NM_003722 NM_003724 NM_003725 NM_003727 NM_003731 NM_003743 NM_003744 NM_003749 NM_003750 NM_003754 NM_003759 NM_003760 NM_003762 NM_003763 NM_003766 NM_003770 NM_003772 NM_003773 NM_003774 NM_003778 NM_003781 NM_003783 NM_003784 NM_003791 NM_003793 NM_003794 NM_003795 NM_003796 NM_003797 NM_003798 NM_003799 NM_003800 NM_003805 NM_003810 NM_003812 NM_003818 NM_003822 NM_003831 NM_003839 NM_003842 NM_003848 NM_003850 NM_003856 NM_003860 NM_003861 NM_003869 NM_003870 NM_003872 NM_003873 NM_003881 NM_003884 NM_003885 NM_003888 NM_003895 NM_003896 NM_003899 NM_003900 NM_003901 NM_003905 NM_003909 NM_003910 NM_003913 NM_003914 NM_003916 NM_003918 NM_003919 NM_003921 NM_003922 NM_003927 NM_003930 NM_003932 NM_003938 NM_003949 NM_003950 NM_003951 NM_003953 NM_003954 NM_003956 NM_003958 NM_003966 NM_003968 NM_003971 NM_003972 NM_003980 NM_003983 NM_003986 NM_003994 NM_003998 NM_004004 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004028 NM_004034 NM_004035 NM_004046 NM_004054 NM_004056 NM_004060 NM_004064 NM_004066 NM_004071 NM_004074 NM_004079 NM_004080 NM_004089 NM_004093 NM_004094 NM_004096 NM_004098 NM_004099 NM_004105 NM_004108 NM_004113 NM_004119 NM_004124 NM_004125 NM_004128 NM_004129 NM_004134 NM_004136 NM_004143 NM_004153 NM_004155 NM_004157 NM_004161 NM_004162 NM_004165 NM_004168 NM_004170 NM_004171 NM_004180 NM_004184 NM_004187 NM_004200 NM_004205 NM_004206 NM_004216 NM_004226 NM_004227 NM_004228 NM_004232 NM_004233 NM_004235 NM_004237 NM_004241 NM_004242 NM_004249 NM_004251 NM_004252 NM_004253 NM_004261 NM_004264 NM_004268 NM_004272 NM_004273 NM_004274 NM_004282 NM_004286 NM_004287 NM_004288 NM_004290 NM_004294 NM_004302 NM_004304 NM_004306 NM_004316 NM_004320 NM_004326 NM_004329 NM_004330 NM_004331 NM_004337 NM_004338 NM_004342 NM_004344 NM_004346 NM_004348 NM_004349 NM_004362 NM_004367 NM_004369 NM_004370 NM_004376 NM_004379 NM_004380 NM_004392 NM_004397 NM_004401 NM_004402 NM_004405 NM_004407 NM_004414 NM_004415 NM_004426 NM_004427 NM_004430 NM_004432 NM_004437 NM_004438 NM_004439 NM_004440 NM_004441 NM_004444 NM_004449 NM_004454 NM_004457 NM_004458 NM_004459 NM_004460 NM_004464 NM_004472 NM_004480 NM_004482 NM_004483 NM_004488 NM_004492 NM_004493 NM_004494 NM_004496 NM_004499 NM_004501 NM_004502 NM_004504 NM_004505 NM_004506 NM_004507 NM_004508 NM_004516 NM_004518 NM_004519 NM_004520 NM_004521 NM_004525 NM_004526 NM_004527 NM_004531 NM_004535 NM_004537 NM_004538 NM_004539 NM_004549 NM_004559 NM_004560 NM_004565 NM_004566 NM_004567 NM_004569 NM_004571 NM_004575 NM_004580 NM_004582 NM_004586 NM_004591 NM_004592 NM_004598 NM_004604 NM_004612 NM_004613 NM_004616 NM_004619 NM_004621 NM_004622 NM_004624 NM_004626 NM_004627 NM_004630 NM_004631 NM_004634 NM_004641 NM_004642 NM_004645 NM_004646 NM_004650 NM_004652 NM_004653 NM_004654 NM_004655 NM_004656 NM_004660 NM_004663 NM_004668 NM_004670 NM_004675 NM_004681 NM_004683 NM_004685 NM_004686 NM_004690 NM_004693 NM_004694 NM_004696 NM_004702 NM_004709 NM_004715 NM_004717 NM_004720 NM_004724 NM_004725 NM_004727 NM_004728 NM_004730 NM_004731 NM_004733 NM_004735 NM_004737 NM_004738 NM_004742 NM_004745 NM_004747 NM_004748 NM_004755 NM_004757 NM_004759 NM_004762 NM_004765 NM_004770 NM_004771 NM_004772 NM_004774 NM_004775 NM_004776 NM_004779 NM_004780 NM_004781 NM_004786 NM_004787 NM_004788 NM_004795 NM_004796 NM_004798 NM_004808 NM_004814 NM_004817 NM_004823 NM_004829 NM_004830 NM_004833 NM_004834 NM_004835 NM_004839 NM_004840 NM_004841 NM_004844 NM_004847 NM_004848 NM_004849 NM_004858 NM_004859 NM_004862 NM_004863 NM_004866 NM_004871 NM_004873 NM_004879 NM_004882 NM_004888 NM_004893 NM_004895 NM_004896 NM_004897 NM_004898 NM_004902 NM_004904 NM_004906 NM_004909 NM_004912 NM_004914 NM_004921 NM_004922 NM_004923 NM_004926 NM_004929 NM_004932 NM_004936 NM_004947 NM_004949 NM_004951 NM_004956 NM_004959 NM_004960 NM_004962 NM_004964 NM_004965 NM_004966 NM_004972 NM_004973 NM_004975 NM_004981 NM_004982 NM_004985 NM_004991 NM_004992 NM_004996 NM_004999 NM_005000 NM_005006 NM_005007 NM_005009 NM_005010 NM_005012 NM_005014 NM_005016 NM_005021 NM_005036 NM_005038 NM_005040 NM_005042 NM_005044 NM_005045 NM_005047 NM_005048 NM_005049 NM_005056 NM_005063 NM_005065 NM_005066 NM_005068 NM_005069 NM_005076 NM_005077 NM_005079 NM_005082 NM_005086 NM_005087 NM_005088 NM_005093 NM_005100 NM_005101 NM_005104 NM_005109 NM_005114 NM_005116 NM_005117 NM_005121 NM_005123 NM_005124 NM_005126 NM_005127 NM_005128 NM_005140 NM_005146 NM_005147 NM_005148 NM_005149 NM_005151 NM_005153 NM_005164 NM_005168 NM_005169 NM_005174 NM_005177 NM_005178 NM_005180 NM_005184 NM_005188 NM_005191 NM_005195 NM_005197 NM_005199 NM_005202 NM_005204 NM_005219 NM_005226 NM_005228 NM_005231 NM_005232 NM_005233 NM_005235 NM_005239 NM_005240 NM_005242 NM_005245 NM_005249 NM_005252 NM_005254 NM_005255 NM_005257 NM_005259 NM_005261 NM_005263 NM_005264 NM_005270 NM_005271 NM_005277 NM_005278 NM_005307 NM_005308 NM_005311 NM_005312 NM_005313 NM_005318 NM_005324 NM_005327 NM_005329 NM_005334 NM_005338 NM_005342 NM_005346 NM_005347 NM_005348 NM_005353 NM_005354 NM_005357 NM_005358 NM_005359 NM_005366 NM_005369 NM_005374 NM_005375 NM_005378 NM_005380 NM_005381 NM_005385 NM_005386 NM_005387 NM_005388 NM_005389 NM_005390 NM_005397 NM_005399 NM_005400 NM_005407 NM_005409 NM_005412 NM_005416 NM_005417 NM_005418 NM_005426 NM_005429 NM_005430 NM_005433 NM_005436 NM_005439 NM_005442 NM_005443 NM_005445 NM_005455 NM_005456 NM_005460 NM_005461 NM_005462 NM_005463 NM_005466 NM_005467 NM_005470 NM_005471 NM_005474 NM_005479 NM_005482 NM_005483 NM_005486 NM_005487 NM_005491 NM_005494 NM_005496 NM_005499 NM_005500 NM_005502 NM_005503 NM_005504 NM_005506 NM_005509 NM_005511 NM_005513 NM_005520 NM_005522 NM_005523 NM_005525 NM_005529 NM_005530 NM_005534 NM_005536 NM_005539 NM_005542 NM_005544 NM_005561 NM_005565 NM_005566 NM_005570 NM_005573 NM_005575 NM_005578 NM_005584 NM_005585 NM_005587 NM_005588 NM_005589 NM_005593 NM_005595 NM_005602 NM_005604 NM_005610 NM_005611 NM_005613 NM_005614 NM_005618 NM_005627 NM_005632 NM_005637 NM_005638 NM_005639 NM_005642 NM_005643 NM_005644 NM_005647 NM_005650 NM_005651 NM_005655 NM_005656 NM_005662 NM_005663 NM_005664 NM_005665 NM_005667 NM_005668 NM_005669 NM_005676 NM_005680 NM_005681 NM_005682 NM_005688 NM_005692 NM_005694 NM_005701 NM_005704 NM_005708 NM_005715 NM_005717 NM_005721 NM_005722 NM_005724 NM_005725 NM_005730 NM_005735 NM_005737 NM_005738 NM_005739 NM_005742 NM_005744 NM_005748 NM_005749 NM_005751 NM_005754 NM_005760 NM_005765 NM_005766 NM_005776 NM_005779 NM_005780 NM_005783 NM_005786 NM_005792 NM_005795 NM_005797 NM_005802 NM_005806 NM_005808 NM_005813 NM_005816 NM_005819 NM_005822 NM_005824 NM_005828 NM_005831 NM_005832 NM_005835 NM_005839 NM_005840 NM_005841 NM_005842 NM_005843 NM_005848 NM_005853 NM_005857 NM_005858 NM_005859 NM_005863 NM_005865 NM_005868 NM_005869 NM_005870 NM_005871 NM_005877 NM_005880 NM_005882 NM_005885 NM_005886 NM_005894 NM_005896 NM_005897 NM_005898 NM_005899 NM_005900 NM_005901 NM_005902 NM_005903 NM_005904 NM_005906 NM_005907 NM_005910 NM_005911 NM_005920 NM_005922 NM_005923 NM_005924 NM_005930 NM_005931 NM_005933 NM_005935 NM_005937 NM_005940 NM_005944 NM_005964 NM_005965 NM_005966 NM_005969 NM_005977 NM_005982 NM_005986 NM_005989 NM_005996 NM_005998 NM_005999 NM_006010 NM_006013 NM_006016 NM_006021 NM_006022 NM_006023 NM_006030 NM_006034 NM_006035 NM_006037 NM_006040 NM_006045 NM_006047 NM_006060 NM_006063 NM_006064 NM_006065 NM_006067 NM_006077 NM_006089 NM_006090 NM_006094 NM_006095 NM_006096 NM_006099 NM_006106 NM_006113 NM_006115 NM_006116 NM_006117 NM_006122 NM_006129 NM_006134 NM_006135 NM_006136 NM_006139 NM_006143 NM_006145 NM_006151 NM_006153 NM_006154 NM_006157 NM_006159 NM_006160 NM_006162 NM_006166 NM_006177 NM_006183 NM_006185 NM_006186 NM_006195 NM_006196 NM_006198 NM_006202 NM_006203 NM_006206 NM_006207 NM_006208 NM_006209 NM_006212 NM_006228 NM_006230 NM_006232 NM_006235 NM_006237 NM_006239 NM_006241 NM_006243 NM_006247 NM_006251 NM_006253 NM_006254 NM_006255 NM_006257 NM_006264 NM_006265 NM_006266 NM_006267 NM_006273 NM_006275 NM_006276 NM_006282 NM_006283 NM_006290 NM_006291 NM_006293 NM_006294 NM_006304 NM_006305 NM_006306 NM_006307 NM_006313 NM_006315 NM_006320 NM_006322 NM_006323 NM_006330 NM_006333 NM_006337 NM_006338 NM_006343 NM_006345 NM_006353 NM_006354 NM_006355 NM_006357 NM_006358 NM_006359 NM_006362 NM_006364 NM_006366 NM_006371 NM_006375 NM_006378 NM_006379 NM_006380 NM_006386 NM_006388 NM_006390 NM_006393 NM_006401 NM_006403 NM_006407 NM_006408 NM_006414 NM_006416 NM_006417 NM_006418 NM_006420 NM_006429 NM_006439 NM_006441 NM_006449 NM_006451 NM_006454 NM_006457 NM_006459 NM_006460 NM_006464 NM_006465 NM_006472 NM_006473 NM_006474 NM_006476 NM_006479 NM_006481 NM_006482 NM_006489 NM_006491 NM_006493 NM_006496 NM_006504 NM_006505 NM_006508 NM_006516 NM_006521 NM_006526 NM_006527 NM_006529 NM_006534 NM_006536 NM_006537 NM_006538 NM_006540 NM_006541 NM_006544 NM_006546 NM_006547 NM_006548 NM_006549 NM_006555 NM_006558 NM_006559 NM_006560 NM_006561 NM_006565 NM_006571 NM_006572 NM_006574 NM_006575 NM_006578 NM_006581 NM_006587 NM_006589 NM_006593 NM_006595 NM_006596 NM_006597 NM_006599 NM_006602 NM_006603 NM_006614 NM_006620 NM_006624 NM_006626 NM_006628 NM_006631 NM_006633 NM_006643 NM_006644 NM_006646 NM_006648 NM_006658 NM_006660 NM_006661 NM_006665 NM_006667 NM_006675 NM_006681 NM_006684 NM_006685 NM_006691 NM_006698 NM_006699 NM_006700 NM_006703 NM_006704 NM_006706 NM_006708 NM_006710 NM_006713 NM_006716 NM_006717 NM_006718 NM_006721 NM_006722 NM_006724 NM_006729 NM_006731 NM_006734 NM_006738 NM_006742 NM_006746 NM_006747 NM_006749 NM_006751 NM_006752 NM_006754 NM_006756 NM_006761 NM_006763 NM_006769 NM_006772 NM_006773 NM_006777 NM_006783 NM_006790 NM_006793 NM_006803 NM_006805 NM_006807 NM_006809 NM_006813 NM_006822 NM_006823 NM_006824 NM_006826 NM_006827 NM_006842 NM_006855 NM_006857 NM_006867 NM_006868 NM_006870 NM_006873 NM_006883 NM_006888 NM_006889 NM_006892 NM_006895 NM_006902 NM_006905 NM_006910 NM_006915 NM_006918 NM_006922 NM_006924 NM_006925 NM_006930 NM_006931 NM_006934 NM_006937 NM_006940 NM_006948 NM_006951 NM_006955 NM_006963 NM_006965 NM_006969 NM_006981 NM_006984 NM_006989 NM_006991 NM_006993 NM_006995 NM_006996 NM_006997 NM_007005 NM_007006 NM_007007 NM_007008 NM_007011 NM_007014 NM_007017 NM_007022 NM_007023 NM_007027 NM_007031 NM_007033 NM_007035 NM_007036 NM_007038 NM_007040 NM_007041 NM_007043 NM_007045 NM_007049 NM_007050 NM_007052 NM_007055 NM_007062 NM_007064 NM_007068 NM_007071 NM_007072 NM_007073 NM_007079 NM_007080 NM_007084 NM_007085 NM_007086 NM_007106 NM_007110 NM_007123 NM_007125 NM_007126 NM_007127 NM_007129 NM_007137 NM_007144 NM_007145 NM_007146 NM_007148 NM_007150 NM_007157 NM_007158 NM_007159 NM_007162 NM_007168 NM_007170 NM_007171 NM_007173 NM_007174 NM_007175 NM_007176 NM_007177 NM_007178 NM_007187 NM_007190 NM_007191 NM_007192 NM_007197 NM_007198 NM_007199 NM_007200 NM_007202 NM_007203 NM_007212 NM_007214 NM_007217 NM_007220 NM_007222 NM_007223 NM_007227 NM_007229 NM_007231 NM_007233 NM_007238 NM_007246 NM_007249 NM_007257 NM_007269 NM_007271 NM_007275 NM_007276 NM_007278 NM_007282 NM_007285 NM_007292 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007328 NM_007331 NM_007345 NM_007346 NM_007347 NM_007351 NM_007353 NM_007356 NM_007357 NM_007361 NM_007362 NM_007368 NM_007375 NM_009585 NM_009590 NM_012068 NM_012072 NM_012073 NM_012074 NM_012080 NM_012082 NM_012083 NM_012086 NM_012089 NM_012090 NM_012092 NM_012093 NM_012095 NM_012096 NM_012098 NM_012102 NM_012104 NM_012106 NM_012115 NM_012120 NM_012125 NM_012128 NM_012129 NM_012135 NM_012137 NM_012141 NM_012142 NM_012151 NM_012153 NM_012156 NM_012161 NM_012170 NM_012173 NM_012174 NM_012175 NM_012177 NM_012179 NM_012180 NM_012188 NM_012193 NM_012198 NM_012199 NM_012204 NM_012215 NM_012219 NM_012223 NM_012225 NM_012226 NM_012229 NM_012231 NM_012233 NM_012236 NM_012238 NM_012239 NM_012241 NM_012242 NM_012244 NM_012245 NM_012247 NM_012248 NM_012249 NM_012252 NM_012255 NM_012258 NM_012259 NM_012262 NM_012266 NM_012271 NM_012275 NM_012279 NM_012280 NM_012281 NM_012286 NM_012287 NM_012288 NM_012290 NM_012295 NM_012296 NM_012297 NM_012300 NM_012301 NM_012302 NM_012304 NM_012306 NM_012311 NM_012318 NM_012322 NM_012325 NM_012327 NM_012328 NM_012329 NM_012333 NM_012339 NM_012341 NM_012342 NM_012345 NM_012382 NM_012388 NM_012392 NM_012394 NM_012395 NM_012397 NM_012399 NM_012405 NM_012406 NM_012409 NM_012411 NM_012414 NM_012415 NM_012419 NM_012420 NM_012423 NM_012424 NM_012425 NM_012426 NM_012428 NM_012431 NM_012434 NM_012446 NM_012453 NM_012455 NM_012461 NM_012463 NM_012464 NM_012465 NM_012473 NM_012479 NM_013229 NM_013230 NM_013231 NM_013233 NM_013236 NM_013242 NM_013243 NM_013251 NM_013252 NM_013253 NM_013254 NM_013255 NM_013256 NM_013257 NM_013261 NM_013262 NM_013263 NM_013275 NM_013276 NM_013277 NM_013283 NM_013290 NM_013293 NM_013302 NM_013306 NM_013309 NM_013313 NM_013315 NM_013316 NM_013320 NM_013322 NM_013323 NM_013332 NM_013341 NM_013354 NM_013355 NM_013368 NM_013371 NM_013372 NM_013374 NM_013375 NM_013377 NM_013380 NM_013381 NM_013382 NM_013386 NM_013390 NM_013396 NM_013410 NM_013416 NM_013423 NM_013427 NM_013437 NM_013438 NM_013443 NM_013444 NM_013446 NM_013450 NM_013451 NM_013937 NM_013943 NM_013979 NM_013980 NM_013989 NM_013995 NM_013996 NM_013997 NM_013998 NM_013999 NM_014003 NM_014005 NM_014007 NM_014010 NM_014011 NM_014012 NM_014016 NM_014021 NM_014028 NM_014033 NM_014034 NM_014039 NM_014043 NM_014044 NM_014046 NM_014048 NM_014050 NM_014056 NM_014058 NM_014059 NM_014071 NM_014077 NM_014078 NM_014080 NM_014089 NM_014098 NM_014106 NM_014110 NM_014112 NM_014117 NM_014142 NM_014143 NM_014145 NM_014154 NM_014155 NM_014157 NM_014159 NM_014160 NM_014166 NM_014170 NM_014171 NM_014206 NM_014207 NM_014211 NM_014212 NM_014217 NM_014220 NM_014226 NM_014243 NM_014245 NM_014249 NM_014250 NM_014251 NM_014257 NM_014258 NM_014265 NM_014266 NM_014267 NM_014271 NM_014275 NM_014279 NM_014282 NM_014283 NM_014285 NM_014288 NM_014292 NM_014293 NM_014294 NM_014300 NM_014305 NM_014306 NM_014313 NM_014319 NM_014323 NM_014324 NM_014326 NM_014331 NM_014335 NM_014336 NM_014342 NM_014350 NM_014351 NM_014357 NM_014359 NM_014360 NM_014361 NM_014363 NM_014368 NM_014372 NM_014382 NM_014385 NM_014386 NM_014388 NM_014393 NM_014394 NM_014395 NM_014396 NM_014397 NM_014398 NM_014399 NM_014405 NM_014411 NM_014412 NM_014415 NM_014421 NM_014429 NM_014438 NM_014442 NM_014444 NM_014451 NM_014455 NM_014456 NM_014458 NM_014459 NM_014462 NM_014468 NM_014469 NM_014472 NM_014485 NM_014487 NM_014494 NM_014497 NM_014498 NM_014499 NM_014502 NM_014504 NM_014518 NM_014521 NM_014547 NM_014548 NM_014554 NM_014563 NM_014564 NM_014570 NM_014573 NM_014574 NM_014575 NM_014577 NM_014584 NM_014585 NM_014586 NM_014587 NM_014588 NM_014591 NM_014602 NM_014607 NM_014611 NM_014613 NM_014614 NM_014615 NM_014616 NM_014618 NM_014623 NM_014631 NM_014634 NM_014635 NM_014646 NM_014647 NM_014648 NM_014653 NM_014656 NM_014660 NM_014663 NM_014666 NM_014667 NM_014668 NM_014669 NM_014670 NM_014673 NM_014674 NM_014675 NM_014676 NM_014679 NM_014682 NM_014683 NM_014686 NM_014689 NM_014699 NM_014701 NM_014702 NM_014704 NM_014706 NM_014707 NM_014711 NM_014714 NM_014715 NM_014717 NM_014719 NM_014720 NM_014724 NM_014729 NM_014735 NM_014736 NM_014737 NM_014739 NM_014742 NM_014743 NM_014744 NM_014746 NM_014751 NM_014755 NM_014756 NM_014758 NM_014760 NM_014761 NM_014765 NM_014766 NM_014767 NM_014770 NM_014774 NM_014776 NM_014779 NM_014781 NM_014783 NM_014784 NM_014787 NM_014789 NM_014791 NM_014792 NM_014795 NM_014800 NM_014801 NM_014802 NM_014803 NM_014805 NM_014809 NM_014810 NM_014811 NM_014812 NM_014813 NM_014815 NM_014819 NM_014820 NM_014821 NM_014826 NM_014827 NM_014828 NM_014829 NM_014830 NM_014832 NM_014836 NM_014838 NM_014839 NM_014841 NM_014844 NM_014848 NM_014849 NM_014850 NM_014854 NM_014858 NM_014859 NM_014860 NM_014862 NM_014864 NM_014865 NM_014867 NM_014871 NM_014872 NM_014873 NM_014875 NM_014876 NM_014879 NM_014880 NM_014883 NM_014885 NM_014886 NM_014887 NM_014888 NM_014891 NM_014892 NM_014893 NM_014895 NM_014897 NM_014898 NM_014903 NM_014904 NM_014905 NM_014906 NM_014909 NM_014910 NM_014912 NM_014913 NM_014918 NM_014919 NM_014920 NM_014923 NM_014924 NM_014926 NM_014929 NM_014930 NM_014935 NM_014936 NM_014937 NM_014939 NM_014940 NM_014943 NM_014944 NM_014945 NM_014946 NM_014947 NM_014948 NM_014949 NM_014950 NM_014951 NM_014952 NM_014953 NM_014957 NM_014959 NM_014961 NM_014962 NM_014964 NM_014965 NM_014974 NM_014988 NM_014990 NM_014991 NM_014996 NM_014999 NM_015002 NM_015003 NM_015008 NM_015015 NM_015017 NM_015020 NM_015022 NM_015025 NM_015027 NM_015032 NM_015033 NM_015039 NM_015040 NM_015045 NM_015046 NM_015049 NM_015051 NM_015053 NM_015054 NM_015055 NM_015056 NM_015057 NM_015061 NM_015064 NM_015066 NM_015070 NM_015071 NM_015074 NM_015076 NM_015077 NM_015080 NM_015084 NM_015087 NM_015088 NM_015090 NM_015091 NM_015092 NM_015093 NM_015097 NM_015100 NM_015115 NM_015125 NM_015137 NM_015138 NM_015141 NM_015143 NM_015144 NM_015149 NM_015151 NM_015153 NM_015155 NM_015157 NM_015161 NM_015163 NM_015166 NM_015167 NM_015170 NM_015173 NM_015176 NM_015180 NM_015184 NM_015185 NM_015187 NM_015190 NM_015191 NM_015192 NM_015193 NM_015199 NM_015200 NM_015205 NM_015206 NM_015208 NM_015214 NM_015215 NM_015216 NM_015219 NM_015224 NM_015225 NM_015226 NM_015230 NM_015231 NM_015234 NM_015236 NM_015246 NM_015247 NM_015251 NM_015253 NM_015254 NM_015257 NM_015261 NM_015264 NM_015265 NM_015266 NM_015267 NM_015271 NM_015272 NM_015275 NM_015277 NM_015278 NM_015286 NM_015288 NM_015289 NM_015293 NM_015294 NM_015296 NM_015299 NM_015308 NM_015310 NM_015313 NM_015314 NM_015315 NM_015317 NM_015318 NM_015323 NM_015326 NM_015328 NM_015329 NM_015331 NM_015332 NM_015335 NM_015336 NM_015344 NM_015345 NM_015347 NM_015349 NM_015352 NM_015353 NM_015355 NM_015358 NM_015359 NM_015362 NM_015367 NM_015375 NM_015378 NM_015379 NM_015385 NM_015387 NM_015391 NM_015393 NM_015394 NM_015396 NM_015397 NM_015401 NM_015409 NM_015416 NM_015419 NM_015423 NM_015429 NM_015431 NM_015434 NM_015436 NM_015443 NM_015446 NM_015450 NM_015453 NM_015455 NM_015458 NM_015461 NM_015463 NM_015464 NM_015469 NM_015471 NM_015472 NM_015475 NM_015476 NM_015484 NM_015485 NM_015493 NM_015497 NM_015507 NM_015508 NM_015515 NM_015516 NM_015522 NM_015523 NM_015525 NM_015527 NM_015530 NM_015532 NM_015541 NM_015542 NM_015549 NM_015550 NM_015553 NM_015554 NM_015560 NM_015564 NM_015565 NM_015568 NM_015569 NM_015570 NM_015571 NM_015575 NM_015576 NM_015577 NM_015578 NM_015595 NM_015601 NM_015604 NM_015605 NM_015630 NM_015634 NM_015635 NM_015640 NM_015641 NM_015646 NM_015659 NM_015675 NM_015678 NM_015679 NM_015690 NM_015691 NM_015693 NM_015695 NM_015696 NM_015702 NM_015713 NM_015721 NM_015723 NM_015833 NM_015834 NM_015836 NM_015837 NM_015840 NM_015841 NM_015865 NM_015866 NM_015872 NM_015878 NM_015881 NM_015886 NM_015891 NM_015898 NM_015901 NM_015902 NM_015904 NM_015907 NM_015914 NM_015916 NM_015919 NM_015920 NM_015928 NM_015932 NM_015933 NM_015942 NM_015947 NM_015955 NM_015960 NM_015962 NM_015967 NM_015971 NM_015974 NM_015975 NM_015976 NM_015978 NM_015986 NM_015989 NM_015990 NM_015994 NM_015995 NM_015997 NM_016002 NM_016004 NM_016009 NM_016018 NM_016019 NM_016021 NM_016022 NM_016023 NM_016025 NM_016026 NM_016034 NM_016037 NM_016040 NM_016045 NM_016046 NM_016048 NM_016052 NM_016057 NM_016060 NM_016062 NM_016063 NM_016065 NM_016070 NM_016072 NM_016073 NM_016074 NM_016076 NM_016078 NM_016079 NM_016081 NM_016083 NM_016087 NM_016096 NM_016097 NM_016098 NM_016100 NM_016101 NM_016103 NM_016107 NM_016108 NM_016114 NM_016115 NM_016119 NM_016120 NM_016121 NM_016123 NM_016125 NM_016127 NM_016128 NM_016132 NM_016133 NM_016138 NM_016142 NM_016144 NM_016146 NM_016147 NM_016155 NM_016162 NM_016169 NM_016194 NM_016195 NM_016200 NM_016205 NM_016206 NM_016217 NM_016218 NM_016221 NM_016224 NM_016226 NM_016227 NM_016228 NM_016231 NM_016234 NM_016248 NM_016249 NM_016255 NM_016261 NM_016262 NM_016269 NM_016271 NM_016272 NM_016275 NM_016277 NM_016279 NM_016281 NM_016284 NM_016289 NM_016291 NM_016297 NM_016298 NM_016301 NM_016302 NM_016303 NM_016304 NM_016305 NM_016310 NM_016312 NM_016315 NM_016318 NM_016321 NM_016322 NM_016331 NM_016338 NM_016340 NM_016353 NM_016355 NM_016356 NM_016357 NM_016359 NM_016360 NM_016369 NM_016371 NM_016374 NM_016376 NM_016382 NM_016388 NM_016389 NM_016396 NM_016397 NM_016399 NM_016410 NM_016413 NM_016418 NM_016422 NM_016424 NM_016426 NM_016427 NM_016430 NM_016433 NM_016436 NM_016441 NM_016442 NM_016445 NM_016448 NM_016452 NM_016467 NM_016470 NM_016472 NM_016475 NM_016480 NM_016482 NM_016484 NM_016488 NM_016489 NM_016500 NM_016513 NM_016520 NM_016530 NM_016531 NM_016533 NM_016536 NM_016540 NM_016541 NM_016542 NM_016543 NM_016544 NM_016551 NM_016556 NM_016557 NM_016562 NM_016567 NM_016569 NM_016571 NM_016575 NM_016577 NM_016580 NM_016586 NM_016587 NM_016591 NM_016593 NM_016596 NM_016605 NM_016607 NM_016608 NM_016613 NM_016617 NM_016621 NM_016622 NM_016623 NM_016625 NM_016628 NM_016640 NM_016648 NM_016649 NM_016652 NM_016654 NM_016656 NM_016831 NM_016834 NM_016835 NM_016836 NM_016839 NM_016841 NM_016941 NM_016950 NM_017412 NM_017413 NM_017414 NM_017415 NM_017420 NM_017423 NM_017426 NM_017435 NM_017437 NM_017440 NM_017443 NM_017444 NM_017455 NM_017456 NM_017457 NM_017460 NM_017482 NM_017484 NM_017487 NM_017489 NM_017493 NM_017495 NM_017515 NM_017516 NM_017522 NM_017523 NM_017527 NM_017544 NM_017545 NM_017548 NM_017551 NM_017554 NM_017556 NM_017564 NM_017572 NM_017577 NM_017582 NM_017585 NM_017593 NM_017594 NM_017599 NM_017610 NM_017612 NM_017628 NM_017629 NM_017631 NM_017632 NM_017635 NM_017637 NM_017638 NM_017640 NM_017641 NM_017643 NM_017644 NM_017645 NM_017654 NM_017655 NM_017656 NM_017660 NM_017661 NM_017662 NM_017664 NM_017665 NM_017667 NM_017669 NM_017670 NM_017671 NM_017673 NM_017682 NM_017684 NM_017692 NM_017693 NM_017694 NM_017700 NM_017705 NM_017709 NM_017719 NM_017724 NM_017729 NM_017730 NM_017734 NM_017736 NM_017737 NM_017741 NM_017742 NM_017748 NM_017749 NM_017751 NM_017757 NM_017761 NM_017762 NM_017768 NM_017769 NM_017770 NM_017772 NM_017773 NM_017775 NM_017778 NM_017779 NM_017780 NM_017785 NM_017786 NM_017789 NM_017791 NM_017798 NM_017801 NM_017802 NM_017810 NM_017811 NM_017813 NM_017818 NM_017821 NM_017822 NM_017831 NM_017833 NM_017839 NM_017841 NM_017845 NM_017846 NM_017847 NM_017848 NM_017850 NM_017851 NM_017853 NM_017872 NM_017873 NM_017880 NM_017883 NM_017884 NM_017896 NM_017897 NM_017902 NM_017905 NM_017913 NM_017915 NM_017918 NM_017919 NM_017920 NM_017922 NM_017923 NM_017924 NM_017927 NM_017928 NM_017929 NM_017936 NM_017938 NM_017945 NM_017946 NM_017951 NM_017952 NM_017953 NM_017954 NM_017964 NM_017968 NM_017974 NM_017975 NM_017977 NM_017988 NM_017990 NM_017993 NM_017998 NM_018000 NM_018003 NM_018004 NM_018011 NM_018018 NM_018023 NM_018024 NM_018031 NM_018038 NM_018040 NM_018045 NM_018046 NM_018048 NM_018057 NM_018059 NM_018061 NM_018069 NM_018079 NM_018082 NM_018084 NM_018088 NM_018092 NM_018093 NM_018094 NM_018098 NM_018099 NM_018101 NM_018103 NM_018105 NM_018109 NM_018110 NM_018112 NM_018114 NM_018117 NM_018120 NM_018121 NM_018126 NM_018130 NM_018131 NM_018132 NM_018133 NM_018137 NM_018142 NM_018146 NM_018149 NM_018150 NM_018151 NM_018152 NM_018155 NM_018156 NM_018158 NM_018159 NM_018169 NM_018170 NM_018171 NM_018172 NM_018176 NM_018177 NM_018178 NM_018180 NM_018181 NM_018184 NM_018186 NM_018189 NM_018191 NM_018196 NM_018197 NM_018199 NM_018200 NM_018202 NM_018204 NM_018206 NM_018207 NM_018208 NM_018211 NM_018212 NM_018214 NM_018215 NM_018221 NM_018223 NM_018227 NM_018229 NM_018237 NM_018244 NM_018247 NM_018248 NM_018252 NM_018254 NM_018257 NM_018264 NM_018268 NM_018269 NM_018272 NM_018282 NM_018283 NM_018284 NM_018285 NM_018286 NM_018290 NM_018292 NM_018298 NM_018299 NM_018303 NM_018304 NM_018307 NM_018323 NM_018327 NM_018330 NM_018332 NM_018339 NM_018342 NM_018346 NM_018351 NM_018353 NM_018361 NM_018362 NM_018364 NM_018365 NM_018367 NM_018369 NM_018370 NM_018371 NM_018372 NM_018374 NM_018375 NM_018379 NM_018385 NM_018386 NM_018387 NM_018394 NM_018396 NM_018401 NM_018404 NM_018405 NM_018413 NM_018415 NM_018416 NM_018420 NM_018424 NM_018427 NM_018437 NM_018438 NM_018439 NM_018440 NM_018441 NM_018443 NM_018444 NM_018445 NM_018446 NM_018447 NM_018448 NM_018449 NM_018452 NM_018454 NM_018457 NM_018464 NM_018471 NM_018473 NM_018475 NM_018476 NM_018479 NM_018482 NM_018488 NM_018489 NM_018490 NM_018518 NM_018557 NM_018566 NM_018569 NM_018579 NM_018602 NM_018622 NM_018638 NM_018640 NM_018650 NM_018651 NM_018652 NM_018657 NM_018658 NM_018660 NM_018661 NM_018667 NM_018668 NM_018672 NM_018674 NM_018682 NM_018685 NM_018686 NM_018689 NM_018691 NM_018693 NM_018695 NM_018698 NM_018700 NM_018703 NM_018712 NM_018718 NM_018724 NM_018728 NM_018834 NM_018835 NM_018836 NM_018837 NM_018841 NM_018844 NM_018846 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018931 NM_018933 NM_018938 NM_018939 NM_018940 NM_018945 NM_018957 NM_018959 NM_018961 NM_018962 NM_018970 NM_018976 NM_018977 NM_018992 NM_018993 NM_018999 NM_019000 NM_019001 NM_019002 NM_019006 NM_019007 NM_019008 NM_019009 NM_019011 NM_019012 NM_019013 NM_019018 NM_019020 NM_019021 NM_019022 NM_019024 NM_019025 NM_019026 NM_019027 NM_019028 NM_019034 NM_019036 NM_019042 NM_019045 NM_019061 NM_019063 NM_019066 NM_019069 NM_019080 NM_019081 NM_019083 NM_019084 NM_019086 NM_019087 NM_019091 NM_019094 NM_019095 NM_019098 NM_019106 NM_019114 NM_019119 NM_019555 NM_019556 NM_019559 NM_019590 NM_019591 NM_019610 NM_019613 NM_019618 NM_019843 NM_019844 NM_019845 NM_019850 NM_019852 NM_019859 NM_019860 NM_019862 NM_019863 NM_019884 NM_019885 NM_019886 NM_019894 NM_019895 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020039 NM_020066 NM_020116 NM_020119 NM_020121 NM_020122 NM_020123 NM_020124 NM_020125 NM_020127 NM_020130 NM_020131 NM_020133 NM_020139 NM_020143 NM_020147 NM_020148 NM_020151 NM_020152 NM_020159 NM_020161 NM_020163 NM_020164 NM_020165 NM_020177 NM_020178 NM_020182 NM_020185 NM_020193 NM_020194 NM_020195 NM_020197 NM_020198 NM_020199 NM_020207 NM_020208 NM_020213 NM_020214 NM_020215 NM_020228 NM_020231 NM_020235 NM_020238 NM_020239 NM_020242 NM_020245 NM_020247 NM_020248 NM_020300 NM_020311 NM_020313 NM_020317 NM_020318 NM_020319 NM_020335 NM_020337 NM_020338 NM_020340 NM_020341 NM_020342 NM_020346 NM_020348 NM_020360 NM_020362 NM_020367 NM_020368 NM_020374 NM_020377 NM_020379 NM_020381 NM_020383 NM_020384 NM_020390 NM_020398 NM_020399 NM_020401 NM_020403 NM_020405 NM_020416 NM_020425 NM_020426 NM_020428 NM_020429 NM_020432 NM_020436 NM_020437 NM_020445 NM_020448 NM_020453 NM_020455 NM_020456 NM_020462 NM_020463 NM_020466 NM_020472 NM_020473 NM_020474 NM_020525 NM_020532 NM_020536 NM_020546 NM_020630 NM_020638 NM_020639 NM_020640 NM_020644 NM_020647 NM_020648 NM_020651 NM_020652 NM_020654 NM_020657 NM_020661 NM_020662 NM_020665 NM_020666 NM_020673 NM_020674 NM_020686 NM_020689 NM_020697 NM_020699 NM_020703 NM_020704 NM_020708 NM_020711 NM_020713 NM_020714 NM_020715 NM_020724 NM_020727 NM_020728 NM_020731 NM_020738 NM_020739 NM_020742 NM_020747 NM_020748 NM_020749 NM_020750 NM_020751 NM_020753 NM_020754 NM_020755 NM_020760 NM_020762 NM_020766 NM_020768 NM_020769 NM_020770 NM_020771 NM_020772 NM_020773 NM_020774 NM_020775 NM_020777 NM_020779 NM_020782 NM_020783 NM_020786 NM_020791 NM_020792 NM_020795 NM_020796 NM_020800 NM_020801 NM_020802 NM_020805 NM_020808 NM_020810 NM_020814 NM_020820 NM_020821 NM_020824 NM_020825 NM_020828 NM_020834 NM_020841 NM_020843 NM_020844 NM_020856 NM_020858 NM_020860 NM_020861 NM_020865 NM_020866 NM_020867 NM_020868 NM_020870 NM_020871 NM_020873 NM_020890 NM_020894 NM_020897 NM_020905 NM_020909 NM_020917 NM_020918 NM_020919 NM_020922 NM_020924 NM_020925 NM_020933 NM_020935 NM_020940 NM_020943 NM_020947 NM_020948 NM_020951 NM_020957 NM_020959 NM_020961 NM_020962 NM_020965 NM_020971 NM_020975 NM_020977 NM_020980 NM_020981 NM_020982 NM_020987 NM_020988 NM_020992 NM_020997 NM_021003 NM_021005 NM_021016 NM_021023 NM_021032 NM_021033 NM_021038 NM_021044 NM_021045 NM_021063 NM_021064 NM_021069 NM_021070 NM_021079 NM_021083 NM_021088 NM_021089 NM_021090 NM_021101 NM_021109 NM_021110 NM_021111 NM_021116 NM_021126 NM_021127 NM_021133 NM_021135 NM_021140 NM_021144 NM_021145 NM_021146 NM_021147 NM_021149 NM_021154 NM_021155 NM_021156 NM_021163 NM_021167 NM_021181 NM_021183 NM_021184 NM_021189 NM_021190 NM_021194 NM_021199 NM_021201 NM_021212 NM_021215 NM_021216 NM_021217 NM_021218 NM_021219 NM_021222 NM_021238 NM_021239 NM_021240 NM_021242 NM_021249 NM_021252 NM_021255 NM_021269 NM_021572 NM_021614 NM_021619 NM_021622 NM_021624 NM_021627 NM_021629 NM_021638 NM_021639 NM_021642 NM_021643 NM_021645 NM_021648 NM_021649 NM_021705 NM_021724 NM_021735 NM_021736 NM_021737 NM_021738 NM_021783 NM_021784 NM_021804 NM_021809 NM_021813 NM_021814 NM_021815 NM_021818 NM_021824 NM_021825 NM_021826 NM_021832 NM_021903 NM_021904 NM_021905 NM_021906 NM_021912 NM_021914 NM_021927 NM_021928 NM_021933 NM_021935 NM_021940 NM_021942 NM_021943 NM_021945 NM_021949 NM_021950 NM_021951 NM_021957 NM_021958 NM_021960 NM_021961 NM_021965 NM_021966 NM_021967 NM_021969 NM_021977 NM_021980 NM_021988 NM_021992 NM_022039 NM_022041 NM_022045 NM_022049 NM_022050 NM_022051 NM_022054 NM_022058 NM_022059 NM_022060 NM_022062 NM_022068 NM_022070 NM_022072 NM_022074 NM_022079 NM_022080 NM_022087 NM_022088 NM_022090 NM_022097 NM_022100 NM_022104 NM_022106 NM_022112 NM_022114 NM_022116 NM_022118 NM_022119 NM_022121 NM_022130 NM_022131 NM_022133 NM_022136 NM_022137 NM_022139 NM_022143 NM_022149 NM_022150 NM_022152 NM_022153 NM_022160 NM_022162 NM_022164 NM_022169 NM_022171 NM_022304 NM_022333 NM_022338 NM_022343 NM_022351 NM_022362 NM_022368 NM_022374 NM_022405 NM_022442 NM_022445 NM_022458 NM_022459 NM_022461 NM_022465 NM_022466 NM_022469 NM_022473 NM_022474 NM_022475 NM_022482 NM_022483 NM_022484 NM_022487 NM_022491 NM_022495 NM_022549 NM_022552 NM_022567 NM_022571 NM_022650 NM_022652 NM_022658 NM_022662 NM_022663 NM_022716 NM_022725 NM_022726 NM_022737 NM_022739 NM_022742 NM_022745 NM_022752 NM_022753 NM_022754 NM_022755 NM_022756 NM_022757 NM_022758 NM_022761 NM_022763 NM_022767 NM_022771 NM_022776 NM_022777 NM_022780 NM_022782 NM_022786 NM_022802 NM_022810 NM_022817 NM_022818 NM_022824 NM_022828 NM_022829 NM_022832 NM_022836 NM_022837 NM_022838 NM_022839 NM_022840 NM_022842 NM_022843 NM_022845 NM_022893 NM_022894 NM_022897 NM_022898 NM_022899 NM_022900 NM_022902 NM_022912 NM_022913 NM_022917 NM_022965 NM_022969 NM_022970 NM_022972 NM_022975 NM_022977 NM_022978 NM_023000 NM_023001 NM_023005 NM_023009 NM_023011 NM_023012 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023036 NM_023037 NM_023072 NM_023073 NM_023074 NM_023075 NM_023076 NM_023077 NM_023107 NM_023108 NM_023914 NM_023920 NM_023923 NM_023928 NM_023934 NM_023938 NM_023940 NM_024016 NM_024019 NM_024037 NM_024054 NM_024061 NM_024068 NM_024072 NM_024076 NM_024081 NM_024086 NM_024090 NM_024095 NM_024099 NM_024102 NM_024110 NM_024116 NM_024292 NM_024293 NM_024294 NM_024295 NM_024297 NM_024308 NM_024312 NM_024315 NM_024320 NM_024324 NM_024330 NM_024331 NM_024332 NM_024334 NM_024335 NM_024336 NM_024337 NM_024345 NM_024408 NM_024419 NM_024422 NM_024423 NM_024424 NM_024425 NM_024426 NM_024430 NM_024490 NM_024491 NM_024493 NM_024496 NM_024498 NM_024501 NM_024510 NM_024526 NM_024527 NM_024529 NM_024539 NM_024545 NM_024548 NM_024557 NM_024560 NM_024561 NM_024563 NM_024567 NM_024569 NM_024573 NM_024574 NM_024581 NM_024584 NM_024587 NM_024593 NM_024594 NM_024595 NM_024605 NM_024607 NM_024610 NM_024611 NM_024613 NM_024614 NM_024624 NM_024625 NM_024627 NM_024628 NM_024629 NM_024632 NM_024636 NM_024638 NM_024639 NM_024640 NM_024641 NM_024646 NM_024647 NM_024649 NM_024665 NM_024666 NM_024669 NM_024672 NM_024674 NM_024675 NM_024677 NM_024680 NM_024685 NM_024686 NM_024689 NM_024692 NM_024698 NM_024699 NM_024700 NM_024701 NM_024702 NM_024711 NM_024713 NM_024727 NM_024738 NM_024740 NM_024743 NM_024745 NM_024755 NM_024756 NM_024761 NM_024768 NM_024769 NM_024770 NM_024771 NM_024772 NM_024778 NM_024779 NM_024780 NM_024781 NM_024783 NM_024787 NM_024789 NM_024793 NM_024795 NM_024811 NM_024814 NM_024818 NM_024824 NM_024828 NM_024831 NM_024834 NM_024837 NM_024841 NM_024847 NM_024852 NM_024854 NM_024857 NM_024861 NM_024863 NM_024869 NM_024873 NM_024878 NM_024881 NM_024882 NM_024896 NM_024899 NM_024900 NM_024906 NM_024908 NM_024913 NM_024915 NM_024918 NM_024920 NM_024921 NM_024922 NM_024924 NM_024938 NM_024941 NM_024944 NM_024946 NM_024947 NM_024948 NM_024949 NM_024953 NM_024955 NM_024963 NM_024969 NM_024974 NM_024989 NM_024993 NM_024996 NM_024997 NM_025000 NM_025009 NM_025010 NM_025027 NM_025030 NM_025040 NM_025045 NM_025047 NM_025049 NM_025054 NM_025057 NM_025059 NM_025063 NM_025073 NM_025074 NM_025087 NM_025090 NM_025104 NM_025115 NM_025132 NM_025133 NM_025134 NM_025136 NM_025138 NM_025146 NM_025147 NM_025151 NM_025154 NM_025160 NM_025161 NM_025164 NM_025169 NM_025187 NM_025191 NM_025201 NM_025202 NM_025205 NM_025213 NM_025214 NM_025215 NM_025235 NM_025237 NM_025238 NM_025240 NM_025243 NM_025247 NM_025251 NM_025264 NM_025265 NM_030379 NM_030380 NM_030381 NM_030569 NM_030571 NM_030576 NM_030581 NM_030583 NM_030621 NM_030623 NM_030625 NM_030627 NM_030633 NM_030634 NM_030636 NM_030639 NM_030640 NM_030648 NM_030650 NM_030661 NM_030664 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030673 NM_030751 NM_030755 NM_030759 NM_030762 NM_030763 NM_030764 NM_030766 NM_030768 NM_030769 NM_030773 NM_030777 NM_030780 NM_030787 NM_030791 NM_030796 NM_030799 NM_030803 NM_030806 NM_030808 NM_030811 NM_030817 NM_030820 NM_030821 NM_030824 NM_030881 NM_030884 NM_030906 NM_030907 NM_030911 NM_030915 NM_030918 NM_030920 NM_030923 NM_030934 NM_030936 NM_030937 NM_030939 NM_030944 NM_030945 NM_030956 NM_030960 NM_030962 NM_030963 NM_030964 NM_030965 NM_030978 NM_031208 NM_031209 NM_031211 NM_031216 NM_031217 NM_031243 NM_031246 NM_031262 NM_031263 NM_031266 NM_031267 NM_031268 NM_031271 NM_031272 NM_031279 NM_031292 NM_031296 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031372 NM_031409 NM_031411 NM_031416 NM_031417 NM_031418 NM_031419 NM_031423 NM_031426 NM_031431 NM_031435 NM_031437 NM_031438 NM_031439 NM_031442 NM_031443 NM_031444 NM_031450 NM_031452 NM_031453 NM_031455 NM_031461 NM_031462 NM_031463 NM_031465 NM_031468 NM_031469 NM_031476 NM_031480 NM_031482 NM_031483 NM_031496 NM_031844 NM_031845 NM_031846 NM_031847 NM_031849 NM_031850 NM_031857 NM_031858 NM_031860 NM_031862 NM_031866 NM_031886 NM_031887 NM_031888 NM_031899 NM_031911 NM_031912 NM_031924 NM_031935 NM_031939 NM_031940 NM_031942 NM_031943 NM_031948 NM_031954 NM_031956 NM_031966 NM_031988 NM_031989 NM_031990 NM_031991 NM_031994 NM_032012 NM_032016 NM_032017 NM_032018 NM_032021 NM_032038 NM_032042 NM_032043 NM_032047 NM_032048 NM_032049 NM_032050 NM_032052 NM_032102 NM_032109 NM_032116 NM_032120 NM_032121 NM_032124 NM_032136 NM_032138 NM_032143 NM_032144 NM_032145 NM_032146 NM_032148 NM_032151 NM_032153 NM_032154 NM_032165 NM_032169 NM_032175 NM_032177 NM_032189 NM_032192 NM_032208 NM_032221 NM_032227 NM_032228 NM_032229 NM_032231 NM_032239 NM_032242 NM_032250 NM_032257 NM_032279 NM_032280 NM_032281 NM_032283 NM_032285 NM_032287 NM_032288 NM_032289 NM_032291 NM_032293 NM_032295 NM_032300 NM_032303 NM_032307 NM_032320 NM_032329 NM_032334 NM_032335 NM_032347 NM_032351 NM_032352 NM_032354 NM_032357 NM_032358 NM_032361 NM_032368 NM_032374 NM_032379 NM_032408 NM_032410 NM_032413 NM_032420 NM_032421 NM_032423 NM_032424 NM_032431 NM_032432 NM_032433 NM_032435 NM_032436 NM_032438 NM_032439 NM_032440 NM_032441 NM_032445 NM_032446 NM_032449 NM_032458 NM_032467 NM_032471 NM_032486 NM_032491 NM_032492 NM_032498 NM_032499 NM_032505 NM_032507 NM_032509 NM_032510 NM_032513 NM_032521 NM_032523 NM_032524 NM_032532 NM_032539 NM_032545 NM_032547 NM_032549 NM_032552 NM_032556 NM_032558 NM_032560 NM_032565 NM_032567 NM_032569 NM_032576 NM_032581 NM_032582 NM_032583 NM_032588 NM_032590 NM_032594 NM_032606 NM_032611 NM_032621 NM_032622 NM_032625 NM_032626 NM_032632 NM_032644 NM_032663 NM_032664 NM_032682 NM_032706 NM_032711 NM_032717 NM_032718 NM_032737 NM_032738 NM_032740 NM_032780 NM_032783 NM_032797 NM_032800 NM_032801 NM_032808 NM_032810 NM_032811 NM_032813 NM_032815 NM_032817 NM_032818 NM_032823 NM_032825 NM_032826 NM_032828 NM_032832 NM_032833 NM_032838 NM_032839 NM_032842 NM_032846 NM_032857 NM_032858 NM_032859 NM_032860 NM_032861 NM_032863 NM_032866 NM_032869 NM_032873 NM_032876 NM_032886 NM_032895 NM_032900 NM_032905 NM_032906 NM_032910 NM_032918 NM_032920 NM_032926 NM_032932 NM_032943 NM_032951 NM_032952 NM_032953 NM_032954 NM_032955 NM_032960 NM_032967 NM_032968 NM_032969 NM_032971 NM_032972 NM_032973 NM_032975 NM_032980 NM_032982 NM_032983 NM_032984 NM_032988 NM_032991 NM_032994 NM_032998 NM_032999 NM_033000 NM_033001 NM_033012 NM_033016 NM_033017 NM_033027 NM_033035 NM_033044 NM_033051 NM_033052 NM_033055 NM_033059 NM_033061 NM_033071 NM_033083 NM_033084 NM_033090 NM_033091 NM_033100 NM_033103 NM_033106 NM_033107 NM_033114 NM_033117 NM_033118 NM_033121 NM_033125 NM_033128 NM_033129 NM_033133 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033143 NM_033151 NM_033157 NM_033158 NM_033161 NM_033181 NM_033182 NM_033201 NM_033206 NM_033207 NM_033210 NM_033211 NM_033212 NM_033213 NM_033222 NM_033224 NM_033226 NM_033227 NM_033228 NM_033239 NM_033240 NM_033242 NM_033244 NM_033245 NM_033250 NM_033252 NM_033253 NM_033254 NM_033260 NM_033262 NM_033266 NM_033272 NM_033274 NM_033281 NM_033285 NM_033291 NM_033296 NM_033300 NM_033302 NM_033305 NM_033326 NM_033331 NM_033342 NM_033346 NM_033360 NM_033364 NM_033380 NM_033381 NM_033387 NM_033389 NM_033393 NM_033394 NM_033402 NM_033411 NM_033421 NM_033426 NM_033427 NM_033428 NM_033430 NM_033437 NM_033439 NM_033501 NM_033502 NM_033505 NM_033512 NM_033515 NM_033516 NM_033535 NM_033540 NM_033542 NM_033548 NM_033549 NM_033550 NM_033551 NM_033624 NM_033631 NM_033644 NM_033645 NM_033655 NM_033656 NM_033666 NM_037370 NM_044472 NM_048368 NM_052818 NM_052822 NM_052827 NM_052831 NM_052832 NM_052845 NM_052849 NM_052851 NM_052854 NM_052855 NM_052857 NM_052862 NM_052864 NM_052866 NM_052873 NM_052876 NM_052879 NM_052886 NM_052896 NM_052897 NM_052898 NM_052900 NM_052903 NM_052904 NM_052905 NM_052910 NM_052917 NM_052925 NM_052928 NM_052934 NM_052941 NM_052948 NM_052951 NM_052952 NM_052953 NM_052962 NM_052966 NM_053002 NM_053023 NM_053024 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053043 NM_053053 NM_053055 NM_053056 NM_053067 NM_053277 NM_053279 NM_053280 NM_053282 NM_053285 NM_054012 NM_054013 NM_054016 NM_054030 NM_054031 NM_054035 NM_054114 NM_057159 NM_057164 NM_057165 NM_057166 NM_057167 NM_057168 NM_057169 NM_057170 NM_057175 NM_057178 NM_057180 NM_057182 NM_057735 NM_057749 NM_058166 NM_058170 NM_058178 NM_058179 NM_058183 NM_058184 NM_058186 NM_058229 NM_058240 NM_058241 NM_078468 NM_078470 NM_078473 NM_078476 NM_078483 NM_078487 NM_079421 NM_080284 NM_080387 NM_080491 NM_080546 NM_080548 NM_080549 NM_080551 NM_080591 NM_080599 NM_080605 NM_080607 NM_080617 NM_080618 NM_080626 NM_080627 NM_080628 NM_080629 NM_080630 NM_080645 NM_080646 NM_080651 NM_080654 NM_080655 NM_080656 NM_080657 NM_080661 NM_080666 NM_080668 NM_080676 NM_080678 NM_080682 NM_080683 NM_080684 NM_080685 NM_080687 NM_080717 NM_080737 NM_080752 NM_080759 NM_080760 NM_080792 NM_080820 NM_080828 NM_080832 NM_080836 NM_080840 NM_080841 NM_080867 NM_080872 NM_080874 NM_080876 NM_080912 NM_080913 NM_080914 NM_080915 NM_080917 NM_080921 NM_080922 NM_080927 NM_100264 NM_100486 NM_101395 NM_130391 NM_130392 NM_130393 NM_130435 NM_130436 NM_130437 NM_130438 NM_130442 NM_130459 NM_130463 NM_130466 NM_130468 NM_130469 NM_130768 NM_130769 NM_130771 NM_130773 NM_130793 NM_130809 NM_130810 NM_130811 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130842 NM_130843 NM_130846 NM_133168 NM_133169 NM_133170 NM_133171 NM_133177 NM_133178 NM_133180 NM_133181 NM_133265 NM_133282 NM_133329 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133336 NM_133337 NM_133338 NM_133339 NM_133340 NM_133341 NM_133342 NM_133343 NM_133344 NM_133367 NM_133371 NM_133372 NM_133373 NM_133377 NM_133379 NM_133433 NM_133443 NM_133445 NM_133448 NM_133451 NM_133452 NM_133459 NM_133460 NM_133468 NM_133474 NM_133476 NM_133490 NM_133496 NM_133510 NM_133631 NM_133632 NM_133633 NM_133640 NM_133642 NM_133650 NM_134264 NM_134268 NM_134325 NM_134433 NM_134434 NM_134442 NM_134447 NM_134470 NM_138270 NM_138271 NM_138278 NM_138280 NM_138282 NM_138284 NM_138285 NM_138287 NM_138288 NM_138290 NM_138295 NM_138300 NM_138316 NM_138326 NM_138333 NM_138344 NM_138346 NM_138347 NM_138357 NM_138362 NM_138364 NM_138369 NM_138370 NM_138372 NM_138375 NM_138376 NM_138386 NM_138395 NM_138400 NM_138409 NM_138423 NM_138434 NM_138436 NM_138437 NM_138439 NM_138440 NM_138444 NM_138448 NM_138453 NM_138455 NM_138457 NM_138459 NM_138462 NM_138468 NM_138473 NM_138476 NM_138479 NM_138484 NM_138485 NM_138499 NM_138551 NM_138558 NM_138565 NM_138576 NM_138608 NM_138609 NM_138610 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138636 NM_138638 NM_138699 NM_138704 NM_138713 NM_138714 NM_138715 NM_138716 NM_138720 NM_138726 NM_138729 NM_138730 NM_138731 NM_138732 NM_138734 NM_138761 NM_138763 NM_138764 NM_138765 NM_138766 NM_138771 NM_138775 NM_138777 NM_138782 NM_138784 NM_138786 NM_138792 NM_138793 NM_138795 NM_138800 NM_138811 NM_138821 NM_138822 NM_138925 NM_138926 NM_138927 NM_138931 NM_138958 NM_138970 NM_138971 NM_138972 NM_138973 NM_138995 NM_139012 NM_139014 NM_139015 NM_139045 NM_139053 NM_139062 NM_139078 NM_139126 NM_139131 NM_139157 NM_139160 NM_139168 NM_139169 NM_139182 NM_139202 NM_139204 NM_139207 NM_139215 NM_139235 NM_139242 NM_139245 NM_139246 NM_139266 NM_139267 NM_139275 NM_139276 NM_139279 NM_139280 NM_139283 NM_139290 NM_139315 NM_139319 NM_139321 NM_139323 NM_139352 NM_144490 NM_144497 NM_144567 NM_144568 NM_144578 NM_144581 NM_144586 NM_144591 NM_144597 NM_144599 NM_144600 NM_144601 NM_144607 NM_144609 NM_144610 NM_144628 NM_144629 NM_144632 NM_144635 NM_144638 NM_144642 NM_144649 NM_144657 NM_144658 NM_144664 NM_144670 NM_144676 NM_144682 NM_144686 NM_144689 NM_144701 NM_144709 NM_144710 NM_144711 NM_144712 NM_144714 NM_144718 NM_144719 NM_144721 NM_144722 NM_144732 NM_144733 NM_144734 NM_144767 NM_144769 NM_144778 NM_144949 NM_144966 NM_144969 NM_144973 NM_144975 NM_144976 NM_144982 NM_144988 NM_144996 NM_144997 NM_145010 NM_145011 NM_145013 NM_145021 NM_145029 NM_145034 NM_145035 NM_145036 NM_145037 NM_145043 NM_145044 NM_145047 NM_145048 NM_145049 NM_145050 NM_145052 NM_145055 NM_145056 NM_145060 NM_145061 NM_145111 NM_145115 NM_145117 NM_145119 NM_145159 NM_145165 NM_145169 NM_145175 NM_145185 NM_145186 NM_145187 NM_145188 NM_145189 NM_145190 NM_145203 NM_145207 NM_145212 NM_145213 NM_145214 NM_145231 NM_145241 NM_145250 NM_145257 NM_145258 NM_145260 NM_145263 NM_145271 NM_145278 NM_145283 NM_145284 NM_145286 NM_145294 NM_145296 NM_145301 NM_145304 NM_145307 NM_145308 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145326 NM_145341 NM_145342 NM_145646 NM_145647 NM_145686 NM_145687 NM_145690 NM_145697 NM_145728 NM_145733 NM_145734 NM_145735 NM_145739 NM_145753 NM_145756 NM_145759 NM_145762 NM_145763 NM_145764 NM_145791 NM_145792 NM_145793 NM_145808 NM_145809 NM_145810 NM_145859 NM_145860 NM_145863 NM_145868 NM_145869 NM_145906 NM_145912 NM_145913 NM_145914 NM_146388 NM_147129 NM_147134 NM_147147 NM_147150 NM_147152 NM_147156 NM_147171 NM_147175 NM_147185 NM_147187 NM_147188 NM_147194 NM_147200 NM_147223 NM_147233 NM_147686 NM_147777 NM_148170 NM_148171 NM_148174 NM_148175 NM_148176 NM_148177 NM_148571 NM_148676 NM_148921 NM_148954 NM_148957 NM_148960 NM_148977 NM_148978 NM_152133 NM_152221 NM_152233 NM_152235 NM_152238 NM_152244 NM_152255 NM_152257 NM_152259 NM_152260 NM_152261 NM_152265 NM_152267 NM_152269 NM_152270 NM_152271 NM_152275 NM_152279 NM_152280 NM_152281 NM_152282 NM_152284 NM_152287 NM_152289 NM_152291 NM_152292 NM_152295 NM_152298 NM_152301 NM_152302 NM_152303 NM_152305 NM_152306 NM_152308 NM_152314 NM_152315 NM_152316 NM_152330 NM_152332 NM_152346 NM_152350 NM_152355 NM_152356 NM_152365 NM_152367 NM_152372 NM_152379 NM_152384 NM_152387 NM_152388 NM_152391 NM_152392 NM_152399 NM_152400 NM_152402 NM_152405 NM_152407 NM_152409 NM_152410 NM_152412 NM_152417 NM_152418 NM_152422 NM_152423 NM_152424 NM_152433 NM_152440 NM_152442 NM_152443 NM_152444 NM_152446 NM_152448 NM_152449 NM_152450 NM_152460 NM_152462 NM_152464 NM_152475 NM_152478 NM_152484 NM_152485 NM_152488 NM_152491 NM_152495 NM_152498 NM_152500 NM_152510 NM_152515 NM_152517 NM_152519 NM_152520 NM_152522 NM_152524 NM_152527 NM_152536 NM_152538 NM_152539 NM_152540 NM_152545 NM_152551 NM_152556 NM_152563 NM_152579 NM_152581 NM_152583 NM_152584 NM_152586 NM_152588 NM_152590 NM_152594 NM_152595 NM_152596 NM_152603 NM_152605 NM_152608 NM_152610 NM_152613 NM_152616 NM_152618 NM_152622 NM_152624 NM_152625 NM_152630 NM_152633 NM_152636 NM_152641 NM_152647 NM_152653 NM_152655 NM_152660 NM_152666 NM_152667 NM_152672 NM_152678 NM_152681 NM_152682 NM_152686 NM_152688 NM_152692 NM_152694 NM_152695 NM_152698 NM_152701 NM_152704 NM_152705 NM_152709 NM_152713 NM_152716 NM_152723 NM_152724 NM_152729 NM_152731 NM_152734 NM_152735 NM_152737 NM_152739 NM_152744 NM_152745 NM_152750 NM_152754 NM_152758 NM_152765 NM_152772 NM_152774 NM_152776 NM_152787 NM_152793 NM_152827 NM_152828 NM_152829 NM_152831 NM_152834 NM_152835 NM_152836 NM_152837 NM_152838 NM_152842 NM_152856 NM_152857 NM_152858 NM_152860 NM_152864 NM_152866 NM_152868 NM_152869 NM_152879 NM_152890 NM_152896 NM_152897 NM_152900 NM_152902 NM_152903 NM_152909 NM_152914 NM_152924 NM_152932 NM_152933 NM_152934 NM_152943 NM_152989 NM_152991 NM_152994 NM_152995 NM_152999 NM_153003 NM_153005 NM_153010 NM_153013 NM_153015 NM_153020 NM_153022 NM_153026 NM_153027 NM_153029 NM_153032 NM_153035 NM_153036 NM_153042 NM_153050 NM_153051 NM_153183 NM_153201 NM_153207 NM_153208 NM_153217 NM_153218 NM_153220 NM_153223 NM_153225 NM_153226 NM_153233 NM_153234 NM_153235 NM_153238 NM_153239 NM_153240 NM_153253 NM_153255 NM_153256 NM_153257 NM_153260 NM_153261 NM_153262 NM_153263 NM_153267 NM_153273 NM_153274 NM_153331 NM_153333 NM_153337 NM_153341 NM_153343 NM_153344 NM_153346 NM_153347 NM_153348 NM_153350 NM_153354 NM_153361 NM_153365 NM_153367 NM_153371 NM_153374 NM_153381 NM_153442 NM_153451 NM_153456 NM_153464 NM_153478 NM_153479 NM_153499 NM_153500 NM_153607 NM_153610 NM_153613 NM_153616 NM_153617 NM_153618 NM_153619 NM_153620 NM_153631 NM_153632 NM_153634 NM_153636 NM_153649 NM_153675 NM_153681 NM_153682 NM_153683 NM_153686 NM_153687 NM_153688 NM_153689 NM_153694 NM_153695 NM_153699 NM_153702 NM_153705 NM_153706 NM_153712 NM_153714 NM_153754 NM_153757 NM_153758 NM_153759 NM_153810 NM_153812 NM_153825 NM_153826 NM_153828 NM_153834 NM_153836 NM_153837 NM_156038 NM_156039 NM_170607 NM_170662 NM_170665 NM_170672 NM_170679 NM_170682 NM_170683 NM_170692 NM_170696 NM_170697 NM_170705 NM_170706 NM_170709 NM_170710 NM_170711 NM_170719 NM_170724 NM_170725 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170746 NM_170768 NM_170773 NM_170774 NM_170775 NM_171827 NM_171982 NM_171998 NM_171999 NM_172005 NM_172037 NM_172058 NM_172059 NM_172060 NM_172069 NM_172070 NM_172127 NM_172128 NM_172164 NM_172177 NM_172178 NM_172193 NM_172216 NM_172218 NM_172219 NM_172220 NM_172226 NM_172230 NM_172232 NM_172236 NM_172239 NM_172241 NM_172244 NM_172318 NM_172344 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172373 NM_172387 NM_172388 NM_172389 NM_173054 NM_173060 NM_173075 NM_173078 NM_173079 NM_173080 NM_173082 NM_173083 NM_173157 NM_173161 NM_173170 NM_173171 NM_173172 NM_173173 NM_173177 NM_173191 NM_173192 NM_173193 NM_173194 NM_173195 NM_173198 NM_173200 NM_173201 NM_173206 NM_173213 NM_173214 NM_173342 NM_173353 NM_173355 NM_173459 NM_173464 NM_173465 NM_173466 NM_173468 NM_173469 NM_173470 NM_173471 NM_173473 NM_173475 NM_173480 NM_173483 NM_173487 NM_173491 NM_173493 NM_173497 NM_173510 NM_173511 NM_173514 NM_173517 NM_173518 NM_173522 NM_173523 NM_173528 NM_173529 NM_173531 NM_173532 NM_173536 NM_173547 NM_173557 NM_173562 NM_173570 NM_173571 NM_173578 NM_173580 NM_173582 NM_173583 NM_173586 NM_173587 NM_173597 NM_173602 NM_173607 NM_173625 NM_173626 NM_173630 NM_173631 NM_173632 NM_173635 NM_173644 NM_173645 NM_173646 NM_173647 NM_173648 NM_173651 NM_173654 NM_173660 NM_173661 NM_173665 NM_173666 NM_173667 NM_173669 NM_173672 NM_173674 NM_173675 NM_173677 NM_173683 NM_173688 NM_173694 NM_173698 NM_173700 NM_173701 NM_173728 NM_173794 NM_173797 NM_173800 NM_173803 NM_173808 NM_173809 NM_173812 NM_173817 NM_173822 NM_173823 NM_173826 NM_173827 NM_173829 NM_173831 NM_173841 NM_173842 NM_173843 NM_173848 NM_173851 NM_173852 NM_173853 NM_173854 NM_174858 NM_174871 NM_174872 NM_174873 NM_174887 NM_174891 NM_174901 NM_174907 NM_174908 NM_174911 NM_174921 NM_174936 NM_174937 NM_174940 NM_174950 NM_174978 NM_175052 NM_175058 NM_175061 NM_175062 NM_175064 NM_175069 NM_175071 NM_175072 NM_175073 NM_175080 NM_175085 NM_175566 NM_175569 NM_175607 NM_175610 NM_175612 NM_175629 NM_175634 NM_175635 NM_175636 NM_175719 NM_175720 NM_175721 NM_175722 NM_175736 NM_175747 NM_175839 NM_175840 NM_175841 NM_175842 NM_175847 NM_175848 NM_175849 NM_175850 NM_175854 NM_175862 NM_175864 NM_175873 NM_175876 NM_175883 NM_175884 NM_175892 NM_175907 NM_175918 NM_175920 NM_175921 NM_175922 NM_175924 NM_176071 NM_176072 NM_176787 NM_176799 NM_176800 NM_176805 NM_176806 NM_176812 NM_176813 NM_176814 NM_176815 NM_176816 NM_176823 NM_176824 NM_176853 NM_176874 NM_176880 NM_176891 NM_176894 NM_177404 NM_177414 NM_177415 NM_177422 NM_177424 NM_177434 NM_177436 NM_177438 NM_177439 NM_177442 NM_177452 NM_177453 NM_177454 NM_177526 NM_177532 NM_177538 NM_177543 NM_177559 NM_177560 NM_177926 NM_177947 NM_177948 NM_177952 NM_177954 NM_177965 NM_177968 NM_177969 NM_177972 NM_177974 NM_177976 NM_177977 NM_177986 NM_177990 NM_177995 NM_177996 NM_177999 NM_178006 NM_178007 NM_178010 NM_178011 NM_178012 NM_178037 NM_178038 NM_178039 NM_178040 NM_178120 NM_178123 NM_178125 NM_178127 NM_178129 NM_178130 NM_178135 NM_178138 NM_178140 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178191 NM_178232 NM_178335 NM_178336 NM_178342 NM_178343 NM_178353 NM_178423 NM_178424 NM_178426 NM_178427 NM_178430 NM_178438 NM_178445 NM_178470 NM_178493 NM_178496 NM_178498 NM_178505 NM_178507 NM_178508 NM_178509 NM_178514 NM_178517 NM_178523 NM_178526 NM_178539 NM_178544 NM_178548 NM_178550 NM_178555 NM_178558 NM_178565 NM_178566 NM_178583 NM_178584 NM_178585 NM_178586 NM_178587 NM_178812 NM_178814 NM_178815 NM_178816 NM_178826 NM_178831 NM_178836 NM_178839 NM_178842 NM_178849 NM_178868 NM_180981 NM_180982 NM_180989 NM_180991 NM_181054 NM_181076 NM_181077 NM_181265 NM_181291 NM_181304 NM_181305 NM_181306 NM_181307 NM_181309 NM_181310 NM_181311 NM_181312 NM_181313 NM_181314 NM_181332 NM_181334 NM_181335 NM_181340 NM_181341 NM_181349 NM_181351 NM_181354 NM_181358 NM_181359 NM_181361 NM_181425 NM_181435 NM_181443 NM_181453 NM_181457 NM_181458 NM_181459 NM_181460 NM_181481 NM_181482 NM_181483 NM_181486 NM_181489 NM_181491 NM_181492 NM_181502 NM_181503 NM_181504 NM_181505 NM_181523 NM_181524 NM_181527 NM_181528 NM_181531 NM_181533 NM_181553 NM_181554 NM_181555 NM_181571 NM_181573 NM_181581 NM_181643 NM_181644 NM_181654 NM_181655 NM_181656 NM_181659 NM_181672 NM_181673 NM_181689 NM_181702 NM_181704 NM_181706 NM_181708 NM_181713 NM_181714 NM_181715 NM_181717 NM_181723 NM_181725 NM_181739 NM_181740 NM_181741 NM_181742 NM_181755 NM_181762 NM_181776 NM_181777 NM_181787 NM_181789 NM_181794 NM_181795 NM_181814 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181838 NM_181839 NM_181861 NM_181868 NM_181869 NM_181874 NM_181876 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_181897 NM_182314 NM_182398 NM_182472 NM_182484 NM_182485 NM_182487 NM_182488 NM_182492 NM_182493 NM_182495 NM_182501 NM_182502 NM_182503 NM_182508 NM_182510 NM_182511 NM_182518 NM_182530 NM_182540 NM_182543 NM_182546 NM_182558 NM_182559 NM_182568 NM_182569 NM_182570 NM_182579 NM_182584 NM_182585 NM_182598 NM_182606 NM_182612 NM_182620 NM_182621 NM_182625 NM_182631 NM_182637 NM_182638 NM_182639 NM_182640 NM_182641 NM_182643 NM_182646 NM_182662 NM_182665 NM_182666 NM_182678 NM_182682 NM_182691 NM_182692 NM_182700 NM_182703 NM_182709 NM_182710 NM_182715 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182728 NM_182734 NM_182744 NM_182751 NM_182752 NM_182756 NM_182757 NM_182758 NM_182760 NM_182763 NM_182764 NM_182767 NM_182769 NM_182770 NM_182771 NM_182772 NM_182775 NM_182789 NM_182796 NM_182797 NM_182811 NM_182830 NM_182832 NM_182847 NM_182848 NM_182850 NM_182853 NM_182896 NM_182898 NM_182899 NM_182903 NM_182907 NM_182910 NM_182912 NM_182913 NM_182914 NM_182918 NM_182926 NM_182931 NM_182932 NM_182933 NM_182936 NM_182943 NM_182944 NM_182948 NM_182961 NM_182962 NM_182964 NM_182970 NM_182975 NM_182982 NM_183002 NM_183004 NM_183005 NM_183011 NM_183012 NM_183013 NM_183040 NM_183043 NM_183044 NM_183045 NM_183049 NM_183050 NM_183060 NM_183063 NM_183065 NM_183078 NM_183079 NM_183227 NM_183234 NM_183235 NM_183236 NM_183237 NM_183238 NM_183247 NM_183323 NM_183352 NM_183353 NM_183376 NM_183381 NM_183382 NM_183383 NM_183384 NM_183393 NM_183394 NM_183395 NM_183397 NM_183398 NM_183399 NM_183400 NM_183401 NM_183412 NM_183413 NM_183414 NM_183415 NM_183416 NM_183418 NM_183420 NM_183421 NM_183422 NM_183425 NM_184234 NM_184237 NM_184241 NM_184244 NM_194071 NM_194250 NM_194270 NM_194277 NM_194278 NM_194282 NM_194283 NM_194285 NM_194286 NM_194289 NM_194291 NM_194292 NM_194294 NM_194298 NM_194301 NM_194303 NM_194314 NM_194317 NM_194318 NM_194324 NM_194325 NM_194327 NM_194356 NM_194429 NM_194430 NM_194431 NM_194434 NM_194435 NM_194439 NM_194442 NM_194449 NM_194454 NM_194455 NM_194456 NM_194463 NM_197941 NM_197955 NM_197956 NM_197968 NM_197978 NM_198040 NM_198053 NM_198057 NM_198058 NM_198061 NM_198066 NM_198074 NM_198076 NM_198077 NM_198081 NM_198086 NM_198098 NM_198123 NM_198124 NM_198128 NM_198150 NM_198152 NM_198153 NM_198156 NM_198157 NM_198158 NM_198159 NM_198177 NM_198178 NM_198181 NM_198186 NM_198187 NM_198189 NM_198194 NM_198195 NM_198196 NM_198197 NM_198204 NM_198205 NM_198212 NM_198215 NM_198225 NM_198236 NM_198256 NM_198257 NM_198258 NM_198261 NM_198262 NM_198264 NM_198266 NM_198267 NM_198268 NM_198269 NM_198270 NM_198271 NM_198276 NM_198278 NM_198279 NM_198281 NM_198287 NM_198291 NM_198312 NM_198320 NM_198325 NM_198329 NM_198330 NM_198333 NM_198336 NM_198337 NM_198353 NM_198381 NM_198389 NM_198393 NM_198395 NM_198399 NM_198400 NM_198401 NM_198402 NM_198404 NM_198427 NM_198428 NM_198439 NM_198440 NM_198441 NM_198458 NM_198459 NM_198460 NM_198461 NM_198462 NM_198463 NM_198465 NM_198467 NM_198476 NM_198479 NM_198480 NM_198484 NM_198485 NM_198493 NM_198494 NM_198498 NM_198499 NM_198506 NM_198507 NM_198510 NM_198513 NM_198516 NM_198519 NM_198539 NM_198545 NM_198549 NM_198550 NM_198552 NM_198563 NM_198567 NM_198568 NM_198569 NM_198576 NM_198581 NM_198584 NM_198595 NM_198596 NM_198597 NM_198679 NM_198682 NM_198686 NM_198700 NM_198712 NM_198713 NM_198714 NM_198716 NM_198717 NM_198793 NM_198794 NM_198795 NM_198830 NM_198833 NM_198843 NM_198844 NM_198845 NM_198846 NM_198847 NM_198849 NM_198859 NM_198880 NM_198887 NM_198890 NM_198896 NM_198900 NM_198901 NM_198902 NM_198904 NM_198956 NM_198965 NM_198966 NM_198974 NM_198976 NM_198990 NM_198992 NM_198996 NM_199000 NM_199003 NM_199005 NM_199039 NM_199040 NM_199044 NM_199050 NM_199051 NM_199053 NM_199054 NM_199072 NM_199075 NM_199126 NM_199131 NM_199132 NM_199136 NM_199138 NM_199139 NM_199144 NM_199160 NM_199168 NM_199169 NM_199170 NM_199171 NM_199176 NM_199177 NM_199182 NM_199188 NM_199189 NM_199190 NM_199203 NM_199246 NM_199247 NM_199248 NM_199259 NM_199260 NM_199261 NM_199294 NM_199295 NM_199324 NM_199327 NM_199328 NM_199330 NM_199331 NM_199332 NM_199344 NM_199357 NM_199415 NM_199418 NM_199420 NM_199421 NM_199423 NM_199424 NM_199426 NM_199436 NM_199437 NM_199438 NM_199439 NM_199443 NM_199451 NM_199452 NM_199454 NM_199459 NM_199461 NM_199462 NM_199478 NM_199482 NM_199487 NM_199513 NM_201224 NM_201263 NM_201266 NM_201268 NM_201279 NM_201280 NM_201348 NM_201377 NM_201413 NM_201414 NM_201431 NM_201437 NM_201439 NM_201440 NM_201515 NM_201524 NM_201525 NM_201542 NM_201550 NM_201555 NM_201556 NM_201557 NM_201567 NM_201570 NM_201571 NM_201572 NM_201590 NM_201591 NM_201592 NM_201593 NM_201596 NM_201597 NM_201624 NM_201628 NM_201629 NM_201630 NM_201648 NM_201649 NM_201995 NM_201998 NM_203282 NM_203287 NM_203301 NM_203305 NM_203307 NM_203316 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203341 NM_203342 NM_203343 NM_203344 NM_203350 NM_203354 NM_203355 NM_203356 NM_203357 NM_203364 NM_203371 NM_203372 NM_203379 NM_203380 NM_203381 NM_203382 NM_203391 NM_203394 NM_203395 NM_203400 NM_203403 NM_203406 NM_203413 NM_203414 NM_203415 NM_203417 NM_203418 NM_203422 NM_203429 NM_203433 NM_203434 NM_203436 NM_203446 NM_203448 NM_203451 NM_203453 NM_203454 NM_203459 NM_203462 NM_203463 NM_203464 NM_203468 NM_203481 NM_203486 NM_203487 NM_203488 NM_203497 NM_203504 NM_203505 NM_205833 NM_205855 NM_205857 NM_205860 NM_206594 NM_206595 NM_206813 NM_206814 NM_206817 NM_206818 NM_206836 NM_206841 NM_206853 NM_206854 NM_206855 NM_206860 NM_206861 NM_206862 NM_206866 NM_206876 NM_206877 NM_206887 NM_206891 NM_206893 NM_206907 NM_206909 NM_206925 NM_206927 NM_206928 NM_206929 NM_206930 NM_206933 NM_206937 NM_206938 NM_206939 NM_206940 NM_206943 NM_206953 NM_206954 NM_206955 NM_206956 NM_206964 NM_206998 NM_207003 NM_207012 NM_207032 NM_207033 NM_207034 NM_207035 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207111 NM_207113 NM_207116 NM_207123 NM_207170 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207318 NM_207321 NM_207325 NM_207327 NM_207332 NM_207333 NM_207334 NM_207354 NM_207356 NM_207357 NM_207359 NM_207365 NM_207371 NM_207372 NM_207378 NM_207385 NM_207400 NM_207401 NM_207404 NM_207411 NM_207412 NM_207413 NM_207418 NM_207422 NM_207428 NM_207429 NM_207430 NM_207435 NM_207436 NM_207437 NM_207439 NM_207444 NM_207448 NM_207449 NM_207459 NM_207465 NM_207470 NM_207471 NM_207474 NM_207479 NM_207481 NM_207486 NM_207488 NM_207489 NM_207491 NM_207497 NM_207500 NM_207503 NM_207506 NM_207514 NM_207517 NM_207518 NM_207520 NM_207521 NM_207577 NM_207645 NM_207646 NM_207647 NM_207660 NM_207661 NM_207662 NM_207672 NM_212460 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212539 NM_212540 NM_212543 NM_212558 NM_213566 NM_213568 NM_213589 NM_213594 NM_213598 NM_213608 NM_213612 NM_213618 NM_213645 NM_213646 NM_213651 NM_213654 NM_213657 NM_213658 NM_213662 NM_213723 NM_214675 NM_214676 NM_214677 NM_214678 NM_214679 NM_214711 XM_027236 XM_027307 XM_029353 XM_030378 XM_031553 XM_031689 XM_032571 XM_032901 XM_032945 XM_032996 XM_034274 XM_034872 XM_035299 XM_038150 XM_038436 XM_039393 XM_039515 XM_039570 XM_039627 XM_039676 XM_039702 XM_039908 XM_040592 XM_041126 XM_042066 XM_042301 XM_042698 XM_042833 XM_042936 XM_043493 XM_043653 XM_044178 XM_044434 XM_045290 XM_046581 XM_047355 XM_047550 XM_047554 XM_047995 XM_048128 XM_048898 XM_049078 XM_050278 XM_051081 XM_051862 XM_055636 XM_056455 XM_057107 XM_057296 XM_058513 XM_059318 XM_059396 XM_059482 XM_059929 XM_061864 XM_061890 XM_066058 XM_068632 XM_069842 XM_085463 XM_086186 XM_086937 XM_087089 XM_087353 XM_093839 XM_096688 XM_097265 XM_097351 XM_097580 XM_098450 XM_113641 XM_113743 XM_113763 XM_113947 XM_113967 XM_117294 XM_166103 XM_166132 XM_166140 XM_166203 XM_166320 XM_166966 XM_167147 XM_168578 XM_172889 XM_208204 XM_208313 XM_208333 XM_208545 XM_208658 XM_209429 XM_209569 XM_209607 XM_209700 XM_209741 XM_209920 XM_210048 XM_210860 XM_210906 XM_211086 XM_211090 XM_211108 XM_211174 XM_211367 XM_212061 XM_290345 XM_290502 XM_290597 XM_290615 XM_290737 XM_290835 XM_291007 XM_291019 XM_291020 XM_291028 XM_291095 XM_291128 XM_291208 XM_291253 XM_291262 XM_291344 XM_291625 XM_291671 XM_291729 XM_292184 XM_292357 XM_292717 XM_293380 XM_293918 XM_294765 XM_295058 XM_295091 XM_295257 XM_298151 XM_350880 XM_370577 XM_370654 XM_370664 XM_370665 XM_370672 XM_370837 XM_370838 XM_370839 XM_370840 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_370928 XM_370932 XM_370975 XM_371009 XM_371015 XM_371074 XM_371116 XM_371176 XM_371204 XM_371254 XM_371369 XM_371384 XM_371461 XM_371474 XM_371488 XM_371575 XM_371588 XM_371590 XM_371672 XM_371690 XM_371691 XM_371706 XM_371783 XM_371837 XM_371838 XM_371848 XM_371851 XM_371878 XM_371891 XM_371933 XM_371943 XM_372004 XM_372028 XM_372030 XM_372090 XM_372097 XM_372205 XM_372227 XM_372233 XM_372273 XM_372556 XM_372584 XM_372592 XM_372723 XM_372774 XM_372869 XM_373030 XM_373290 XM_373451 XM_373452 XM_373453 XM_373637 XM_373666 XM_373802 XM_373890 XM_373914 XM_373985 XM_374013 XM_374021 XM_374078 XM_374086 XM_374110 XM_374115 XM_374159 XM_374185 XM_374270 XM_374307 XM_374317 XM_374343 XM_374405 XM_374422 XM_374460 XM_374491 XM_374502 XM_374589 XM_374765 XM_374768 XM_374842 XM_374945 XM_374965 XM_374983 XM_375007 XM_375029 XM_375042 XM_375081 XM_375090 XM_375099 XM_375152 XM_375261 XM_375307 XM_375357 XM_375449 XM_375456 XM_375491 XM_375543 XM_375568 XM_375590 XM_375606 XM_375608 XM_375619 XM_375646 XM_375665 XM_375669 XM_375697 XM_375698 XM_375729 XM_375821 XM_375838 XM_375929 XM_376018 XM_376062 XM_376186 XM_376254 XM_376278 XM_376303 XM_376350 XM_376372 XM_376386 XM_376412 XM_376444 XM_376454 XM_376463 XM_376522 XM_376550 XM_376602 XM_376679 XM_376680 XM_376727 XM_376784 XM_376795 XM_376822 XM_376843 XM_376902 XM_376905 XM_377076 XM_377259 XM_377742 XM_378203 XM_378208 XM_378236 XM_378238 XM_378250 XM_378259 XM_378273 XM_378279 XM_378301 XM_378305 XM_378309 XM_378316 XM_378327 XM_378350 XM_378362 XM_378367 XM_378368 XM_378379 XM_378388 XM_378389 XM_378390 XM_378411 XM_378421 XM_378452 XM_378487 XM_378507 XM_378511 XM_378512 XM_378516 XM_378529 XM_378542 XM_378544 XM_378553 XM_378567 XM_378573 XM_378589 XM_378606 XM_378620 XM_378639 XM_378661 XM_378686 XM_378698 XM_378712 XM_378735 XM_378741 XM_378751 XM_378758 XM_378783 XM_378786 XM_378799 XM_378810 XM_378832 XM_378843 XM_378848 XM_378855 XM_378860 XM_378876 XM_378914 XM_378946 XM_378971 XM_378973 XM_378982 XM_378983 XM_379006 XM_379029 XM_379030 XM_379074 XM_379075 XM_379078 XM_379096 XM_379111 XM_379114 XM_379118 XM_379123 XM_379141 XM_379156 XM_379183 XM_379184 XM_379189 XM_379205 XM_379228 XM_379231 XM_379249 XM_379258 XM_379260 XM_379267 XM_379276 XM_379280 XM_379298 XM_379320 XM_379336 XM_379378 XM_379380 XM_379386 XM_379398 XM_379402 XM_379406 XM_379409 XM_379432 XM_379438 XM_379452 XM_379454 XM_379459 XM_379482 XM_379483 XM_379484 XM_379495 XM_379508 XM_379510 XM_379520 XM_379530 XM_379535 XM_379543 XM_379573 XM_379582 XM_379584 XM_379587 XM_379595 XM_379597 XM_379619 XM_379622 XM_379623 XM_379629 XM_379632 XM_379635 XM_379637 XM_379650 XM_379657 XM_379665 XM_379702 XM_379716 XM_379720 XM_379722 XM_379820 XM_379850 XM_379858 XM_379927 XM_379933 XM_379934 XM_379979 XM_380042 XM_380098 XM_380099 XM_380100 XM_380114 XM_380129 XM_380131 XM_380146 XM_380154 XM_380160 XM_380171 XM_495798 XM_495803 XM_495807 XM_495844 XM_495849 XM_495873 XM_495877 XM_495878 XM_495886 XM_495888 XM_495890 XM_495891 XM_495933 XM_495939 XM_495949 XM_495950 XM_495961 XM_496036 XM_496048 XM_496050 XM_496070 XM_496076 XM_496081 XM_496088 XM_496093 XM_496096 XM_496103 XM_496134 XM_496145 XM_496156 XM_496158 XM_496191 XM_496227 XM_496241 XM_496265 XM_496266 XM_496268 XM_496328 XM_496341 XM_496343 XM_496352 XM_496401 XM_496434 XM_496436 XM_496467 XM_496519 XM_496576 XM_496597 XM_496603 XM_496608 XM_496637 XM_496654 XM_496688 XM_496695 XM_496740 XM_496777 XM_496781 XM_496782 XM_496814 XM_496826 XM_496836 XM_496854 XM_496879 XM_496892 XM_496894 XM_496898 XM_496899 XM_496905 XM_496907 XM_496912 XM_496943 XM_496960 XM_496965 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497002 XM_497012 XM_497036 XM_497089 XM_497120 XM_497141 XM_498436 XM_498438 XM_498440 XM_498441 XM_498442 XM_498445 XM_498452 XM_498456 XM_498457 XM_498461 XM_498464 XM_498467 XM_498473 XM_498490 XM_498506 XM_498508 XM_498515 XM_498525 XM_498540 XM_498555 XM_498557 XM_498567 XM_498569 XM_498571 XM_498572 XM_498593 XM_498594 XM_498611 XM_498614 XM_498631 XM_498644 XM_498646 XM_498649 XM_498659 XM_498660 XM_498679 XM_498683 XM_498691 XM_498717 XM_498727 XM_498825 XM_498826 XM_498828 XM_498841 XM_498851 XM_498852 XM_498869 XM_498889 XM_498894 XM_498898 XM_498901 XM_498902 XM_498943 XM_498951 XM_498974 XM_498994 XM_498995 XM_499002 XM_499008 XM_499010 XM_499013 XM_499039 XM_499050 XM_499061 XM_499065 XM_499071 XM_499085 XM_499117 XM_499119 XM_499123 XM_499125 XM_499130 XM_499147 XM_499153 XM_499154 XM_499182 XM_499263 XM_499298 XM_499309 XM_499314 XM_499317 XM_499321 XM_499328 XM_499330 XM_499333 XM_499338 XM_499343 XM_499348 XM_499349 XM_499354 XM_499356 XM_499392 XM_499498 XM_499502 XM_499510 XM_499515 XM_499524 XM_499556 XM_499566 XM_499568 XM_499570 XM_499571 XM_499572 XM_499575 XM_499577 XM_499585 XM_499586 XM_499591 XM_499594 XM_499597 XR_000182 XR_000192 XR_000195 XR_000216 XR_000217 XR_000227 XR_000254
Genes with multiple seed matches:
NM_000024 NM_000028 NM_000031 NM_000038 NM_000052 NM_000090 NM_000091 NM_000097 NM_000109 NM_000110 NM_000112 NM_000114 NM_000115 NM_000125 NM_000138 NM_000141 NM_000161 NM_000163 NM_000176 NM_000210 NM_000214 NM_000216 NM_000223 NM_000230 NM_000232 NM_000242 NM_000245 NM_000248 NM_000252 NM_000268 NM_000274 NM_000297 NM_000311 NM_000313 NM_000314 NM_000317 NM_000332 NM_000341 NM_000346 NM_000351 NM_000358 NM_000361 NM_000362 NM_000376 NM_000378 NM_000382 NM_000393 NM_000411 NM_000415 NM_000416 NM_000430 NM_000441 NM_000448 NM_000450 NM_000452 NM_000489 NM_000495 NM_000499 NM_000503 NM_000508 NM_000511 NM_000522 NM_000533 NM_000538 NM_000551 NM_000555 NM_000573 NM_000574 NM_000575 NM_000586 NM_000593 NM_000609 NM_000610 NM_000611 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000651 NM_000673 NM_000686 NM_000724 NM_000726 NM_000775 NM_000791 NM_000809 NM_000824 NM_000838 NM_000845 NM_000849 NM_000859 NM_000861 NM_000885 NM_000891 NM_000899 NM_000901 NM_000910 NM_000916 NM_000933 NM_000944 NM_000945 NM_000950 NM_000958 NM_000961 NM_000962 NM_000983 NM_000994 NM_000997 NM_001001323 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001395 NM_001001396 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001484 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001681 NM_001001684 NM_001001697 NM_001001706 NM_001001928 NM_001001929 NM_001001930 NM_001001933 NM_001001938 NM_001001971 NM_001001974 NM_001002026 NM_001002233 NM_001002260 NM_001002799 NM_001002800 NM_001002811 NM_001002812 NM_001002814 NM_001002843 NM_001002860 NM_001002881 NM_001002926 NM_001003652 NM_001003674 NM_001003675 NM_001003681 NM_001003688 NM_001003694 NM_001003712 NM_001003945 NM_001004301 NM_001004317 NM_001004330 NM_001004355 NM_001004417 NM_001004421 NM_001004422 NM_001004434 NM_001004441 NM_001005366 NM_001005372 NM_001005404 NM_001005463 NM_001005473 NM_001005474 NM_001005476 NM_001005505 NM_001005738 NM_001005743 NM_001005744 NM_001005745 NM_001005746 NM_001005747 NM_001005782 NM_001006600 NM_001006610 NM_001006623 NM_001006624 NM_001006625 NM_001006657 NM_001006658 NM_001006935 NM_001006936 NM_001006937 NM_001007024 NM_001007025 NM_001007073 NM_001007074 NM_001007075 NM_001007097 NM_001007098 NM_001007102 NM_001007157 NM_001007176 NM_001007237 NM_001007246 NM_001007267 NM_001007277 NM_001007466 NM_001007538 NM_001007559 NM_001007794 NM_001008224 NM_001008226 NM_001008390 NM_001008393 NM_001008408 NM_001008493 NM_001008537 NM_001008539 NM_001008710 NM_001008711 NM_001008726 NM_001008738 NM_001008781 NM_001008801 NM_001008895 NM_001008938 NM_001009554 NM_001009555 NM_001009567 NM_001009569 NM_001009880 NM_001009894 NM_001009909 NM_001009957 NM_001009958 NM_001010850 NM_001010852 NM_001010853 NM_001010867 NM_001010883 NM_001010888 NM_001010891 NM_001010892 NM_001010913 NM_001010915 NM_001010923 NM_001010942 NM_001010986 NM_001011514 NM_001011515 NM_001011516 NM_001011539 NM_001011546 NM_001011553 NM_001011554 NM_001011658 NM_001011666 NM_001011708 NM_001011709 NM_001011885 NM_001012274 NM_001012393 NM_001012420 NM_001012423 NM_001012424 NM_001012452 NM_001012651 NM_001012729 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012754 NM_001012755 NM_001012756 NM_001012761 NM_001012968 NM_001012981 NM_001013406 NM_001013437 NM_001013655 NM_001013659 NM_001013674 NM_001013688 NM_001013695 NM_001013697 NM_001013710 NM_001013715 NM_001013718 NM_001013719 NM_001013843 NM_001014380 NM_001014439 NM_001014797 NM_001014809 NM_001015045 NM_001015048 NM_001015049 NM_001015051 NM_001015877 NM_001015880 NM_001015882 NM_001015886 NM_001017368 NM_001017370 NM_001017371 NM_001017392 NM_001017395 NM_001017408 NM_001017420 NM_001017424 NM_001017425 NM_001017440 NM_001017535 NM_001017923 NM_001017926 NM_001017972 NM_001017975 NM_001017980 NM_001018009 NM_001018037 NM_001018053 NM_001018054 NM_001018055 NM_001018056 NM_001018058 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001018111 NM_001020658 NM_001023567 NM_001024024 NM_001024070 NM_001024071 NM_001024094 NM_001024216 NM_001024380 NM_001024381 NM_001024593 NM_001024596 NM_001024630 NM_001024646 NM_001024649 NM_001024688 NM_001024736 NM_001024843 NM_001024855 NM_001024948 NM_001024956 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025107 NM_001025108 NM_001025201 NM_001025252 NM_001025253 NM_001025266 NM_001047 NM_001067 NM_001078 NM_001080 NM_001083 NM_001111 NM_001117 NM_001126 NM_001128 NM_001144 NM_001159 NM_001167 NM_001186 NM_001187 NM_001204 NM_001206 NM_001211 NM_001241 NM_001245 NM_001246 NM_001259 NM_001270 NM_001278 NM_001282 NM_001286 NM_001290 NM_001293 NM_001304 NM_001310 NM_001313 NM_001315 NM_001329 NM_001351 NM_001363 NM_001386 NM_001390 NM_001396 NM_001401 NM_001412 NM_001414 NM_001419 NM_001423 NM_001430 NM_001432 NM_001448 NM_001457 NM_001460 NM_001462 NM_001483 NM_001490 NM_001494 NM_001495 NM_001497 NM_001498 NM_001511 NM_001518 NM_001542 NM_001546 NM_001547 NM_001554 NM_001570 NM_001584 NM_001616 NM_001620 NM_001621 NM_001627 NM_001650 NM_001655 NM_001656 NM_001663 NM_001679 NM_001681 NM_001682 NM_001684 NM_001704 NM_001706 NM_001709 NM_001723 NM_001730 NM_001736 NM_001742 NM_001743 NM_001745 NM_001746 NM_001777 NM_001788 NM_001798 NM_001806 NM_001814 NM_001821 NM_001822 NM_001830 NM_001831 NM_001845 NM_001854 NM_001858 NM_001859 NM_001877 NM_001882 NM_001904 NM_001918 NM_001933 NM_001941 NM_001946 NM_001949 NM_001957 NM_001963 NM_001965 NM_001969 NM_001980 NM_001981 NM_001995 NM_002009 NM_002013 NM_002015 NM_002017 NM_002024 NM_002025 NM_002033 NM_002044 NM_002065 NM_002076 NM_002089 NM_002099 NM_002126 NM_002128 NM_002130 NM_002137 NM_002140 NM_002142 NM_002158 NM_002164 NM_002182 NM_002210 NM_002222 NM_002226 NM_002228 NM_002232 NM_002268 NM_002271 NM_002285 NM_002296 NM_002312 NM_002345 NM_002349 NM_002351 NM_002356 NM_002357 NM_002364 NM_002365 NM_002380 NM_002389 NM_002397 NM_002398 NM_002416 NM_002438 NM_002449 NM_002451 NM_002460 NM_002469 NM_002478 NM_002485 NM_002500 NM_002501 NM_002509 NM_002518 NM_002519 NM_002545 NM_002563 NM_002569 NM_002577 NM_002581 NM_002610 NM_002613 NM_002631 NM_002639 NM_002640 NM_002641 NM_002649 NM_002656 NM_002657 NM_002662 NM_002687 NM_002703 NM_002709 NM_002715 NM_002718 NM_002731 NM_002745 NM_002758 NM_002767 NM_002806 NM_002813 NM_002816 NM_002822 NM_002831 NM_002834 NM_002835 NM_002844 NM_002847 NM_002848 NM_002851 NM_002868 NM_002869 NM_002874 NM_002886 NM_002898 NM_002906 NM_002912 NM_002916 NM_002941 NM_002942 NM_002986 NM_002998 NM_003003 NM_003010 NM_003012 NM_003014 NM_003016 NM_003017 NM_003031 NM_003045 NM_003046 NM_003048 NM_003101 NM_003107 NM_003108 NM_003111 NM_003112 NM_003114 NM_003150 NM_003155 NM_003157 NM_003161 NM_003174 NM_003178 NM_003182 NM_003185 NM_003189 NM_003192 NM_003203 NM_003205 NM_003212 NM_003234 NM_003238 NM_003247 NM_003257 NM_003262 NM_003274 NM_003281 NM_003304 NM_003309 NM_003317 NM_003325 NM_003336 NM_003337 NM_003339 NM_003340 NM_003347 NM_003349 NM_003352 NM_003359 NM_003371 NM_003374 NM_003379 NM_003383 NM_003387 NM_003390 NM_003392 NM_003400 NM_003404 NM_003405 NM_003411 NM_003413 NM_003417 NM_003423 NM_003435 NM_003457 NM_003463 NM_003468 NM_003478 NM_003483 NM_003487 NM_003488 NM_003489 NM_003503 NM_003505 NM_003506 NM_003507 NM_003559 NM_003574 NM_003589 NM_003590 NM_003605 NM_003615 NM_003617 NM_003618 NM_003622 NM_003626 NM_003628 NM_003633 NM_003640 NM_003647 NM_003648 NM_003663 NM_003668 NM_003670 NM_003671 NM_003701 NM_003713 NM_003722 NM_003743 NM_003744 NM_003759 NM_003763 NM_003772 NM_003774 NM_003778 NM_003791 NM_003793 NM_003794 NM_003799 NM_003800 NM_003818 NM_003822 NM_003850 NM_003856 NM_003861 NM_003873 NM_003884 NM_003896 NM_003899 NM_003900 NM_003913 NM_003921 NM_003927 NM_003930 NM_003953 NM_003966 NM_003968 NM_003972 NM_003983 NM_003994 NM_004004 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004028 NM_004054 NM_004056 NM_004060 NM_004064 NM_004071 NM_004079 NM_004093 NM_004099 NM_004105 NM_004113 NM_004119 NM_004124 NM_004129 NM_004161 NM_004171 NM_004180 NM_004237 NM_004241 NM_004261 NM_004272 NM_004286 NM_004288 NM_004294 NM_004302 NM_004331 NM_004338 NM_004342 NM_004346 NM_004348 NM_004370 NM_004379 NM_004392 NM_004405 NM_004414 NM_004432 NM_004437 NM_004438 NM_004439 NM_004440 NM_004457 NM_004458 NM_004464 NM_004480 NM_004482 NM_004496 NM_004499 NM_004502 NM_004504 NM_004505 NM_004506 NM_004508 NM_004520 NM_004537 NM_004549 NM_004586 NM_004592 NM_004598 NM_004612 NM_004622 NM_004631 NM_004634 NM_004641 NM_004663 NM_004670 NM_004675 NM_004685 NM_004686 NM_004709 NM_004715 NM_004725 NM_004728 NM_004731 NM_004733 NM_004745 NM_004757 NM_004779 NM_004786 NM_004796 NM_004808 NM_004817 NM_004834 NM_004840 NM_004844 NM_004849 NM_004863 NM_004866 NM_004871 NM_004873 NM_004879 NM_004897 NM_004902 NM_004904 NM_004906 NM_004912 NM_004921 NM_004923 NM_004926 NM_004929 NM_004936 NM_004947 NM_004949 NM_004956 NM_004960 NM_004973 NM_004985 NM_004992 NM_005010 NM_005014 NM_005036 NM_005038 NM_005042 NM_005045 NM_005047 NM_005048 NM_005068 NM_005069 NM_005076 NM_005077 NM_005079 NM_005086 NM_005114 NM_005116 NM_005117 NM_005121 NM_005126 NM_005128 NM_005147 NM_005151 NM_005180 NM_005188 NM_005195 NM_005197 NM_005204 NM_005226 NM_005228 NM_005233 NM_005239 NM_005245 NM_005257 NM_005259 NM_005311 NM_005313 NM_005327 NM_005342 NM_005346 NM_005347 NM_005358 NM_005369 NM_005375 NM_005385 NM_005388 NM_005389 NM_005397 NM_005399 NM_005418 NM_005433 NM_005436 NM_005455 NM_005461 NM_005463 NM_005470 NM_005483 NM_005487 NM_005491 NM_005496 NM_005502 NM_005503 NM_005504 NM_005506 NM_005509 NM_005513 NM_005530 NM_005536 NM_005542 NM_005544 NM_005570 NM_005573 NM_005578 NM_005589 NM_005593 NM_005595 NM_005611 NM_005627 NM_005637 NM_005639 NM_005644 NM_005656 NM_005662 NM_005665 NM_005667 NM_005668 NM_005681 NM_005704 NM_005715 NM_005717 NM_005730 NM_005748 NM_005749 NM_005783 NM_005795 NM_005813 NM_005816 NM_005828 NM_005832 NM_005839 NM_005840 NM_005842 NM_005853 NM_005857 NM_005859 NM_005863 NM_005870 NM_005871 NM_005880 NM_005896 NM_005897 NM_005898 NM_005900 NM_005901 NM_005902 NM_005903 NM_005906 NM_005907 NM_005920 NM_005923 NM_005930 NM_005935 NM_005965 NM_005966 NM_005986 NM_005999 NM_006013 NM_006030 NM_006037 NM_006045 NM_006047 NM_006063 NM_006065 NM_006067 NM_006090 NM_006094 NM_006096 NM_006106 NM_006134 NM_006135 NM_006136 NM_006139 NM_006153 NM_006154 NM_006162 NM_006166 NM_006186 NM_006195 NM_006202 NM_006203 NM_006206 NM_006209 NM_006228 NM_006239 NM_006243 NM_006251 NM_006253 NM_006255 NM_006264 NM_006265 NM_006275 NM_006282 NM_006283 NM_006306 NM_006313 NM_006315 NM_006320 NM_006322 NM_006323 NM_006345 NM_006353 NM_006359 NM_006366 NM_006375 NM_006380 NM_006386 NM_006388 NM_006390 NM_006393 NM_006401 NM_006403 NM_006407 NM_006420 NM_006449 NM_006474 NM_006479 NM_006491 NM_006493 NM_006496 NM_006504 NM_006508 NM_006527 NM_006534 NM_006537 NM_006538 NM_006540 NM_006546 NM_006547 NM_006549 NM_006561 NM_006565 NM_006571 NM_006572 NM_006575 NM_006578 NM_006593 NM_006595 NM_006599 NM_006620 NM_006624 NM_006626 NM_006628 NM_006633 NM_006646 NM_006661 NM_006665 NM_006667 NM_006681 NM_006699 NM_006716 NM_006718 NM_006722 NM_006729 NM_006731 NM_006734 NM_006738 NM_006746 NM_006756 NM_006772 NM_006773 NM_006777 NM_006783 NM_006790 NM_006793 NM_006805 NM_006813 NM_006822 NM_006827 NM_006867 NM_006868 NM_006870 NM_006888 NM_006895 NM_006902 NM_006915 NM_006918 NM_006922 NM_006925 NM_006930 NM_006948 NM_006955 NM_006969 NM_006995 NM_007006 NM_007007 NM_007027 NM_007031 NM_007038 NM_007040 NM_007043 NM_007049 NM_007050 NM_007072 NM_007085 NM_007106 NM_007129 NM_007145 NM_007146 NM_007157 NM_007168 NM_007173 NM_007175 NM_007187 NM_007200 NM_007203 NM_007212 NM_007214 NM_007217 NM_007220 NM_007222 NM_007231 NM_007246 NM_007249 NM_007257 NM_007276 NM_007285 NM_007306 NM_007331 NM_007351 NM_007353 NM_007362 NM_007375 NM_012072 NM_012073 NM_012082 NM_012083 NM_012090 NM_012092 NM_012096 NM_012115 NM_012120 NM_012129 NM_012137 NM_012141 NM_012151 NM_012153 NM_012156 NM_012175 NM_012177 NM_012193 NM_012215 NM_012219 NM_012223 NM_012238 NM_012244 NM_012249 NM_012252 NM_012262 NM_012281 NM_012287 NM_012300 NM_012301 NM_012306 NM_012322 NM_012327 NM_012329 NM_012333 NM_012345 NM_012382 NM_012388 NM_012392 NM_012395 NM_012397 NM_012399 NM_012409 NM_012414 NM_012415 NM_012425 NM_012431 NM_012446 NM_012453 NM_012463 NM_012465 NM_013231 NM_013242 NM_013243 NM_013252 NM_013254 NM_013255 NM_013256 NM_013257 NM_013261 NM_013262 NM_013302 NM_013309 NM_013315 NM_013341 NM_013371 NM_013372 NM_013374 NM_013386 NM_013390 NM_013396 NM_013437 NM_013438 NM_013444 NM_013446 NM_013943 NM_013996 NM_013997 NM_013998 NM_014003 NM_014007 NM_014011 NM_014016 NM_014021 NM_014028 NM_014039 NM_014043 NM_014044 NM_014048 NM_014056 NM_014080 NM_014098 NM_014106 NM_014112 NM_014155 NM_014166 NM_014211 NM_014217 NM_014220 NM_014226 NM_014250 NM_014251 NM_014257 NM_014293 NM_014294 NM_014313 NM_014319 NM_014326 NM_014335 NM_014342 NM_014361 NM_014368 NM_014372 NM_014382 NM_014394 NM_014395 NM_014396 NM_014397 NM_014398 NM_014421 NM_014438 NM_014442 NM_014456 NM_014468 NM_014485 NM_014504 NM_014518 NM_014548 NM_014554 NM_014563 NM_014570 NM_014577 NM_014585 NM_014586 NM_014614 NM_014615 NM_014616 NM_014618 NM_014634 NM_014646 NM_014647 NM_014648 NM_014653 NM_014656 NM_014666 NM_014668 NM_014674 NM_014676 NM_014679 NM_014682 NM_014683 NM_014686 NM_014689 NM_014699 NM_014701 NM_014702 NM_014706 NM_014729 NM_014735 NM_014739 NM_014743 NM_014746 NM_014751 NM_014755 NM_014756 NM_014760 NM_014761 NM_014765 NM_014776 NM_014779 NM_014787 NM_014789 NM_014795 NM_014802 NM_014805 NM_014809 NM_014819 NM_014827 NM_014829 NM_014836 NM_014838 NM_014839 NM_014844 NM_014848 NM_014860 NM_014864 NM_014872 NM_014873 NM_014883 NM_014887 NM_014888 NM_014892 NM_014895 NM_014903 NM_014904 NM_014905 NM_014906 NM_014910 NM_014912 NM_014913 NM_014918 NM_014920 NM_014924 NM_014929 NM_014936 NM_014943 NM_014946 NM_014947 NM_014951 NM_014953 NM_014957 NM_014961 NM_014962 NM_014965 NM_014990 NM_014991 NM_014996 NM_015003 NM_015008 NM_015025 NM_015027 NM_015032 NM_015033 NM_015040 NM_015045 NM_015046 NM_015049 NM_015056 NM_015066 NM_015071 NM_015087 NM_015088 NM_015091 NM_015092 NM_015093 NM_015097 NM_015100 NM_015137 NM_015138 NM_015143 NM_015144 NM_015149 NM_015155 NM_015170 NM_015180 NM_015185 NM_015191 NM_015192 NM_015199 NM_015200 NM_015205 NM_015208 NM_015215 NM_015216 NM_015225 NM_015226 NM_015230 NM_015231 NM_015234 NM_015236 NM_015251 NM_015254 NM_015264 NM_015265 NM_015267 NM_015272 NM_015275 NM_015277 NM_015278 NM_015286 NM_015289 NM_015296 NM_015299 NM_015310 NM_015313 NM_015317 NM_015323 NM_015328 NM_015329 NM_015335 NM_015347 NM_015349 NM_015352 NM_015355 NM_015358 NM_015359 NM_015375 NM_015378 NM_015385 NM_015393 NM_015394 NM_015396 NM_015409 NM_015423 NM_015429 NM_015443 NM_015446 NM_015455 NM_015458 NM_015469 NM_015507 NM_015516 NM_015530 NM_015532 NM_015542 NM_015550 NM_015553 NM_015554 NM_015560 NM_015565 NM_015568 NM_015569 NM_015570 NM_015576 NM_015578 NM_015595 NM_015601 NM_015605 NM_015630 NM_015640 NM_015641 NM_015646 NM_015678 NM_015691 NM_015695 NM_015713 NM_015833 NM_015840 NM_015841 NM_015878 NM_015886 NM_015891 NM_015928 NM_015967 NM_015971 NM_015974 NM_015975 NM_015986 NM_015990 NM_015995 NM_016018 NM_016019 NM_016021 NM_016023 NM_016040 NM_016045 NM_016052 NM_016063 NM_016065 NM_016072 NM_016073 NM_016076 NM_016078 NM_016081 NM_016083 NM_016087 NM_016096 NM_016100 NM_016107 NM_016108 NM_016114 NM_016115 NM_016120 NM_016121 NM_016123 NM_016132 NM_016133 NM_016138 NM_016162 NM_016169 NM_016194 NM_016195 NM_016206 NM_016217 NM_016221 NM_016231 NM_016248 NM_016255 NM_016261 NM_016269 NM_016271 NM_016275 NM_016310 NM_016312 NM_016322 NM_016338 NM_016340 NM_016359 NM_016369 NM_016374 NM_016399 NM_016410 NM_016418 NM_016426 NM_016436 NM_016441 NM_016442 NM_016448 NM_016470 NM_016480 NM_016488 NM_016513 NM_016530 NM_016531 NM_016540 NM_016541 NM_016542 NM_016544 NM_016557 NM_016562 NM_016575 NM_016577 NM_016580 NM_016587 NM_016605 NM_016607 NM_016608 NM_016613 NM_016617 NM_016622 NM_016628 NM_016652 NM_016831 NM_017414 NM_017415 NM_017420 NM_017435 NM_017437 NM_017460 NM_017495 NM_017522 NM_017544 NM_017556 NM_017577 NM_017582 NM_017594 NM_017599 NM_017612 NM_017628 NM_017629 NM_017635 NM_017641 NM_017644 NM_017645 NM_017654 NM_017655 NM_017656 NM_017661 NM_017664 NM_017665 NM_017684 NM_017692 NM_017709 NM_017719 NM_017724 NM_017736 NM_017737 NM_017742 NM_017751 NM_017768 NM_017769 NM_017772 NM_017773 NM_017775 NM_017778 NM_017779 NM_017780 NM_017785 NM_017801 NM_017810 NM_017811 NM_017813 NM_017847 NM_017853 NM_017896 NM_017905 NM_017924 NM_017927 NM_017938 NM_017945 NM_017951 NM_017964 NM_017968 NM_017988 NM_017990 NM_018003 NM_018011 NM_018018 NM_018046 NM_018048 NM_018061 NM_018079 NM_018092 NM_018098 NM_018121 NM_018126 NM_018133 NM_018137 NM_018142 NM_018156 NM_018158 NM_018159 NM_018169 NM_018170 NM_018176 NM_018178 NM_018196 NM_018200 NM_018204 NM_018211 NM_018212 NM_018214 NM_018227 NM_018229 NM_018244 NM_018252 NM_018257 NM_018264 NM_018269 NM_018290 NM_018292 NM_018299 NM_018307 NM_018323 NM_018327 NM_018351 NM_018353 NM_018362 NM_018364 NM_018365 NM_018370 NM_018374 NM_018375 NM_018387 NM_018394 NM_018396 NM_018420 NM_018437 NM_018439 NM_018440 NM_018452 NM_018454 NM_018464 NM_018490 NM_018566 NM_018569 NM_018579 NM_018602 NM_018640 NM_018652 NM_018657 NM_018658 NM_018691 NM_018695 NM_018698 NM_018700 NM_018724 NM_018728 NM_018834 NM_018837 NM_018841 NM_018846 NM_018894 NM_018933 NM_018938 NM_018945 NM_018970 NM_018993 NM_018999 NM_019000 NM_019001 NM_019009 NM_019022 NM_019061 NM_019063 NM_019069 NM_019080 NM_019081 NM_019083 NM_019084 NM_019086 NM_019087 NM_019091 NM_019094 NM_019106 NM_019119 NM_019555 NM_019556 NM_019590 NM_019610 NM_019613 NM_019618 NM_019885 NM_019894 NM_020119 NM_020123 NM_020130 NM_020133 NM_020139 NM_020147 NM_020148 NM_020152 NM_020159 NM_020163 NM_020177 NM_020182 NM_020198 NM_020245 NM_020311 NM_020335 NM_020337 NM_020338 NM_020340 NM_020341 NM_020342 NM_020346 NM_020367 NM_020381 NM_020390 NM_020398 NM_020399 NM_020403 NM_020432 NM_020437 NM_020445 NM_020453 NM_020456 NM_020463 NM_020472 NM_020473 NM_020474 NM_020546 NM_020640 NM_020647 NM_020648 NM_020651 NM_020652 NM_020661 NM_020665 NM_020673 NM_020674 NM_020699 NM_020714 NM_020724 NM_020727 NM_020728 NM_020739 NM_020747 NM_020748 NM_020751 NM_020755 NM_020762 NM_020766 NM_020768 NM_020769 NM_020773 NM_020774 NM_020779 NM_020782 NM_020783 NM_020786 NM_020796 NM_020801 NM_020805 NM_020808 NM_020821 NM_020825 NM_020828 NM_020841 NM_020858 NM_020861 NM_020918 NM_020919 NM_020925 NM_020935 NM_020940 NM_020947 NM_020948 NM_020951 NM_020957 NM_020980 NM_021003 NM_021023 NM_021032 NM_021038 NM_021083 NM_021101 NM_021111 NM_021116 NM_021133 NM_021146 NM_021155 NM_021163 NM_021167 NM_021181 NM_021183 NM_021190 NM_021201 NM_021215 NM_021218 NM_021239 NM_021240 NM_021252 NM_021255 NM_021269 NM_021619 NM_021622 NM_021629 NM_021638 NM_021645 NM_021649 NM_021735 NM_021736 NM_021737 NM_021738 NM_021813 NM_021814 NM_021815 NM_021818 NM_021914 NM_021927 NM_021935 NM_021945 NM_021950 NM_021951 NM_021957 NM_021960 NM_021961 NM_021965 NM_021977 NM_021988 NM_022041 NM_022050 NM_022051 NM_022060 NM_022070 NM_022074 NM_022079 NM_022080 NM_022106 NM_022114 NM_022118 NM_022121 NM_022136 NM_022143 NM_022149 NM_022153 NM_022160 NM_022351 NM_022442 NM_022458 NM_022459 NM_022461 NM_022469 NM_022473 NM_022474 NM_022475 NM_022491 NM_022495 NM_022652 NM_022716 NM_022725 NM_022726 NM_022739 NM_022755 NM_022756 NM_022757 NM_022763 NM_022767 NM_022771 NM_022776 NM_022777 NM_022802 NM_022818 NM_022828 NM_022829 NM_022837 NM_022843 NM_022893 NM_022894 NM_022898 NM_022899 NM_022902 NM_022912 NM_022913 NM_022969 NM_022970 NM_022972 NM_022975 NM_022977 NM_023005 NM_023011 NM_023012 NM_023016 NM_023028 NM_023029 NM_023030 NM_023031 NM_023920 NM_023923 NM_023934 NM_023940 NM_024061 NM_024072 NM_024110 NM_024295 NM_024312 NM_024332 NM_024334 NM_024336 NM_024408 NM_024422 NM_024423 NM_024424 NM_024425 NM_024426 NM_024490 NM_024491 NM_024496 NM_024501 NM_024557 NM_024561 NM_024563 NM_024569 NM_024574 NM_024584 NM_024594 NM_024610 NM_024611 NM_024613 NM_024624 NM_024629 NM_024636 NM_024640 NM_024641 NM_024646 NM_024647 NM_024666 NM_024680 NM_024685 NM_024692 NM_024701 NM_024713 NM_024745 NM_024755 NM_024756 NM_024795 NM_024814 NM_024818 NM_024831 NM_024834 NM_024837 NM_024841 NM_024847 NM_024863 NM_024878 NM_024896 NM_024915 NM_024918 NM_024920 NM_024922 NM_024924 NM_024941 NM_024944 NM_024949 NM_024989 NM_024993 NM_024997 NM_025009 NM_025054 NM_025073 NM_025090 NM_025133 NM_025146 NM_025151 NM_025160 NM_025164 NM_025187 NM_025191 NM_025205 NM_025235 NM_025237 NM_025238 NM_025240 NM_025265 NM_030569 NM_030583 NM_030621 NM_030623 NM_030625 NM_030627 NM_030634 NM_030639 NM_030650 NM_030661 NM_030664 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030773 NM_030777 NM_030806 NM_030817 NM_030820 NM_030881 NM_030911 NM_030915 NM_030918 NM_030934 NM_030939 NM_030945 NM_030962 NM_030964 NM_030965 NM_031208 NM_031211 NM_031216 NM_031243 NM_031262 NM_031263 NM_031266 NM_031268 NM_031271 NM_031296 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031372 NM_031417 NM_031418 NM_031419 NM_031423 NM_031426 NM_031435 NM_031438 NM_031453 NM_031461 NM_031462 NM_031468 NM_031469 NM_031476 NM_031483 NM_031866 NM_031887 NM_031888 NM_031912 NM_031939 NM_031940 NM_031942 NM_031988 NM_032012 NM_032042 NM_032043 NM_032102 NM_032116 NM_032121 NM_032136 NM_032144 NM_032145 NM_032153 NM_032177 NM_032189 NM_032227 NM_032228 NM_032229 NM_032242 NM_032279 NM_032287 NM_032291 NM_032329 NM_032354 NM_032361 NM_032408 NM_032410 NM_032413 NM_032433 NM_032435 NM_032436 NM_032438 NM_032440 NM_032446 NM_032458 NM_032471 NM_032513 NM_032532 NM_032552 NM_032581 NM_032582 NM_032590 NM_032594 NM_032625 NM_032717 NM_032718 NM_032740 NM_032783 NM_032797 NM_032800 NM_032815 NM_032817 NM_032826 NM_032832 NM_032833 NM_032842 NM_032859 NM_032860 NM_032873 NM_032900 NM_032932 NM_032968 NM_032969 NM_032973 NM_032975 NM_032980 NM_032988 NM_032991 NM_032999 NM_033000 NM_033001 NM_033012 NM_033035 NM_033044 NM_033051 NM_033055 NM_033114 NM_033121 NM_033128 NM_033133 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033161 NM_033181 NM_033206 NM_033207 NM_033211 NM_033224 NM_033285 NM_033300 NM_033305 NM_033331 NM_033346 NM_033360 NM_033380 NM_033381 NM_033387 NM_033389 NM_033394 NM_033402 NM_033426 NM_033427 NM_033428 NM_033430 NM_033437 NM_033505 NM_033512 NM_033548 NM_033550 NM_033631 NM_033644 NM_033645 NM_033655 NM_033656 NM_033666 NM_048368 NM_052822 NM_052827 NM_052851 NM_052855 NM_052857 NM_052862 NM_052864 NM_052873 NM_052876 NM_052879 NM_052896 NM_052900 NM_052904 NM_052905 NM_052910 NM_052917 NM_052941 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053056 NM_053277 NM_054016 NM_057159 NM_057168 NM_057169 NM_057170 NM_057175 NM_057178 NM_058170 NM_058178 NM_058241 NM_078470 NM_078473 NM_078476 NM_078487 NM_080548 NM_080549 NM_080591 NM_080599 NM_080629 NM_080630 NM_080645 NM_080654 NM_080657 NM_080666 NM_080678 NM_080682 NM_080683 NM_080684 NM_080685 NM_080687 NM_080759 NM_080760 NM_080792 NM_080832 NM_080867 NM_080872 NM_080874 NM_080876 NM_080927 NM_100264 NM_100486 NM_101395 NM_130435 NM_130436 NM_130437 NM_130438 NM_130459 NM_130463 NM_130466 NM_130773 NM_130809 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130842 NM_130843 NM_133170 NM_133171 NM_133177 NM_133178 NM_133265 NM_133334 NM_133371 NM_133372 NM_133433 NM_133445 NM_133448 NM_133451 NM_133459 NM_133460 NM_133468 NM_133496 NM_133631 NM_134264 NM_134434 NM_134442 NM_138270 NM_138271 NM_138282 NM_138284 NM_138287 NM_138288 NM_138316 NM_138347 NM_138362 NM_138386 NM_138400 NM_138423 NM_138440 NM_138444 NM_138468 NM_138551 NM_138576 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138638 NM_138713 NM_138714 NM_138715 NM_138716 NM_138731 NM_138782 NM_138793 NM_138795 NM_138931 NM_138958 NM_138970 NM_139012 NM_139014 NM_139015 NM_139078 NM_139157 NM_139169 NM_139182 NM_139207 NM_139215 NM_139245 NM_139275 NM_139276 NM_139279 NM_139283 NM_139319 NM_139321 NM_139323 NM_139352 NM_144490 NM_144567 NM_144578 NM_144597 NM_144599 NM_144607 NM_144610 NM_144642 NM_144658 NM_144664 NM_144682 NM_144701 NM_144709 NM_144721 NM_144722 NM_144732 NM_144733 NM_144734 NM_144767 NM_144778 NM_144949 NM_144982 NM_144996 NM_145011 NM_145048 NM_145052 NM_145115 NM_145117 NM_145159 NM_145207 NM_145212 NM_145213 NM_145231 NM_145257 NM_145263 NM_145278 NM_145284 NM_145294 NM_145307 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145341 NM_145342 NM_145686 NM_145687 NM_145697 NM_145728 NM_145733 NM_145734 NM_145735 NM_145753 NM_145756 NM_145808 NM_145809 NM_145810 NM_145859 NM_145860 NM_145863 NM_145913 NM_145914 NM_147150 NM_147156 NM_147223 NM_147233 NM_148170 NM_148174 NM_148175 NM_148176 NM_148977 NM_148978 NM_152235 NM_152259 NM_152261 NM_152269 NM_152271 NM_152280 NM_152281 NM_152287 NM_152289 NM_152291 NM_152306 NM_152314 NM_152332 NM_152367 NM_152379 NM_152384 NM_152399 NM_152407 NM_152409 NM_152418 NM_152442 NM_152444 NM_152449 NM_152450 NM_152460 NM_152462 NM_152488 NM_152510 NM_152519 NM_152522 NM_152527 NM_152540 NM_152588 NM_152594 NM_152605 NM_152608 NM_152622 NM_152624 NM_152630 NM_152636 NM_152641 NM_152678 NM_152688 NM_152716 NM_152723 NM_152724 NM_152737 NM_152739 NM_152745 NM_152754 NM_152758 NM_152772 NM_152774 NM_152776 NM_152793 NM_152829 NM_152834 NM_152835 NM_152838 NM_152864 NM_152866 NM_152879 NM_152890 NM_152896 NM_152903 NM_152933 NM_152934 NM_152999 NM_153010 NM_153015 NM_153035 NM_153207 NM_153223 NM_153234 NM_153235 NM_153238 NM_153240 NM_153262 NM_153263 NM_153343 NM_153347 NM_153354 NM_153361 NM_153371 NM_153381 NM_153456 NM_153499 NM_153500 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153631 NM_153632 NM_153634 NM_153649 NM_153686 NM_153687 NM_153688 NM_153689 NM_153694 NM_153712 NM_153754 NM_153758 NM_153810 NM_153825 NM_153826 NM_170679 NM_170709 NM_170710 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170740 NM_170741 NM_170742 NM_171982 NM_171998 NM_172037 NM_172058 NM_172059 NM_172060 NM_172069 NM_172070 NM_172193 NM_172216 NM_172218 NM_172226 NM_172239 NM_172241 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172373 NM_172387 NM_172388 NM_172389 NM_173054 NM_173078 NM_173082 NM_173083 NM_173171 NM_173172 NM_173173 NM_173214 NM_173353 NM_173355 NM_173459 NM_173468 NM_173469 NM_173470 NM_173473 NM_173475 NM_173483 NM_173497 NM_173510 NM_173511 NM_173517 NM_173528 NM_173529 NM_173531 NM_173536 NM_173547 NM_173557 NM_173580 NM_173582 NM_173583 NM_173602 NM_173607 NM_173626 NM_173631 NM_173644 NM_173646 NM_173651 NM_173654 NM_173665 NM_173666 NM_173667 NM_173669 NM_173683 NM_173694 NM_173698 NM_173700 NM_173808 NM_173812 NM_173822 NM_173827 NM_173829 NM_173848 NM_173854 NM_174871 NM_174887 NM_174901 NM_174921 NM_174950 NM_175058 NM_175064 NM_175069 NM_175071 NM_175072 NM_175073 NM_175085 NM_175566 NM_175610 NM_175736 NM_175747 NM_175854 NM_175876 NM_175907 NM_175921 NM_175924 NM_176787 NM_176814 NM_176815 NM_176824 NM_177414 NM_177424 NM_177438 NM_177453 NM_177538 NM_177947 NM_177948 NM_177952 NM_177968 NM_177974 NM_177990 NM_177996 NM_178006 NM_178007 NM_178011 NM_178012 NM_178127 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178342 NM_178445 NM_178509 NM_178514 NM_178539 NM_178544 NM_178566 NM_178583 NM_178585 NM_178812 NM_178814 NM_178815 NM_178816 NM_178842 NM_180989 NM_180991 NM_181076 NM_181077 NM_181265 NM_181354 NM_181358 NM_181361 NM_181435 NM_181443 NM_181457 NM_181458 NM_181459 NM_181460 NM_181481 NM_181482 NM_181483 NM_181489 NM_181502 NM_181504 NM_181523 NM_181524 NM_181527 NM_181528 NM_181531 NM_181573 NM_181644 NM_181659 NM_181706 NM_181714 NM_181717 NM_181723 NM_181725 NM_181762 NM_181776 NM_181777 NM_181789 NM_181794 NM_181795 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181838 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_181897 NM_182314 NM_182398 NM_182472 NM_182485 NM_182487 NM_182501 NM_182508 NM_182540 NM_182558 NM_182568 NM_182612 NM_182620 NM_182631 NM_182643 NM_182646 NM_182691 NM_182692 NM_182700 NM_182703 NM_182709 NM_182710 NM_182728 NM_182734 NM_182756 NM_182757 NM_182763 NM_182764 NM_182797 NM_182830 NM_182896 NM_182898 NM_182899 NM_182910 NM_182912 NM_182913 NM_182914 NM_182931 NM_182948 NM_182964 NM_183004 NM_183045 NM_183065 NM_183079 NM_183238 NM_183247 NM_183353 NM_183414 NM_183415 NM_183425 NM_184234 NM_184237 NM_184241 NM_184244 NM_194071 NM_194277 NM_194282 NM_194285 NM_194286 NM_194291 NM_194292 NM_194294 NM_194301 NM_194303 NM_194314 NM_194317 NM_194318 NM_194356 NM_194434 NM_194442 NM_194449 NM_194454 NM_194455 NM_194456 NM_197941 NM_197955 NM_197978 NM_198066 NM_198074 NM_198076 NM_198077 NM_198123 NM_198124 NM_198128 NM_198150 NM_198152 NM_198156 NM_198157 NM_198158 NM_198159 NM_198177 NM_198178 NM_198194 NM_198195 NM_198196 NM_198197 NM_198215 NM_198225 NM_198261 NM_198262 NM_198268 NM_198269 NM_198270 NM_198271 NM_198279 NM_198287 NM_198329 NM_198336 NM_198337 NM_198389 NM_198399 NM_198400 NM_198401 NM_198459 NM_198460 NM_198461 NM_198465 NM_198467 NM_198484 NM_198485 NM_198506 NM_198513 NM_198549 NM_198569 NM_198581 NM_198584 NM_198595 NM_198596 NM_198682 NM_198793 NM_198794 NM_198833 NM_198843 NM_198845 NM_198846 NM_198847 NM_198859 NM_198887 NM_198896 NM_198900 NM_198956 NM_198965 NM_198966 NM_198974 NM_198992 NM_199039 NM_199040 NM_199044 NM_199050 NM_199072 NM_199131 NM_199132 NM_199144 NM_199160 NM_199168 NM_199169 NM_199170 NM_199171 NM_199182 NM_199188 NM_199189 NM_199190 NM_199203 NM_199246 NM_199259 NM_199260 NM_199261 NM_199324 NM_199421 NM_199436 NM_199454 NM_199462 NM_199478 NM_199487 NM_199513 NM_201268 NM_201437 NM_201439 NM_201440 NM_201515 NM_201570 NM_201571 NM_201572 NM_201590 NM_201593 NM_201596 NM_201597 NM_201629 NM_203301 NM_203327 NM_203329 NM_203330 NM_203331 NM_203339 NM_203341 NM_203342 NM_203343 NM_203350 NM_203354 NM_203355 NM_203356 NM_203357 NM_203372 NM_203381 NM_203394 NM_203395 NM_203406 NM_203417 NM_203418 NM_203453 NM_203463 NM_203468 NM_203487 NM_205857 NM_205860 NM_206853 NM_206854 NM_206855 NM_206866 NM_206876 NM_206877 NM_206893 NM_206907 NM_206909 NM_206937 NM_206938 NM_206939 NM_206940 NM_207003 NM_207032 NM_207033 NM_207034 NM_207035 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207304 NM_207321 NM_207325 NM_207357 NM_207359 NM_207371 NM_207372 NM_207430 NM_207435 NM_207437 NM_207448 NM_207471 NM_207479 NM_207486 NM_207503 NM_207506 NM_207517 NM_207645 NM_207647 NM_212543 NM_212558 NM_213566 NM_213589 NM_213612 NM_213618 NM_213651 NM_213662 NM_214676 NM_214677 NM_214678 NM_214679 NM_214711 XM_027236 XM_027307 XM_031553 XM_031689 XM_032571 XM_034274 XM_034872 XM_035299 XM_038436 XM_039627 XM_039676 XM_042301 XM_042833 XM_044178 XM_044434 XM_046581 XM_047550 XM_047554 XM_048128 XM_051081 XM_058513 XM_059929 XM_087353 XM_113743 XM_113947 XM_113967 XM_117294 XM_166103 XM_167147 XM_208333 XM_209429 XM_209607 XM_209700 XM_211090 XM_211367 XM_212061 XM_290597 XM_290615 XM_291007 XM_291019 XM_291095 XM_291128 XM_291671 XM_292184 XM_292357 XM_293918 XM_294765 XM_350880 XM_370577 XM_370654 XM_370837 XM_370839 XM_370843 XM_370876 XM_370878 XM_370917 XM_371009 XM_371074 XM_371116 XM_371204 XM_371254 XM_371461 XM_371474 XM_371590 XM_371691 XM_371783 XM_371837 XM_371838 XM_371933 XM_371943 XM_372004 XM_372097 XM_372205 XM_372227 XM_372233 XM_373030 XM_373290 XM_374013 XM_374460 XM_374491 XM_374589 XM_374765 XM_374768 XM_374983 XM_375007 XM_375152 XM_375357 XM_375606 XM_375608 XM_375646 XM_375697 XM_375698 XM_375838 XM_375929 XM_376018 XM_376062 XM_376254 XM_376278 XM_376386 XM_376412 XM_376444 XM_376454 XM_376550 XM_376602 XM_376679 XM_376680 XM_376784 XM_376795 XM_376902 XM_376905 XM_378208 XM_378273 XM_378309 XM_378316 XM_378379 XM_378411 XM_378512 XM_378529 XM_378573 XM_378620 XM_378712 XM_378741 XM_378783 XM_378876 XM_378914 XM_378982 XM_379006 XM_379030 XM_379074 XM_379075 XM_379123 XM_379228 XM_379267 XM_379276 XM_379402 XM_379409 XM_379438 XM_379454 XM_379459 XM_379484 XM_379595 XM_379619 XM_379720 XM_379820 XM_379858 XM_379933 XM_379934 XM_380100 XM_495798 XM_495844 XM_495961 XM_496036 XM_496048 XM_496070 XM_496076 XM_496088 XM_496093 XM_496096 XM_496134 XM_496156 XM_496688 XM_496814 XM_496826 XM_496879 XM_496892 XM_496905 XM_496912 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497012 XM_498436 XM_498441 XM_498442 XM_498456 XM_498464 XM_498506 XM_498569 XM_498572 XM_498614 XM_498631 XM_498646 XM_498660 XM_498679 XM_498901 XM_498902 XM_499065 XM_499117 XM_499123 XM_499147 XM_499182 XM_499298 XM_499309 XM_499314 XM_499317 XM_499333 XM_499338 XM_499354 XM_499356 XM_499392 XM_499515 XM_499566 XM_499571 XM_499572 XM_499594 XR_000182 XR_000195 XR_000216
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)