VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"gguggaccggucgauguaugu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6308
.
Total Genes with multiple seed matches:
1993
.
Genes with at least one seed match:
NM_000015 NM_000021 NM_000027 NM_000038 NM_000043 NM_000044 NM_000046 NM_000049 NM_000052 NM_000054 NM_000070 NM_000081 NM_000082 NM_000084 NM_000088 NM_000090 NM_000091 NM_000096 NM_000097 NM_000103 NM_000104 NM_000112 NM_000114 NM_000115 NM_000133 NM_000136 NM_000141 NM_000151 NM_000153 NM_000158 NM_000161 NM_000165 NM_000167 NM_000168 NM_000176 NM_000188 NM_000192 NM_000201 NM_000212 NM_000214 NM_000216 NM_000218 NM_000220 NM_000222 NM_000231 NM_000232 NM_000233 NM_000237 NM_000240 NM_000242 NM_000245 NM_000246 NM_000248 NM_000250 NM_000252 NM_000254 NM_000256 NM_000275 NM_000276 NM_000277 NM_000278 NM_000292 NM_000293 NM_000296 NM_000305 NM_000312 NM_000319 NM_000322 NM_000325 NM_000330 NM_000332 NM_000333 NM_000334 NM_000336 NM_000337 NM_000344 NM_000345 NM_000346 NM_000351 NM_000361 NM_000365 NM_000368 NM_000370 NM_000372 NM_000378 NM_000380 NM_000381 NM_000386 NM_000397 NM_000399 NM_000406 NM_000418 NM_000428 NM_000429 NM_000430 NM_000435 NM_000436 NM_000437 NM_000438 NM_000439 NM_000448 NM_000450 NM_000451 NM_000452 NM_000453 NM_000454 NM_000462 NM_000483 NM_000486 NM_000492 NM_000493 NM_000512 NM_000525 NM_000527 NM_000535 NM_000536 NM_000538 NM_000551 NM_000555 NM_000573 NM_000577 NM_000578 NM_000579 NM_000584 NM_000586 NM_000588 NM_000590 NM_000596 NM_000599 NM_000618 NM_000621 NM_000623 NM_000624 NM_000625 NM_000627 NM_000629 NM_000632 NM_000633 NM_000634 NM_000639 NM_000641 NM_000647 NM_000651 NM_000663 NM_000664 NM_000671 NM_000676 NM_000677 NM_000681 NM_000686 NM_000689 NM_000692 NM_000695 NM_000696 NM_000702 NM_000705 NM_000706 NM_000715 NM_000719 NM_000729 NM_000742 NM_000745 NM_000755 NM_000780 NM_000782 NM_000785 NM_000793 NM_000800 NM_000809 NM_000811 NM_000814 NM_000818 NM_000823 NM_000824 NM_000832 NM_000834 NM_000837 NM_000838 NM_000843 NM_000844 NM_000851 NM_000859 NM_000860 NM_000868 NM_000872 NM_000876 NM_000877 NM_000891 NM_000899 NM_000901 NM_000906 NM_000910 NM_000914 NM_000922 NM_000925 NM_000927 NM_000929 NM_000933 NM_000935 NM_000944 NM_000945 NM_000950 NM_000951 NM_000956 NM_000958 NM_000963 NM_000965 NM_000983 NM_000984 NM_000997 NM_001001331 NM_001001342 NM_001001344 NM_001001349 NM_001001394 NM_001001395 NM_001001396 NM_001001412 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001548 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001660 NM_001001662 NM_001001664 NM_001001675 NM_001001679 NM_001001680 NM_001001686 NM_001001692 NM_001001698 NM_001001700 NM_001001702 NM_001001707 NM_001001709 NM_001001787 NM_001001870 NM_001001872 NM_001001873 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001938 NM_001001971 NM_001001974 NM_001001995 NM_001002006 NM_001002231 NM_001002232 NM_001002233 NM_001002243 NM_001002257 NM_001002269 NM_001002294 NM_001002295 NM_001002811 NM_001002812 NM_001002814 NM_001002843 NM_001002860 NM_001002881 NM_001002909 NM_001002912 NM_001002914 NM_001002915 NM_001002919 NM_001002924 NM_001003395 NM_001003396 NM_001003397 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003688 NM_001003689 NM_001003698 NM_001003699 NM_001003712 NM_001003790 NM_001003791 NM_001003795 NM_001003800 NM_001003818 NM_001003819 NM_001003827 NM_001003895 NM_001003937 NM_001003940 NM_001003942 NM_001003943 NM_001004053 NM_001004106 NM_001004285 NM_001004286 NM_001004297 NM_001004299 NM_001004300 NM_001004301 NM_001004302 NM_001004306 NM_001004308 NM_001004313 NM_001004315 NM_001004317 NM_001004322 NM_001004328 NM_001004329 NM_001004339 NM_001004348 NM_001004356 NM_001004358 NM_001004360 NM_001004707 NM_001005209 NM_001005210 NM_001005340 NM_001005353 NM_001005375 NM_001005388 NM_001005409 NM_001005413 NM_001005414 NM_001005463 NM_001005473 NM_001005476 NM_001005527 NM_001005609 NM_001005737 NM_001005743 NM_001005744 NM_001005745 NM_001005753 NM_001005766 NM_001005781 NM_001005782 NM_001005785 NM_001005786 NM_001005862 NM_001006109 NM_001006115 NM_001006600 NM_001006604 NM_001006616 NM_001006623 NM_001006634 NM_001006635 NM_001006657 NM_001006666 NM_001006932 NM_001006946 NM_001007023 NM_001007026 NM_001007027 NM_001007067 NM_001007068 NM_001007069 NM_001007070 NM_001007094 NM_001007097 NM_001007098 NM_001007102 NM_001007156 NM_001007188 NM_001007214 NM_001007224 NM_001007225 NM_001007232 NM_001007233 NM_001007237 NM_001007239 NM_001007245 NM_001007246 NM_001007254 NM_001007257 NM_001007258 NM_001007262 NM_001007279 NM_001007466 NM_001007525 NM_001007538 NM_001007540 NM_001007559 NM_001007563 NM_001008211 NM_001008212 NM_001008213 NM_001008220 NM_001008224 NM_001008225 NM_001008226 NM_001008234 NM_001008239 NM_001008390 NM_001008391 NM_001008393 NM_001008397 NM_001008406 NM_001008407 NM_001008408 NM_001008409 NM_001008410 NM_001008491 NM_001008492 NM_001008493 NM_001008495 NM_001008537 NM_001008539 NM_001008540 NM_001008541 NM_001008564 NM_001008660 NM_001008661 NM_001008662 NM_001008707 NM_001008710 NM_001008711 NM_001008738 NM_001008742 NM_001008744 NM_001008777 NM_001008781 NM_001008801 NM_001008925 NM_001008938 NM_001009182 NM_001009183 NM_001009184 NM_001009552 NM_001009553 NM_001009569 NM_001009610 NM_001009814 NM_001009820 NM_001009880 NM_001009894 NM_001009899 NM_001009909 NM_001009913 NM_001009922 NM_001009932 NM_001009933 NM_001009934 NM_001009937 NM_001009938 NM_001009944 NM_001009956 NM_001009960 NM_001009998 NM_001010000 NM_001010846 NM_001010853 NM_001010861 NM_001010866 NM_001010867 NM_001010871 NM_001010874 NM_001010883 NM_001010888 NM_001010891 NM_001010898 NM_001010913 NM_001010915 NM_001010917 NM_001010934 NM_001010942 NM_001010984 NM_001011513 NM_001011514 NM_001011539 NM_001011544 NM_001011551 NM_001011554 NM_001011645 NM_001011655 NM_001011656 NM_001011657 NM_001011663 NM_001011666 NM_001011708 NM_001011709 NM_001011713 NM_001011720 NM_001011724 NM_001011725 NM_001012239 NM_001012267 NM_001012274 NM_001012302 NM_001012320 NM_001012339 NM_001012393 NM_001012398 NM_001012410 NM_001012412 NM_001012415 NM_001012418 NM_001012420 NM_001012423 NM_001012424 NM_001012452 NM_001012456 NM_001012614 NM_001012642 NM_001012714 NM_001012716 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012756 NM_001012763 NM_001012968 NM_001012971 NM_001012977 NM_001012981 NM_001012989 NM_001013000 NM_001013005 NM_001013029 NM_001013031 NM_001013406 NM_001013438 NM_001013439 NM_001013619 NM_001013637 NM_001013646 NM_001013650 NM_001013652 NM_001013656 NM_001013674 NM_001013675 NM_001013680 NM_001013682 NM_001013688 NM_001013690 NM_001013691 NM_001013695 NM_001013699 NM_001013705 NM_001013706 NM_001013707 NM_001013710 NM_001013724 NM_001013725 NM_001013727 NM_001013748 NM_001013843 NM_001013848 NM_001014380 NM_001014434 NM_001014449 NM_001014451 NM_001014797 NM_001014831 NM_001014832 NM_001014833 NM_001014834 NM_001014835 NM_001015045 NM_001015048 NM_001015049 NM_001015051 NM_001015508 NM_001015877 NM_001015880 NM_001015881 NM_001015886 NM_001017368 NM_001017370 NM_001017371 NM_001017395 NM_001017408 NM_001017415 NM_001017416 NM_001017420 NM_001017423 NM_001017424 NM_001017425 NM_001017523 NM_001017526 NM_001017919 NM_001017922 NM_001017926 NM_001017963 NM_001017970 NM_001017973 NM_001017974 NM_001017975 NM_001017977 NM_001017979 NM_001017980 NM_001017992 NM_001017995 NM_001017998 NM_001018009 NM_001018037 NM_001018040 NM_001018053 NM_001018054 NM_001018055 NM_001018058 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018072 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018102 NM_001018161 NM_001018676 NM_001018677 NM_001020658 NM_001020825 NM_001023563 NM_001023566 NM_001023567 NM_001023587 NM_001024024 NM_001024070 NM_001024071 NM_001024094 NM_001024372 NM_001024380 NM_001024381 NM_001024401 NM_001024455 NM_001024460 NM_001024463 NM_001024592 NM_001024596 NM_001024630 NM_001024631 NM_001024649 NM_001024657 NM_001024680 NM_001024688 NM_001024843 NM_001024844 NM_001024855 NM_001024912 NM_001024948 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025105 NM_001025108 NM_001025193 NM_001025233 NM_001025242 NM_001025243 NM_001025252 NM_001025253 NM_001025266 NM_001038 NM_001041 NM_001046 NM_001047 NM_001066 NM_001071 NM_001080 NM_001081 NM_001083 NM_001087 NM_001093 NM_001096 NM_001099 NM_001101 NM_001105 NM_001107 NM_001114 NM_001121 NM_001125 NM_001127 NM_001128 NM_001146 NM_001149 NM_001154 NM_001158 NM_001159 NM_001160 NM_001166 NM_001167 NM_001172 NM_001177 NM_001178 NM_001186 NM_001204 NM_001206 NM_001211 NM_001222 NM_001223 NM_001227 NM_001241 NM_001243 NM_001244 NM_001257 NM_001259 NM_001260 NM_001265 NM_001267 NM_001268 NM_001275 NM_001277 NM_001282 NM_001284 NM_001286 NM_001289 NM_001290 NM_001295 NM_001300 NM_001304 NM_001310 NM_001316 NM_001320 NM_001321 NM_001326 NM_001328 NM_001331 NM_001332 NM_001334 NM_001347 NM_001351 NM_001356 NM_001364 NM_001375 NM_001379 NM_001384 NM_001390 NM_001391 NM_001396 NM_001399 NM_001401 NM_001406 NM_001412 NM_001414 NM_001419 NM_001421 NM_001427 NM_001430 NM_001431 NM_001432 NM_001438 NM_001439 NM_001447 NM_001448 NM_001454 NM_001460 NM_001461 NM_001463 NM_001465 NM_001482 NM_001483 NM_001489 NM_001490 NM_001494 NM_001495 NM_001497 NM_001503 NM_001511 NM_001514 NM_001515 NM_001519 NM_001521 NM_001530 NM_001535 NM_001541 NM_001542 NM_001543 NM_001550 NM_001560 NM_001563 NM_001565 NM_001569 NM_001587 NM_001609 NM_001616 NM_001620 NM_001625 NM_001634 NM_001635 NM_001639 NM_001649 NM_001650 NM_001656 NM_001663 NM_001664 NM_001668 NM_001676 NM_001677 NM_001679 NM_001683 NM_001684 NM_001690 NM_001693 NM_001694 NM_001695 NM_001698 NM_001701 NM_001704 NM_001706 NM_001709 NM_001712 NM_001717 NM_001718 NM_001723 NM_001730 NM_001738 NM_001740 NM_001742 NM_001746 NM_001752 NM_001754 NM_001755 NM_001759 NM_001772 NM_001775 NM_001777 NM_001792 NM_001797 NM_001801 NM_001812 NM_001821 NM_001826 NM_001827 NM_001858 NM_001859 NM_001879 NM_001882 NM_001892 NM_001902 NM_001903 NM_001904 NM_001908 NM_001918 NM_001923 NM_001931 NM_001934 NM_001938 NM_001940 NM_001941 NM_001945 NM_001948 NM_001949 NM_001951 NM_001952 NM_001957 NM_001963 NM_001964 NM_001966 NM_001969 NM_001974 NM_001980 NM_001981 NM_001987 NM_001992 NM_001999 NM_002006 NM_002010 NM_002015 NM_002017 NM_002023 NM_002024 NM_002026 NM_002027 NM_002033 NM_002039 NM_002040 NM_002042 NM_002044 NM_002048 NM_002051 NM_002056 NM_002065 NM_002069 NM_002074 NM_002076 NM_002078 NM_002081 NM_002082 NM_002089 NM_002090 NM_002092 NM_002099 NM_002101 NM_002108 NM_002111 NM_002112 NM_002119 NM_002129 NM_002130 NM_002136 NM_002140 NM_002149 NM_002154 NM_002155 NM_002158 NM_002164 NM_002170 NM_002182 NM_002187 NM_002196 NM_002211 NM_002214 NM_002222 NM_002223 NM_002226 NM_002228 NM_002229 NM_002231 NM_002239 NM_002242 NM_002243 NM_002247 NM_002254 NM_002259 NM_002260 NM_002262 NM_002265 NM_002266 NM_002267 NM_002268 NM_002284 NM_002285 NM_002291 NM_002293 NM_002296 NM_002310 NM_002312 NM_002313 NM_002319 NM_002345 NM_002346 NM_002349 NM_002351 NM_002353 NM_002357 NM_002359 NM_002365 NM_002367 NM_002375 NM_002379 NM_002380 NM_002381 NM_002382 NM_002389 NM_002397 NM_002399 NM_002401 NM_002427 NM_002429 NM_002430 NM_002436 NM_002443 NM_002444 NM_002449 NM_002460 NM_002463 NM_002474 NM_002479 NM_002481 NM_002485 NM_002487 NM_002499 NM_002501 NM_002504 NM_002510 NM_002518 NM_002519 NM_002520 NM_002522 NM_002523 NM_002524 NM_002542 NM_002543 NM_002544 NM_002545 NM_002552 NM_002556 NM_002558 NM_002563 NM_002570 NM_002572 NM_002574 NM_002582 NM_002586 NM_002588 NM_002589 NM_002591 NM_002594 NM_002605 NM_002608 NM_002609 NM_002610 NM_002613 NM_002614 NM_002623 NM_002628 NM_002636 NM_002639 NM_002640 NM_002641 NM_002643 NM_002644 NM_002646 NM_002653 NM_002654 NM_002655 NM_002658 NM_002662 NM_002666 NM_002670 NM_002674 NM_002677 NM_002706 NM_002711 NM_002725 NM_002731 NM_002734 NM_002736 NM_002737 NM_002738 NM_002748 NM_002751 NM_002752 NM_002753 NM_002755 NM_002758 NM_002760 NM_002763 NM_002764 NM_002767 NM_002775 NM_002776 NM_002790 NM_002803 NM_002806 NM_002809 NM_002811 NM_002814 NM_002816 NM_002819 NM_002821 NM_002823 NM_002827 NM_002828 NM_002829 NM_002833 NM_002834 NM_002835 NM_002838 NM_002840 NM_002841 NM_002844 NM_002845 NM_002849 NM_002857 NM_002860 NM_002871 NM_002874 NM_002876 NM_002878 NM_002879 NM_002883 NM_002886 NM_002890 NM_002897 NM_002898 NM_002900 NM_002902 NM_002906 NM_002907 NM_002913 NM_002919 NM_002920 NM_002937 NM_002940 NM_002948 NM_002954 NM_002955 NM_002956 NM_002957 NM_002971 NM_002993 NM_002994 NM_002997 NM_002999 NM_003002 NM_003003 NM_003004 NM_003009 NM_003010 NM_003011 NM_003016 NM_003020 NM_003022 NM_003026 NM_003027 NM_003028 NM_003030 NM_003038 NM_003044 NM_003046 NM_003058 NM_003060 NM_003068 NM_003079 NM_003101 NM_003107 NM_003108 NM_003111 NM_003112 NM_003114 NM_003118 NM_003125 NM_003126 NM_003131 NM_003133 NM_003137 NM_003139 NM_003141 NM_003144 NM_003146 NM_003153 NM_003155 NM_003157 NM_003161 NM_003170 NM_003173 NM_003182 NM_003184 NM_003185 NM_003188 NM_003189 NM_003192 NM_003204 NM_003212 NM_003215 NM_003222 NM_003236 NM_003243 NM_003246 NM_003255 NM_003262 NM_003263 NM_003270 NM_003274 NM_003281 NM_003286 NM_003287 NM_003291 NM_003296 NM_003302 NM_003304 NM_003308 NM_003320 NM_003337 NM_003338 NM_003339 NM_003342 NM_003345 NM_003348 NM_003350 NM_003352 NM_003358 NM_003359 NM_003368 NM_003369 NM_003371 NM_003374 NM_003387 NM_003401 NM_003404 NM_003406 NM_003408 NM_003411 NM_003417 NM_003421 NM_003423 NM_003425 NM_003428 NM_003435 NM_003436 NM_003439 NM_003440 NM_003453 NM_003454 NM_003457 NM_003458 NM_003462 NM_003467 NM_003469 NM_003471 NM_003476 NM_003477 NM_003478 NM_003480 NM_003483 NM_003488 NM_003489 NM_003490 NM_003498 NM_003506 NM_003528 NM_003559 NM_003574 NM_003583 NM_003590 NM_003597 NM_003605 NM_003615 NM_003616 NM_003617 NM_003626 NM_003627 NM_003628 NM_003629 NM_003633 NM_003640 NM_003644 NM_003647 NM_003648 NM_003649 NM_003663 NM_003664 NM_003670 NM_003672 NM_003675 NM_003677 NM_003679 NM_003681 NM_003685 NM_003688 NM_003693 NM_003702 NM_003705 NM_003711 NM_003716 NM_003722 NM_003728 NM_003734 NM_003735 NM_003736 NM_003740 NM_003743 NM_003744 NM_003749 NM_003750 NM_003751 NM_003759 NM_003761 NM_003763 NM_003764 NM_003775 NM_003794 NM_003803 NM_003818 NM_003828 NM_003842 NM_003847 NM_003852 NM_003856 NM_003858 NM_003861 NM_003870 NM_003872 NM_003877 NM_003878 NM_003882 NM_003884 NM_003885 NM_003887 NM_003896 NM_003898 NM_003899 NM_003901 NM_003909 NM_003913 NM_003924 NM_003932 NM_003938 NM_003941 NM_003943 NM_003953 NM_003966 NM_003972 NM_003980 NM_003981 NM_003983 NM_003987 NM_003988 NM_003989 NM_003990 NM_003994 NM_004003 NM_004028 NM_004032 NM_004035 NM_004049 NM_004055 NM_004056 NM_004061 NM_004064 NM_004067 NM_004075 NM_004081 NM_004089 NM_004090 NM_004093 NM_004099 NM_004102 NM_004109 NM_004113 NM_004114 NM_004116 NM_004120 NM_004125 NM_004133 NM_004134 NM_004137 NM_004145 NM_004147 NM_004155 NM_004156 NM_004157 NM_004161 NM_004169 NM_004171 NM_004177 NM_004180 NM_004181 NM_004184 NM_004199 NM_004200 NM_004208 NM_004215 NM_004217 NM_004223 NM_004233 NM_004239 NM_004241 NM_004262 NM_004263 NM_004265 NM_004268 NM_004270 NM_004272 NM_004273 NM_004274 NM_004275 NM_004281 NM_004287 NM_004291 NM_004293 NM_004294 NM_004296 NM_004300 NM_004302 NM_004310 NM_004315 NM_004319 NM_004321 NM_004326 NM_004337 NM_004338 NM_004339 NM_004342 NM_004346 NM_004348 NM_004349 NM_004356 NM_004362 NM_004363 NM_004364 NM_004365 NM_004370 NM_004375 NM_004376 NM_004379 NM_004384 NM_004386 NM_004389 NM_004392 NM_004393 NM_004402 NM_004403 NM_004404 NM_004407 NM_004412 NM_004414 NM_004417 NM_004423 NM_004426 NM_004427 NM_004428 NM_004430 NM_004434 NM_004437 NM_004438 NM_004441 NM_004448 NM_004449 NM_004457 NM_004458 NM_004459 NM_004464 NM_004473 NM_004474 NM_004481 NM_004482 NM_004495 NM_004496 NM_004498 NM_004500 NM_004501 NM_004504 NM_004505 NM_004508 NM_004512 NM_004513 NM_004514 NM_004516 NM_004518 NM_004521 NM_004529 NM_004530 NM_004535 NM_004536 NM_004537 NM_004538 NM_004539 NM_004540 NM_004548 NM_004549 NM_004550 NM_004557 NM_004562 NM_004564 NM_004567 NM_004578 NM_004583 NM_004586 NM_004593 NM_004598 NM_004600 NM_004602 NM_004612 NM_004617 NM_004619 NM_004626 NM_004628 NM_004631 NM_004637 NM_004641 NM_004642 NM_004645 NM_004650 NM_004657 NM_004660 NM_004663 NM_004665 NM_004668 NM_004670 NM_004673 NM_004680 NM_004684 NM_004685 NM_004686 NM_004691 NM_004694 NM_004703 NM_004705 NM_004709 NM_004710 NM_004717 NM_004719 NM_004725 NM_004727 NM_004728 NM_004730 NM_004731 NM_004735 NM_004736 NM_004738 NM_004740 NM_004744 NM_004745 NM_004755 NM_004759 NM_004760 NM_004764 NM_004772 NM_004776 NM_004778 NM_004781 NM_004782 NM_004788 NM_004791 NM_004796 NM_004797 NM_004798 NM_004801 NM_004805 NM_004814 NM_004815 NM_004818 NM_004823 NM_004824 NM_004834 NM_004840 NM_004844 NM_004845 NM_004847 NM_004855 NM_004856 NM_004859 NM_004860 NM_004863 NM_004865 NM_004866 NM_004867 NM_004873 NM_004878 NM_004882 NM_004886 NM_004896 NM_004898 NM_004902 NM_004904 NM_004912 NM_004914 NM_004921 NM_004924 NM_004925 NM_004926 NM_004933 NM_004937 NM_004938 NM_004947 NM_004949 NM_004951 NM_004955 NM_004956 NM_004961 NM_004962 NM_004972 NM_004985 NM_004992 NM_004993 NM_004998 NM_005000 NM_005003 NM_005006 NM_005010 NM_005011 NM_005023 NM_005032 NM_005036 NM_005044 NM_005045 NM_005046 NM_005047 NM_005048 NM_005049 NM_005054 NM_005063 NM_005065 NM_005075 NM_005079 NM_005087 NM_005095 NM_005099 NM_005100 NM_005105 NM_005109 NM_005113 NM_005116 NM_005117 NM_005121 NM_005124 NM_005126 NM_005133 NM_005134 NM_005137 NM_005141 NM_005154 NM_005155 NM_005160 NM_005168 NM_005180 NM_005181 NM_005188 NM_005189 NM_005191 NM_005197 NM_005198 NM_005201 NM_005202 NM_005204 NM_005206 NM_005214 NM_005219 NM_005220 NM_005225 NM_005226 NM_005233 NM_005238 NM_005239 NM_005242 NM_005248 NM_005249 NM_005254 NM_005257 NM_005259 NM_005261 NM_005276 NM_005277 NM_005282 NM_005300 NM_005311 NM_005312 NM_005314 NM_005316 NM_005324 NM_005328 NM_005329 NM_005340 NM_005342 NM_005346 NM_005348 NM_005356 NM_005358 NM_005359 NM_005361 NM_005364 NM_005365 NM_005366 NM_005369 NM_005374 NM_005375 NM_005382 NM_005392 NM_005399 NM_005400 NM_005402 NM_005414 NM_005417 NM_005433 NM_005436 NM_005461 NM_005465 NM_005466 NM_005467 NM_005472 NM_005475 NM_005477 NM_005482 NM_005494 NM_005495 NM_005497 NM_005502 NM_005504 NM_005509 NM_005513 NM_005520 NM_005523 NM_005530 NM_005533 NM_005536 NM_005537 NM_005539 NM_005551 NM_005559 NM_005573 NM_005578 NM_005585 NM_005587 NM_005589 NM_005590 NM_005591 NM_005602 NM_005604 NM_005610 NM_005613 NM_005625 NM_005626 NM_005627 NM_005637 NM_005638 NM_005639 NM_005642 NM_005647 NM_005648 NM_005649 NM_005651 NM_005653 NM_005658 NM_005659 NM_005665 NM_005667 NM_005668 NM_005669 NM_005670 NM_005671 NM_005672 NM_005682 NM_005686 NM_005699 NM_005705 NM_005724 NM_005725 NM_005732 NM_005737 NM_005738 NM_005742 NM_005746 NM_005748 NM_005751 NM_005754 NM_005756 NM_005759 NM_005768 NM_005779 NM_005785 NM_005786 NM_005789 NM_005795 NM_005797 NM_005802 NM_005804 NM_005813 NM_005815 NM_005816 NM_005822 NM_005826 NM_005828 NM_005829 NM_005837 NM_005839 NM_005840 NM_005843 NM_005848 NM_005858 NM_005859 NM_005860 NM_005862 NM_005863 NM_005865 NM_005866 NM_005870 NM_005871 NM_005872 NM_005877 NM_005879 NM_005884 NM_005898 NM_005900 NM_005901 NM_005902 NM_005903 NM_005904 NM_005906 NM_005907 NM_005914 NM_005915 NM_005920 NM_005922 NM_005924 NM_005935 NM_005943 NM_005955 NM_005962 NM_005965 NM_005969 NM_005986 NM_005989 NM_006007 NM_006009 NM_006011 NM_006015 NM_006020 NM_006022 NM_006024 NM_006033 NM_006037 NM_006040 NM_006041 NM_006045 NM_006047 NM_006052 NM_006055 NM_006067 NM_006073 NM_006089 NM_006094 NM_006106 NM_006113 NM_006122 NM_006125 NM_006133 NM_006134 NM_006135 NM_006138 NM_006139 NM_006141 NM_006148 NM_006153 NM_006154 NM_006155 NM_006156 NM_006162 NM_006164 NM_006166 NM_006167 NM_006177 NM_006184 NM_006186 NM_006187 NM_006193 NM_006195 NM_006201 NM_006203 NM_006206 NM_006209 NM_006212 NM_006235 NM_006237 NM_006239 NM_006241 NM_006243 NM_006251 NM_006273 NM_006276 NM_006282 NM_006283 NM_006286 NM_006290 NM_006291 NM_006298 NM_006306 NM_006315 NM_006328 NM_006330 NM_006333 NM_006334 NM_006335 NM_006336 NM_006347 NM_006353 NM_006357 NM_006358 NM_006359 NM_006363 NM_006366 NM_006372 NM_006373 NM_006375 NM_006379 NM_006380 NM_006387 NM_006389 NM_006390 NM_006393 NM_006403 NM_006404 NM_006405 NM_006407 NM_006415 NM_006416 NM_006418 NM_006449 NM_006451 NM_006457 NM_006459 NM_006460 NM_006469 NM_006475 NM_006480 NM_006482 NM_006486 NM_006493 NM_006499 NM_006500 NM_006504 NM_006510 NM_006517 NM_006520 NM_006526 NM_006527 NM_006529 NM_006531 NM_006534 NM_006538 NM_006540 NM_006544 NM_006547 NM_006548 NM_006554 NM_006559 NM_006561 NM_006562 NM_006568 NM_006572 NM_006575 NM_006583 NM_006587 NM_006590 NM_006591 NM_006595 NM_006599 NM_006601 NM_006602 NM_006603 NM_006606 NM_006614 NM_006620 NM_006626 NM_006628 NM_006631 NM_006636 NM_006640 NM_006650 NM_006656 NM_006658 NM_006661 NM_006665 NM_006667 NM_006674 NM_006684 NM_006700 NM_006701 NM_006710 NM_006713 NM_006716 NM_006717 NM_006720 NM_006722 NM_006724 NM_006726 NM_006729 NM_006730 NM_006734 NM_006736 NM_006741 NM_006746 NM_006748 NM_006751 NM_006754 NM_006763 NM_006766 NM_006767 NM_006769 NM_006771 NM_006772 NM_006773 NM_006774 NM_006775 NM_006778 NM_006779 NM_006784 NM_006785 NM_006790 NM_006811 NM_006815 NM_006821 NM_006822 NM_006823 NM_006826 NM_006827 NM_006832 NM_006845 NM_006847 NM_006856 NM_006857 NM_006866 NM_006867 NM_006868 NM_006872 NM_006873 NM_006884 NM_006888 NM_006890 NM_006894 NM_006895 NM_006901 NM_006902 NM_006904 NM_006908 NM_006909 NM_006911 NM_006914 NM_006922 NM_006923 NM_006930 NM_006931 NM_006936 NM_006938 NM_006940 NM_006947 NM_006948 NM_006951 NM_006955 NM_006959 NM_006961 NM_006969 NM_006974 NM_006981 NM_006984 NM_006987 NM_006989 NM_006995 NM_006996 NM_006997 NM_007006 NM_007008 NM_007011 NM_007014 NM_007017 NM_007022 NM_007023 NM_007027 NM_007029 NM_007035 NM_007036 NM_007038 NM_007042 NM_007047 NM_007050 NM_007054 NM_007057 NM_007067 NM_007068 NM_007073 NM_007078 NM_007084 NM_007087 NM_007088 NM_007099 NM_007107 NM_007110 NM_007125 NM_007129 NM_007136 NM_007137 NM_007144 NM_007145 NM_007146 NM_007147 NM_007148 NM_007149 NM_007163 NM_007166 NM_007168 NM_007170 NM_007173 NM_007174 NM_007182 NM_007183 NM_007187 NM_007190 NM_007191 NM_007203 NM_007212 NM_007214 NM_007219 NM_007222 NM_007223 NM_007236 NM_007238 NM_007242 NM_007246 NM_007249 NM_007257 NM_007259 NM_007269 NM_007282 NM_007292 NM_007318 NM_007327 NM_007328 NM_007331 NM_007332 NM_007334 NM_007335 NM_007336 NM_007338 NM_007345 NM_007347 NM_007350 NM_007351 NM_007353 NM_007356 NM_007357 NM_007370 NM_007371 NM_007372 NM_007373 NM_007375 NM_009590 NM_012062 NM_012064 NM_012072 NM_012080 NM_012081 NM_012082 NM_012083 NM_012089 NM_012096 NM_012098 NM_012106 NM_012115 NM_012120 NM_012124 NM_012125 NM_012129 NM_012134 NM_012137 NM_012153 NM_012154 NM_012156 NM_012157 NM_012158 NM_012171 NM_012177 NM_012193 NM_012197 NM_012198 NM_012199 NM_012206 NM_012208 NM_012213 NM_012215 NM_012218 NM_012223 NM_012229 NM_012231 NM_012238 NM_012241 NM_012249 NM_012252 NM_012255 NM_012259 NM_012262 NM_012264 NM_012269 NM_012275 NM_012279 NM_012286 NM_012287 NM_012288 NM_012290 NM_012297 NM_012300 NM_012301 NM_012304 NM_012307 NM_012309 NM_012319 NM_012325 NM_012328 NM_012329 NM_012333 NM_012338 NM_012345 NM_012346 NM_012347 NM_012384 NM_012388 NM_012395 NM_012399 NM_012405 NM_012409 NM_012412 NM_012416 NM_012417 NM_012420 NM_012424 NM_012425 NM_012428 NM_012437 NM_012446 NM_012455 NM_012456 NM_012460 NM_012463 NM_012464 NM_012465 NM_012468 NM_012471 NM_012479 NM_012484 NM_012485 NM_013229 NM_013230 NM_013231 NM_013233 NM_013236 NM_013240 NM_013241 NM_013243 NM_013246 NM_013252 NM_013255 NM_013256 NM_013257 NM_013260 NM_013261 NM_013262 NM_013281 NM_013283 NM_013286 NM_013300 NM_013302 NM_013309 NM_013310 NM_013323 NM_013332 NM_013334 NM_013336 NM_013341 NM_013348 NM_013372 NM_013374 NM_013375 NM_013381 NM_013382 NM_013396 NM_013403 NM_013410 NM_013422 NM_013438 NM_013440 NM_013447 NM_013449 NM_013451 NM_013937 NM_013943 NM_013956 NM_013964 NM_013987 NM_013988 NM_013989 NM_013995 NM_013996 NM_013997 NM_013998 NM_014003 NM_014011 NM_014015 NM_014016 NM_014021 NM_014023 NM_014035 NM_014038 NM_014046 NM_014048 NM_014050 NM_014053 NM_014056 NM_014079 NM_014089 NM_014106 NM_014112 NM_014138 NM_014141 NM_014143 NM_014147 NM_014153 NM_014154 NM_014157 NM_014160 NM_014166 NM_014171 NM_014177 NM_014178 NM_014211 NM_014217 NM_014220 NM_014228 NM_014229 NM_014231 NM_014232 NM_014234 NM_014243 NM_014246 NM_014252 NM_014257 NM_014276 NM_014293 NM_014296 NM_014301 NM_014302 NM_014308 NM_014309 NM_014314 NM_014319 NM_014324 NM_014325 NM_014332 NM_014335 NM_014338 NM_014344 NM_014351 NM_014361 NM_014362 NM_014363 NM_014372 NM_014381 NM_014382 NM_014388 NM_014391 NM_014393 NM_014399 NM_014412 NM_014415 NM_014417 NM_014418 NM_014426 NM_014442 NM_014451 NM_014452 NM_014456 NM_014463 NM_014469 NM_014476 NM_014483 NM_014487 NM_014489 NM_014504 NM_014505 NM_014517 NM_014518 NM_014552 NM_014553 NM_014554 NM_014556 NM_014570 NM_014574 NM_014577 NM_014585 NM_014586 NM_014590 NM_014600 NM_014606 NM_014607 NM_014610 NM_014612 NM_014613 NM_014615 NM_014625 NM_014631 NM_014634 NM_014646 NM_014647 NM_014648 NM_014653 NM_014656 NM_014659 NM_014663 NM_014670 NM_014671 NM_014672 NM_014676 NM_014679 NM_014682 NM_014683 NM_014686 NM_014689 NM_014690 NM_014691 NM_014701 NM_014704 NM_014706 NM_014707 NM_014711 NM_014717 NM_014720 NM_014723 NM_014724 NM_014728 NM_014730 NM_014732 NM_014733 NM_014735 NM_014737 NM_014738 NM_014739 NM_014742 NM_014743 NM_014746 NM_014752 NM_014755 NM_014756 NM_014757 NM_014762 NM_014764 NM_014765 NM_014766 NM_014767 NM_014772 NM_014774 NM_014776 NM_014777 NM_014782 NM_014784 NM_014787 NM_014789 NM_014791 NM_014792 NM_014795 NM_014797 NM_014801 NM_014803 NM_014804 NM_014809 NM_014812 NM_014815 NM_014819 NM_014820 NM_014821 NM_014822 NM_014827 NM_014829 NM_014830 NM_014837 NM_014841 NM_014847 NM_014849 NM_014853 NM_014854 NM_014858 NM_014860 NM_014867 NM_014872 NM_014874 NM_014875 NM_014876 NM_014880 NM_014883 NM_014888 NM_014890 NM_014891 NM_014893 NM_014895 NM_014897 NM_014899 NM_014900 NM_014901 NM_014902 NM_014904 NM_014906 NM_014910 NM_014913 NM_014918 NM_014919 NM_014920 NM_014923 NM_014924 NM_014926 NM_014930 NM_014934 NM_014935 NM_014937 NM_014947 NM_014951 NM_014953 NM_014955 NM_014956 NM_014959 NM_014964 NM_014965 NM_014969 NM_014970 NM_014985 NM_014991 NM_014992 NM_014994 NM_014996 NM_014999 NM_015001 NM_015002 NM_015003 NM_015005 NM_015008 NM_015018 NM_015020 NM_015022 NM_015025 NM_015026 NM_015035 NM_015040 NM_015044 NM_015045 NM_015047 NM_015049 NM_015052 NM_015053 NM_015055 NM_015056 NM_015061 NM_015066 NM_015070 NM_015074 NM_015075 NM_015076 NM_015077 NM_015082 NM_015086 NM_015087 NM_015088 NM_015090 NM_015091 NM_015092 NM_015094 NM_015100 NM_015115 NM_015116 NM_015120 NM_015133 NM_015137 NM_015138 NM_015140 NM_015141 NM_015149 NM_015150 NM_015155 NM_015158 NM_015163 NM_015172 NM_015180 NM_015184 NM_015186 NM_015187 NM_015191 NM_015192 NM_015194 NM_015198 NM_015199 NM_015200 NM_015205 NM_015206 NM_015208 NM_015214 NM_015216 NM_015224 NM_015225 NM_015229 NM_015230 NM_015234 NM_015236 NM_015245 NM_015250 NM_015253 NM_015254 NM_015257 NM_015261 NM_015263 NM_015264 NM_015266 NM_015271 NM_015275 NM_015277 NM_015278 NM_015282 NM_015285 NM_015288 NM_015299 NM_015305 NM_015308 NM_015310 NM_015313 NM_015316 NM_015317 NM_015323 NM_015326 NM_015328 NM_015329 NM_015335 NM_015336 NM_015338 NM_015344 NM_015347 NM_015349 NM_015353 NM_015358 NM_015359 NM_015375 NM_015378 NM_015382 NM_015385 NM_015387 NM_015394 NM_015396 NM_015401 NM_015419 NM_015423 NM_015429 NM_015435 NM_015436 NM_015438 NM_015441 NM_015443 NM_015446 NM_015447 NM_015450 NM_015455 NM_015458 NM_015460 NM_015461 NM_015463 NM_015469 NM_015472 NM_015476 NM_015483 NM_015496 NM_015507 NM_015509 NM_015525 NM_015526 NM_015532 NM_015534 NM_015542 NM_015545 NM_015550 NM_015553 NM_015555 NM_015557 NM_015560 NM_015564 NM_015565 NM_015567 NM_015569 NM_015570 NM_015575 NM_015576 NM_015577 NM_015578 NM_015595 NM_015607 NM_015621 NM_015626 NM_015635 NM_015640 NM_015646 NM_015657 NM_015678 NM_015679 NM_015684 NM_015690 NM_015695 NM_015702 NM_015715 NM_015725 NM_015726 NM_015833 NM_015834 NM_015866 NM_015878 NM_015885 NM_015886 NM_015891 NM_015892 NM_015899 NM_015905 NM_015907 NM_015909 NM_015915 NM_015929 NM_015935 NM_015937 NM_015942 NM_015976 NM_015986 NM_015995 NM_016002 NM_016004 NM_016010 NM_016018 NM_016021 NM_016023 NM_016038 NM_016040 NM_016042 NM_016059 NM_016067 NM_016070 NM_016072 NM_016073 NM_016075 NM_016076 NM_016079 NM_016083 NM_016090 NM_016096 NM_016100 NM_016101 NM_016107 NM_016114 NM_016120 NM_016122 NM_016123 NM_016124 NM_016127 NM_016132 NM_016133 NM_016138 NM_016142 NM_016152 NM_016156 NM_016167 NM_016173 NM_016192 NM_016195 NM_016201 NM_016203 NM_016204 NM_016206 NM_016210 NM_016216 NM_016217 NM_016225 NM_016231 NM_016233 NM_016243 NM_016248 NM_016252 NM_016255 NM_016257 NM_016264 NM_016271 NM_016272 NM_016275 NM_016277 NM_016282 NM_016284 NM_016289 NM_016301 NM_016302 NM_016304 NM_016308 NM_016316 NM_016324 NM_016325 NM_016338 NM_016343 NM_016353 NM_016357 NM_016358 NM_016374 NM_016388 NM_016389 NM_016396 NM_016399 NM_016400 NM_016424 NM_016426 NM_016436 NM_016441 NM_016447 NM_016452 NM_016467 NM_016472 NM_016475 NM_016480 NM_016485 NM_016486 NM_016500 NM_016508 NM_016509 NM_016513 NM_016519 NM_016522 NM_016530 NM_016532 NM_016534 NM_016536 NM_016540 NM_016542 NM_016544 NM_016545 NM_016553 NM_016559 NM_016563 NM_016571 NM_016575 NM_016585 NM_016586 NM_016591 NM_016593 NM_016596 NM_016599 NM_016607 NM_016613 NM_016617 NM_016620 NM_016623 NM_016644 NM_016653 NM_016654 NM_016734 NM_016815 NM_016819 NM_016820 NM_016821 NM_016823 NM_016824 NM_016826 NM_016827 NM_016828 NM_016829 NM_016831 NM_016836 NM_016839 NM_016848 NM_016946 NM_017409 NM_017411 NM_017415 NM_017417 NM_017420 NM_017423 NM_017424 NM_017426 NM_017434 NM_017436 NM_017438 NM_017443 NM_017450 NM_017452 NM_017453 NM_017454 NM_017455 NM_017506 NM_017515 NM_017519 NM_017522 NM_017526 NM_017544 NM_017545 NM_017548 NM_017549 NM_017551 NM_017553 NM_017577 NM_017582 NM_017583 NM_017586 NM_017593 NM_017595 NM_017599 NM_017610 NM_017615 NM_017617 NM_017622 NM_017628 NM_017629 NM_017631 NM_017637 NM_017640 NM_017641 NM_017644 NM_017645 NM_017651 NM_017655 NM_017656 NM_017657 NM_017661 NM_017662 NM_017665 NM_017666 NM_017667 NM_017671 NM_017672 NM_017679 NM_017681 NM_017686 NM_017691 NM_017694 NM_017697 NM_017703 NM_017705 NM_017709 NM_017714 NM_017719 NM_017731 NM_017737 NM_017738 NM_017742 NM_017745 NM_017747 NM_017752 NM_017753 NM_017761 NM_017762 NM_017769 NM_017770 NM_017772 NM_017773 NM_017776 NM_017778 NM_017779 NM_017780 NM_017787 NM_017789 NM_017791 NM_017801 NM_017810 NM_017813 NM_017818 NM_017824 NM_017829 NM_017831 NM_017851 NM_017855 NM_017860 NM_017866 NM_017888 NM_017896 NM_017898 NM_017902 NM_017911 NM_017915 NM_017919 NM_017923 NM_017924 NM_017926 NM_017927 NM_017928 NM_017929 NM_017933 NM_017936 NM_017945 NM_017946 NM_017953 NM_017958 NM_017966 NM_017968 NM_017972 NM_017975 NM_017987 NM_017988 NM_017990 NM_017991 NM_017998 NM_017999 NM_018003 NM_018004 NM_018010 NM_018011 NM_018017 NM_018018 NM_018027 NM_018028 NM_018036 NM_018040 NM_018046 NM_018048 NM_018052 NM_018054 NM_018055 NM_018057 NM_018058 NM_018069 NM_018071 NM_018073 NM_018077 NM_018079 NM_018084 NM_018086 NM_018092 NM_018098 NM_018106 NM_018108 NM_018112 NM_018120 NM_018121 NM_018126 NM_018129 NM_018133 NM_018137 NM_018138 NM_018139 NM_018140 NM_018150 NM_018152 NM_018156 NM_018157 NM_018158 NM_018170 NM_018177 NM_018181 NM_018182 NM_018189 NM_018191 NM_018192 NM_018194 NM_018195 NM_018201 NM_018204 NM_018205 NM_018206 NM_018211 NM_018212 NM_018214 NM_018215 NM_018221 NM_018222 NM_018224 NM_018227 NM_018228 NM_018234 NM_018235 NM_018239 NM_018243 NM_018245 NM_018246 NM_018247 NM_018252 NM_018257 NM_018263 NM_018266 NM_018267 NM_018268 NM_018270 NM_018271 NM_018279 NM_018290 NM_018295 NM_018298 NM_018303 NM_018307 NM_018310 NM_018319 NM_018326 NM_018338 NM_018339 NM_018340 NM_018346 NM_018347 NM_018348 NM_018356 NM_018361 NM_018362 NM_018363 NM_018364 NM_018365 NM_018367 NM_018374 NM_018375 NM_018383 NM_018385 NM_018389 NM_018393 NM_018399 NM_018400 NM_018401 NM_018404 NM_018407 NM_018416 NM_018419 NM_018420 NM_018424 NM_018425 NM_018427 NM_018431 NM_018433 NM_018437 NM_018439 NM_018440 NM_018442 NM_018443 NM_018448 NM_018449 NM_018450 NM_018451 NM_018452 NM_018469 NM_018471 NM_018482 NM_018488 NM_018490 NM_018498 NM_018509 NM_018518 NM_018534 NM_018538 NM_018555 NM_018557 NM_018561 NM_018566 NM_018579 NM_018590 NM_018602 NM_018638 NM_018639 NM_018640 NM_018647 NM_018650 NM_018652 NM_018656 NM_018658 NM_018660 NM_018672 NM_018676 NM_018677 NM_018682 NM_018683 NM_018684 NM_018685 NM_018686 NM_018689 NM_018695 NM_018697 NM_018698 NM_018706 NM_018708 NM_018712 NM_018715 NM_018717 NM_018718 NM_018719 NM_018837 NM_018840 NM_018841 NM_018847 NM_018890 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018933 NM_018936 NM_018940 NM_018945 NM_018947 NM_018962 NM_018963 NM_018964 NM_018970 NM_018976 NM_018984 NM_018992 NM_018993 NM_018999 NM_019001 NM_019005 NM_019006 NM_019008 NM_019014 NM_019018 NM_019021 NM_019022 NM_019026 NM_019027 NM_019035 NM_019044 NM_019045 NM_019049 NM_019053 NM_019061 NM_019063 NM_019067 NM_019069 NM_019074 NM_019081 NM_019084 NM_019094 NM_019098 NM_019099 NM_019106 NM_019114 NM_019117 NM_019119 NM_019556 NM_019557 NM_019590 NM_019593 NM_019597 NM_019842 NM_019857 NM_019859 NM_019860 NM_019887 NM_019903 NM_020038 NM_020066 NM_020119 NM_020127 NM_020133 NM_020139 NM_020144 NM_020148 NM_020149 NM_020150 NM_020151 NM_020154 NM_020157 NM_020162 NM_020163 NM_020166 NM_020167 NM_020169 NM_020177 NM_020182 NM_020187 NM_020189 NM_020190 NM_020193 NM_020194 NM_020198 NM_020200 NM_020204 NM_020208 NM_020215 NM_020228 NM_020232 NM_020239 NM_020243 NM_020245 NM_020247 NM_020299 NM_020307 NM_020310 NM_020335 NM_020337 NM_020338 NM_020341 NM_020342 NM_020345 NM_020348 NM_020357 NM_020360 NM_020363 NM_020364 NM_020375 NM_020381 NM_020382 NM_020399 NM_020405 NM_020408 NM_020420 NM_020429 NM_020431 NM_020443 NM_020444 NM_020445 NM_020452 NM_020453 NM_020456 NM_020465 NM_020472 NM_020473 NM_020474 NM_020524 NM_020531 NM_020532 NM_020552 NM_020553 NM_020631 NM_020638 NM_020639 NM_020640 NM_020642 NM_020647 NM_020652 NM_020654 NM_020661 NM_020666 NM_020673 NM_020676 NM_020685 NM_020686 NM_020689 NM_020695 NM_020698 NM_020699 NM_020704 NM_020710 NM_020713 NM_020714 NM_020727 NM_020728 NM_020732 NM_020738 NM_020739 NM_020742 NM_020749 NM_020754 NM_020755 NM_020760 NM_020761 NM_020766 NM_020768 NM_020769 NM_020771 NM_020772 NM_020773 NM_020774 NM_020778 NM_020779 NM_020781 NM_020782 NM_020783 NM_020786 NM_020789 NM_020791 NM_020792 NM_020796 NM_020800 NM_020801 NM_020802 NM_020804 NM_020805 NM_020807 NM_020809 NM_020810 NM_020817 NM_020825 NM_020826 NM_020828 NM_020839 NM_020841 NM_020844 NM_020851 NM_020853 NM_020856 NM_020858 NM_020860 NM_020867 NM_020868 NM_020870 NM_020871 NM_020897 NM_020901 NM_020909 NM_020914 NM_020917 NM_020918 NM_020921 NM_020925 NM_020927 NM_020932 NM_020933 NM_020935 NM_020940 NM_020951 NM_020954 NM_020960 NM_020962 NM_020971 NM_020975 NM_020980 NM_020987 NM_021003 NM_021021 NM_021023 NM_021032 NM_021033 NM_021035 NM_021036 NM_021038 NM_021045 NM_021049 NM_021082 NM_021083 NM_021103 NM_021105 NM_021110 NM_021111 NM_021116 NM_021132 NM_021135 NM_021136 NM_021140 NM_021141 NM_021148 NM_021151 NM_021153 NM_021154 NM_021158 NM_021159 NM_021164 NM_021165 NM_021183 NM_021202 NM_021203 NM_021204 NM_021205 NM_021215 NM_021217 NM_021226 NM_021227 NM_021229 NM_021237 NM_021238 NM_021239 NM_021240 NM_021242 NM_021255 NM_021569 NM_021616 NM_021622 NM_021624 NM_021629 NM_021632 NM_021638 NM_021643 NM_021649 NM_021728 NM_021735 NM_021736 NM_021737 NM_021785 NM_021804 NM_021807 NM_021813 NM_021814 NM_021815 NM_021818 NM_021820 NM_021826 NM_021905 NM_021912 NM_021914 NM_021915 NM_021916 NM_021923 NM_021925 NM_021931 NM_021932 NM_021940 NM_021942 NM_021945 NM_021948 NM_021949 NM_021950 NM_021958 NM_021960 NM_021961 NM_021966 NM_021970 NM_021971 NM_021980 NM_021984 NM_021987 NM_021990 NM_021992 NM_021999 NM_022006 NM_022037 NM_022041 NM_022058 NM_022062 NM_022063 NM_022066 NM_022080 NM_022085 NM_022096 NM_022098 NM_022100 NM_022106 NM_022113 NM_022116 NM_022118 NM_022131 NM_022133 NM_022138 NM_022152 NM_022154 NM_022162 NM_022173 NM_022333 NM_022336 NM_022337 NM_022341 NM_022343 NM_022344 NM_022351 NM_022368 NM_022371 NM_022375 NM_022405 NM_022406 NM_022455 NM_022458 NM_022459 NM_022468 NM_022471 NM_022473 NM_022474 NM_022475 NM_022476 NM_022482 NM_022484 NM_022490 NM_022492 NM_022549 NM_022550 NM_022566 NM_022568 NM_022573 NM_022650 NM_022716 NM_022726 NM_022731 NM_022733 NM_022735 NM_022742 NM_022753 NM_022754 NM_022758 NM_022763 NM_022771 NM_022772 NM_022776 NM_022780 NM_022781 NM_022791 NM_022792 NM_022818 NM_022819 NM_022826 NM_022828 NM_022829 NM_022832 NM_022837 NM_022840 NM_022844 NM_022845 NM_022874 NM_022875 NM_022876 NM_022877 NM_022893 NM_022894 NM_022898 NM_022899 NM_022900 NM_022901 NM_022903 NM_022910 NM_022912 NM_022917 NM_022918 NM_022969 NM_022970 NM_022972 NM_022975 NM_022977 NM_023003 NM_023008 NM_023028 NM_023029 NM_023030 NM_023031 NM_023037 NM_023112 NM_023914 NM_023927 NM_023930 NM_023934 NM_023938 NM_024026 NM_024033 NM_024046 NM_024047 NM_024051 NM_024052 NM_024065 NM_024072 NM_024080 NM_024086 NM_024090 NM_024092 NM_024095 NM_024098 NM_024102 NM_024107 NM_024116 NM_024165 NM_024294 NM_024295 NM_024301 NM_024309 NM_024312 NM_024315 NM_024325 NM_024331 NM_024332 NM_024342 NM_024344 NM_024345 NM_024408 NM_024420 NM_024422 NM_024423 NM_024424 NM_024425 NM_024426 NM_024430 NM_024490 NM_024503 NM_024507 NM_024511 NM_024512 NM_024513 NM_024517 NM_024529 NM_024541 NM_024545 NM_024546 NM_024548 NM_024551 NM_024563 NM_024567 NM_024569 NM_024590 NM_024594 NM_024595 NM_024607 NM_024611 NM_024612 NM_024613 NM_024617 NM_024619 NM_024620 NM_024627 NM_024628 NM_024633 NM_024638 NM_024639 NM_024644 NM_024646 NM_024647 NM_024652 NM_024656 NM_024657 NM_024664 NM_024665 NM_024666 NM_024670 NM_024674 NM_024676 NM_024683 NM_024689 NM_024692 NM_024698 NM_024700 NM_024701 NM_024702 NM_024704 NM_024711 NM_024713 NM_024721 NM_024730 NM_024733 NM_024738 NM_024742 NM_024743 NM_024744 NM_024745 NM_024746 NM_024747 NM_024749 NM_024753 NM_024754 NM_024755 NM_024761 NM_024772 NM_024774 NM_024783 NM_024784 NM_024785 NM_024787 NM_024791 NM_024794 NM_024798 NM_024803 NM_024807 NM_024808 NM_024809 NM_024810 NM_024812 NM_024813 NM_024828 NM_024834 NM_024841 NM_024844 NM_024854 NM_024857 NM_024859 NM_024861 NM_024864 NM_024873 NM_024874 NM_024877 NM_024896 NM_024900 NM_024910 NM_024911 NM_024913 NM_024915 NM_024924 NM_024926 NM_024930 NM_024933 NM_024935 NM_024938 NM_024939 NM_024942 NM_024953 NM_024974 NM_024996 NM_025009 NM_025019 NM_025023 NM_025054 NM_025057 NM_025059 NM_025073 NM_025074 NM_025090 NM_025106 NM_025113 NM_025115 NM_025133 NM_025134 NM_025138 NM_025139 NM_025151 NM_025152 NM_025154 NM_025160 NM_025164 NM_025168 NM_025176 NM_025182 NM_025191 NM_025208 NM_025213 NM_025214 NM_025217 NM_025218 NM_025219 NM_025221 NM_025235 NM_025250 NM_030571 NM_030578 NM_030583 NM_030626 NM_030627 NM_030634 NM_030637 NM_030643 NM_030650 NM_030660 NM_030661 NM_030751 NM_030759 NM_030780 NM_030781 NM_030782 NM_030783 NM_030784 NM_030786 NM_030791 NM_030806 NM_030810 NM_030811 NM_030817 NM_030820 NM_030884 NM_030912 NM_030915 NM_030916 NM_030918 NM_030919 NM_030920 NM_030934 NM_030937 NM_030940 NM_030945 NM_030949 NM_030950 NM_030958 NM_030963 NM_030964 NM_030965 NM_030971 NM_030981 NM_031157 NM_031211 NM_031226 NM_031262 NM_031263 NM_031268 NM_031275 NM_031281 NM_031282 NM_031314 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031371 NM_031411 NM_031418 NM_031422 NM_031427 NM_031435 NM_031438 NM_031439 NM_031442 NM_031444 NM_031445 NM_031446 NM_031451 NM_031458 NM_031461 NM_031465 NM_031469 NM_031482 NM_031488 NM_031490 NM_031844 NM_031849 NM_031857 NM_031860 NM_031862 NM_031886 NM_031890 NM_031897 NM_031911 NM_031912 NM_031913 NM_031939 NM_031940 NM_031942 NM_031946 NM_031952 NM_031954 NM_031988 NM_031990 NM_031991 NM_031994 NM_032012 NM_032016 NM_032020 NM_032021 NM_032026 NM_032027 NM_032029 NM_032041 NM_032047 NM_032048 NM_032088 NM_032091 NM_032092 NM_032102 NM_032105 NM_032116 NM_032119 NM_032121 NM_032122 NM_032128 NM_032139 NM_032142 NM_032149 NM_032151 NM_032154 NM_032160 NM_032165 NM_032168 NM_032181 NM_032186 NM_032189 NM_032195 NM_032208 NM_032228 NM_032237 NM_032239 NM_032257 NM_032268 NM_032271 NM_032283 NM_032284 NM_032285 NM_032287 NM_032289 NM_032291 NM_032294 NM_032296 NM_032300 NM_032305 NM_032316 NM_032317 NM_032320 NM_032324 NM_032325 NM_032329 NM_032342 NM_032352 NM_032358 NM_032359 NM_032364 NM_032373 NM_032379 NM_032382 NM_032383 NM_032403 NM_032410 NM_032412 NM_032423 NM_032424 NM_032431 NM_032436 NM_032438 NM_032440 NM_032441 NM_032449 NM_032457 NM_032458 NM_032471 NM_032485 NM_032486 NM_032491 NM_032495 NM_032497 NM_032499 NM_032505 NM_032510 NM_032511 NM_032514 NM_032521 NM_032523 NM_032532 NM_032538 NM_032547 NM_032548 NM_032557 NM_032560 NM_032572 NM_032581 NM_032588 NM_032606 NM_032608 NM_032622 NM_032623 NM_032626 NM_032627 NM_032632 NM_032638 NM_032646 NM_032664 NM_032681 NM_032682 NM_032711 NM_032721 NM_032735 NM_032738 NM_032770 NM_032783 NM_032785 NM_032787 NM_032788 NM_032793 NM_032800 NM_032804 NM_032808 NM_032809 NM_032810 NM_032811 NM_032813 NM_032823 NM_032826 NM_032828 NM_032833 NM_032834 NM_032840 NM_032842 NM_032846 NM_032853 NM_032858 NM_032859 NM_032861 NM_032863 NM_032864 NM_032867 NM_032869 NM_032873 NM_032876 NM_032895 NM_032899 NM_032900 NM_032905 NM_032906 NM_032910 NM_032918 NM_032932 NM_032933 NM_032943 NM_032946 NM_032960 NM_032968 NM_032969 NM_032973 NM_032975 NM_032978 NM_032979 NM_032980 NM_032981 NM_032985 NM_032986 NM_032991 NM_032997 NM_033016 NM_033017 NM_033018 NM_033025 NM_033028 NM_033052 NM_033058 NM_033066 NM_033068 NM_033069 NM_033070 NM_033071 NM_033083 NM_033091 NM_033100 NM_033117 NM_033125 NM_033129 NM_033135 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033141 NM_033143 NM_033152 NM_033153 NM_033154 NM_033155 NM_033157 NM_033181 NM_033201 NM_033211 NM_033213 NM_033222 NM_033224 NM_033225 NM_033227 NM_033228 NM_033253 NM_033260 NM_033274 NM_033281 NM_033285 NM_033290 NM_033291 NM_033292 NM_033293 NM_033294 NM_033295 NM_033297 NM_033300 NM_033305 NM_033309 NM_033318 NM_033332 NM_033334 NM_033335 NM_033338 NM_033339 NM_033340 NM_033346 NM_033360 NM_033364 NM_033389 NM_033392 NM_033394 NM_033405 NM_033427 NM_033428 NM_033429 NM_033430 NM_033437 NM_033480 NM_033481 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033505 NM_033513 NM_033540 NM_033544 NM_033550 NM_033624 NM_033631 NM_033642 NM_033644 NM_033645 NM_033656 NM_033666 NM_033671 NM_052822 NM_052828 NM_052832 NM_052834 NM_052839 NM_052851 NM_052857 NM_052860 NM_052861 NM_052864 NM_052869 NM_052872 NM_052876 NM_052878 NM_052879 NM_052887 NM_052896 NM_052904 NM_052906 NM_052913 NM_052918 NM_052932 NM_052937 NM_052938 NM_052941 NM_052957 NM_052962 NM_052963 NM_052965 NM_052966 NM_052969 NM_052978 NM_053002 NM_053024 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053042 NM_053044 NM_053053 NM_053056 NM_053064 NM_053281 NM_053282 NM_054014 NM_054030 NM_054033 NM_054111 NM_057159 NM_057169 NM_057170 NM_057175 NM_057177 NM_057178 NM_058166 NM_058167 NM_058170 NM_058172 NM_058178 NM_058179 NM_058182 NM_058237 NM_058241 NM_078470 NM_078471 NM_078473 NM_078483 NM_078488 NM_078625 NM_078628 NM_080387 NM_080422 NM_080423 NM_080473 NM_080542 NM_080593 NM_080599 NM_080645 NM_080654 NM_080660 NM_080661 NM_080677 NM_080717 NM_080723 NM_080730 NM_080731 NM_080737 NM_080759 NM_080760 NM_080764 NM_080789 NM_080790 NM_080791 NM_080818 NM_080827 NM_080836 NM_080860 NM_080867 NM_080868 NM_080871 NM_080872 NM_080874 NM_080876 NM_080921 NM_080922 NM_080923 NM_101395 NM_130387 NM_130389 NM_130435 NM_130436 NM_130437 NM_130438 NM_130439 NM_130440 NM_130446 NM_130465 NM_130466 NM_130759 NM_130766 NM_130793 NM_130809 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130845 NM_130846 NM_130847 NM_133170 NM_133175 NM_133176 NM_133259 NM_133265 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133337 NM_133367 NM_133369 NM_133370 NM_133372 NM_133444 NM_133445 NM_133460 NM_133468 NM_133474 NM_133477 NM_133482 NM_133496 NM_133502 NM_133627 NM_133628 NM_133629 NM_133630 NM_133632 NM_133633 NM_133646 NM_134264 NM_134265 NM_134421 NM_134422 NM_134423 NM_134424 NM_134428 NM_134442 NM_134470 NM_138278 NM_138281 NM_138288 NM_138316 NM_138319 NM_138346 NM_138357 NM_138369 NM_138375 NM_138390 NM_138399 NM_138400 NM_138402 NM_138409 NM_138415 NM_138419 NM_138444 NM_138448 NM_138459 NM_138473 NM_138479 NM_138484 NM_138494 NM_138555 NM_138566 NM_138576 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138634 NM_138638 NM_138640 NM_138694 NM_138713 NM_138714 NM_138715 NM_138716 NM_138717 NM_138726 NM_138731 NM_138735 NM_138777 NM_138781 NM_138782 NM_138795 NM_138797 NM_138798 NM_138799 NM_138815 NM_138929 NM_138930 NM_138931 NM_138959 NM_138961 NM_138969 NM_138970 NM_138980 NM_138981 NM_138982 NM_138995 NM_138998 NM_139016 NM_139018 NM_139022 NM_139024 NM_139028 NM_139068 NM_139069 NM_139070 NM_139075 NM_139076 NM_139126 NM_139135 NM_139169 NM_139175 NM_139177 NM_139182 NM_139207 NM_139211 NM_139212 NM_139235 NM_139239 NM_139244 NM_139245 NM_139246 NM_139264 NM_139267 NM_139274 NM_139275 NM_139277 NM_139279 NM_139280 NM_139316 NM_139323 NM_144497 NM_144502 NM_144503 NM_144504 NM_144567 NM_144570 NM_144578 NM_144595 NM_144596 NM_144599 NM_144600 NM_144609 NM_144610 NM_144611 NM_144613 NM_144621 NM_144626 NM_144629 NM_144632 NM_144636 NM_144638 NM_144641 NM_144642 NM_144679 NM_144682 NM_144684 NM_144687 NM_144689 NM_144693 NM_144711 NM_144715 NM_144717 NM_144718 NM_144720 NM_144722 NM_144726 NM_144770 NM_144778 NM_144781 NM_144782 NM_144949 NM_144972 NM_144974 NM_144975 NM_144976 NM_144980 NM_144988 NM_144992 NM_145008 NM_145011 NM_145013 NM_145020 NM_145035 NM_145044 NM_145049 NM_145052 NM_145055 NM_145056 NM_145061 NM_145071 NM_145112 NM_145113 NM_145119 NM_145159 NM_145167 NM_145173 NM_145174 NM_145176 NM_145196 NM_145197 NM_145198 NM_145199 NM_145203 NM_145207 NM_145230 NM_145234 NM_145238 NM_145246 NM_145250 NM_145251 NM_145257 NM_145261 NM_145268 NM_145276 NM_145284 NM_145293 NM_145295 NM_145296 NM_145300 NM_145303 NM_145307 NM_145312 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145326 NM_145331 NM_145332 NM_145333 NM_145341 NM_145347 NM_145348 NM_145349 NM_145350 NM_145351 NM_145352 NM_145648 NM_145660 NM_145685 NM_145686 NM_145687 NM_145690 NM_145693 NM_145696 NM_145730 NM_145735 NM_145739 NM_145753 NM_145759 NM_145796 NM_145798 NM_145804 NM_145808 NM_145810 NM_145812 NM_145813 NM_145814 NM_145815 NM_145858 NM_145865 NM_145888 NM_145911 NM_147128 NM_147147 NM_147150 NM_147156 NM_147157 NM_147158 NM_147159 NM_147160 NM_147171 NM_147181 NM_147182 NM_147183 NM_147185 NM_147187 NM_147202 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148170 NM_148171 NM_148174 NM_148571 NM_148894 NM_148918 NM_148921 NM_148957 NM_148977 NM_148978 NM_152219 NM_152227 NM_152238 NM_152244 NM_152261 NM_152264 NM_152265 NM_152267 NM_152269 NM_152282 NM_152289 NM_152291 NM_152292 NM_152301 NM_152308 NM_152309 NM_152312 NM_152322 NM_152329 NM_152330 NM_152332 NM_152344 NM_152349 NM_152354 NM_152355 NM_152357 NM_152373 NM_152374 NM_152380 NM_152385 NM_152388 NM_152390 NM_152399 NM_152409 NM_152414 NM_152416 NM_152418 NM_152420 NM_152429 NM_152431 NM_152433 NM_152442 NM_152450 NM_152451 NM_152457 NM_152458 NM_152464 NM_152466 NM_152470 NM_152484 NM_152487 NM_152490 NM_152498 NM_152512 NM_152516 NM_152519 NM_152522 NM_152527 NM_152529 NM_152540 NM_152547 NM_152551 NM_152554 NM_152556 NM_152565 NM_152579 NM_152587 NM_152588 NM_152597 NM_152606 NM_152607 NM_152608 NM_152615 NM_152616 NM_152622 NM_152624 NM_152625 NM_152635 NM_152636 NM_152638 NM_152641 NM_152649 NM_152655 NM_152660 NM_152665 NM_152667 NM_152673 NM_152677 NM_152678 NM_152682 NM_152688 NM_152692 NM_152695 NM_152701 NM_152715 NM_152722 NM_152723 NM_152724 NM_152729 NM_152737 NM_152745 NM_152753 NM_152755 NM_152756 NM_152765 NM_152774 NM_152776 NM_152780 NM_152787 NM_152789 NM_152793 NM_152835 NM_152836 NM_152837 NM_152838 NM_152866 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152879 NM_152880 NM_152881 NM_152882 NM_152883 NM_152888 NM_152890 NM_152903 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152924 NM_152933 NM_152934 NM_152942 NM_152989 NM_152991 NM_152995 NM_152999 NM_153010 NM_153022 NM_153031 NM_153032 NM_153183 NM_153184 NM_153186 NM_153191 NM_153207 NM_153223 NM_153231 NM_153235 NM_153238 NM_153240 NM_153256 NM_153257 NM_153261 NM_153263 NM_153273 NM_153292 NM_153328 NM_153332 NM_153341 NM_153354 NM_153355 NM_153362 NM_153365 NM_153367 NM_153371 NM_153426 NM_153427 NM_153442 NM_153453 NM_153456 NM_153487 NM_153488 NM_153607 NM_153616 NM_153617 NM_153618 NM_153619 NM_153631 NM_153632 NM_153634 NM_153646 NM_153647 NM_153648 NM_153686 NM_153698 NM_153702 NM_153703 NM_153705 NM_153710 NM_153711 NM_153712 NM_153718 NM_153719 NM_153742 NM_153764 NM_153765 NM_153766 NM_153767 NM_153810 NM_153825 NM_153826 NM_153828 NM_153837 NM_170587 NM_170607 NM_170674 NM_170675 NM_170676 NM_170677 NM_170679 NM_170686 NM_170705 NM_170709 NM_170710 NM_170712 NM_170713 NM_170714 NM_170715 NM_170716 NM_170717 NM_170719 NM_170720 NM_170721 NM_170724 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170741 NM_170742 NM_170743 NM_170750 NM_170751 NM_170752 NM_170771 NM_170773 NM_170774 NM_171982 NM_171998 NM_172020 NM_172027 NM_172028 NM_172037 NM_172056 NM_172069 NM_172070 NM_172127 NM_172128 NM_172159 NM_172160 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172177 NM_172178 NM_172193 NM_172199 NM_172206 NM_172214 NM_172215 NM_172217 NM_172218 NM_172229 NM_172230 NM_172232 NM_172240 NM_172250 NM_172311 NM_172315 NM_172316 NM_172337 NM_172346 NM_172349 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172364 NM_172387 NM_172388 NM_172389 NM_173042 NM_173043 NM_173044 NM_173054 NM_173055 NM_173056 NM_173057 NM_173058 NM_173064 NM_173065 NM_173074 NM_173076 NM_173087 NM_173088 NM_173089 NM_173090 NM_173156 NM_173170 NM_173171 NM_173172 NM_173173 NM_173177 NM_173198 NM_173200 NM_173214 NM_173342 NM_173354 NM_173355 NM_173359 NM_173362 NM_173454 NM_173455 NM_173456 NM_173457 NM_173459 NM_173463 NM_173464 NM_173468 NM_173469 NM_173470 NM_173471 NM_173473 NM_173477 NM_173478 NM_173484 NM_173487 NM_173491 NM_173497 NM_173505 NM_173508 NM_173510 NM_173511 NM_173512 NM_173514 NM_173515 NM_173519 NM_173522 NM_173528 NM_173529 NM_173531 NM_173536 NM_173545 NM_173546 NM_173547 NM_173551 NM_173552 NM_173557 NM_173560 NM_173562 NM_173571 NM_173576 NM_173578 NM_173580 NM_173582 NM_173589 NM_173597 NM_173602 NM_173611 NM_173622 NM_173626 NM_173632 NM_173644 NM_173646 NM_173647 NM_173650 NM_173653 NM_173654 NM_173661 NM_173663 NM_173664 NM_173666 NM_173667 NM_173671 NM_173675 NM_173677 NM_173683 NM_173698 NM_173700 NM_173701 NM_173793 NM_173799 NM_173800 NM_173801 NM_173802 NM_173808 NM_173809 NM_173822 NM_173823 NM_173825 NM_173826 NM_173827 NM_173830 NM_173833 NM_173841 NM_173842 NM_173843 NM_173844 NM_173851 NM_174871 NM_174892 NM_174901 NM_174902 NM_174911 NM_174937 NM_174940 NM_174945 NM_174959 NM_174975 NM_175047 NM_175052 NM_175064 NM_175066 NM_175075 NM_175566 NM_175605 NM_175607 NM_175611 NM_175612 NM_175626 NM_175627 NM_175630 NM_175634 NM_175635 NM_175636 NM_175742 NM_175743 NM_175747 NM_175847 NM_175854 NM_175858 NM_175859 NM_175863 NM_175866 NM_175872 NM_175876 NM_175883 NM_175884 NM_175892 NM_175911 NM_175921 NM_175940 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176677 NM_176789 NM_176792 NM_176811 NM_176814 NM_176816 NM_176824 NM_176863 NM_176871 NM_176874 NM_176891 NM_176894 NM_176895 NM_177401 NM_177405 NM_177436 NM_177452 NM_177453 NM_177532 NM_177554 NM_177924 NM_177947 NM_177948 NM_177949 NM_177951 NM_177952 NM_177959 NM_177966 NM_177968 NM_177969 NM_177972 NM_177990 NM_177996 NM_178006 NM_178007 NM_178010 NM_178033 NM_178043 NM_178123 NM_178126 NM_178127 NM_178135 NM_178140 NM_178151 NM_178152 NM_178153 NM_178159 NM_178238 NM_178324 NM_178338 NM_178339 NM_178340 NM_178341 NM_178342 NM_178353 NM_178424 NM_178426 NM_178427 NM_178450 NM_178470 NM_178505 NM_178509 NM_178539 NM_178548 NM_178549 NM_178564 NM_178566 NM_178582 NM_178585 NM_178812 NM_178818 NM_178823 NM_178826 NM_178830 NM_178832 NM_178836 NM_178839 NM_178842 NM_178850 NM_178858 NM_178861 NM_180991 NM_181041 NM_181054 NM_181076 NM_181077 NM_181265 NM_181309 NM_181310 NM_181332 NM_181334 NM_181335 NM_181349 NM_181358 NM_181430 NM_181431 NM_181435 NM_181481 NM_181482 NM_181483 NM_181484 NM_181486 NM_181489 NM_181504 NM_181509 NM_181523 NM_181524 NM_181527 NM_181528 NM_181531 NM_181558 NM_181578 NM_181598 NM_181643 NM_181655 NM_181656 NM_181659 NM_181670 NM_181671 NM_181696 NM_181697 NM_181701 NM_181702 NM_181705 NM_181706 NM_181714 NM_181723 NM_181726 NM_181739 NM_181740 NM_181741 NM_181742 NM_181756 NM_181774 NM_181782 NM_181784 NM_181794 NM_181795 NM_181797 NM_181798 NM_181836 NM_181838 NM_181839 NM_181846 NM_181847 NM_181861 NM_181868 NM_181869 NM_181874 NM_182314 NM_182470 NM_182471 NM_182485 NM_182487 NM_182506 NM_182507 NM_182511 NM_182513 NM_182518 NM_182522 NM_182531 NM_182540 NM_182546 NM_182547 NM_182551 NM_182558 NM_182562 NM_182564 NM_182568 NM_182569 NM_182584 NM_182592 NM_182594 NM_182603 NM_182606 NM_182609 NM_182621 NM_182625 NM_182631 NM_182641 NM_182643 NM_182644 NM_182645 NM_182646 NM_182678 NM_182682 NM_182685 NM_182691 NM_182692 NM_182701 NM_182703 NM_182712 NM_182715 NM_182734 NM_182740 NM_182746 NM_182749 NM_182751 NM_182756 NM_182758 NM_182762 NM_182763 NM_182765 NM_182767 NM_182789 NM_182796 NM_182797 NM_182798 NM_182799 NM_182801 NM_182802 NM_182812 NM_182830 NM_182832 NM_182848 NM_182894 NM_182898 NM_182899 NM_182901 NM_182904 NM_182910 NM_182912 NM_182913 NM_182914 NM_182915 NM_182918 NM_182920 NM_182931 NM_182943 NM_182948 NM_182966 NM_183004 NM_183006 NM_183041 NM_183050 NM_183075 NM_183227 NM_183238 NM_183323 NM_183353 NM_183376 NM_183381 NM_183382 NM_183383 NM_183384 NM_183393 NM_183394 NM_183397 NM_183414 NM_183415 NM_183416 NM_183419 NM_183422 NM_184085 NM_184086 NM_184087 NM_184234 NM_184237 NM_184241 NM_184244 NM_194071 NM_194259 NM_194260 NM_194261 NM_194277 NM_194282 NM_194283 NM_194285 NM_194286 NM_194287 NM_194294 NM_194298 NM_194303 NM_194314 NM_194315 NM_194316 NM_194318 NM_194319 NM_194325 NM_194327 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194356 NM_194358 NM_194359 NM_194428 NM_194430 NM_194431 NM_194434 NM_194442 NM_194454 NM_194455 NM_194456 NM_194457 NM_194458 NM_197939 NM_197951 NM_197952 NM_197953 NM_197956 NM_197968 NM_197978 NM_198038 NM_198039 NM_198040 NM_198047 NM_198057 NM_198058 NM_198077 NM_198082 NM_198086 NM_198087 NM_198088 NM_198098 NM_198120 NM_198128 NM_198141 NM_198147 NM_198150 NM_198151 NM_198156 NM_198158 NM_198159 NM_198177 NM_198178 NM_198181 NM_198182 NM_198183 NM_198189 NM_198194 NM_198196 NM_198204 NM_198205 NM_198215 NM_198217 NM_198218 NM_198219 NM_198236 NM_198240 NM_198256 NM_198257 NM_198258 NM_198267 NM_198268 NM_198269 NM_198270 NM_198274 NM_198275 NM_198277 NM_198291 NM_198309 NM_198310 NM_198312 NM_198325 NM_198330 NM_198334 NM_198335 NM_198391 NM_198392 NM_198395 NM_198400 NM_198401 NM_198428 NM_198431 NM_198439 NM_198451 NM_198452 NM_198459 NM_198460 NM_198474 NM_198484 NM_198485 NM_198488 NM_198493 NM_198499 NM_198502 NM_198503 NM_198511 NM_198539 NM_198547 NM_198549 NM_198550 NM_198562 NM_198564 NM_198569 NM_198571 NM_198581 NM_198595 NM_198596 NM_198679 NM_198681 NM_198722 NM_198793 NM_198794 NM_198797 NM_198798 NM_198829 NM_198830 NM_198833 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198844 NM_198851 NM_198887 NM_198902 NM_198904 NM_198926 NM_198935 NM_198939 NM_198968 NM_198990 NM_198992 NM_199005 NM_199040 NM_199044 NM_199053 NM_199075 NM_199126 NM_199132 NM_199133 NM_199136 NM_199168 NM_199169 NM_199170 NM_199171 NM_199176 NM_199177 NM_199182 NM_199185 NM_199188 NM_199190 NM_199202 NM_199245 NM_199262 NM_199263 NM_199324 NM_199328 NM_199335 NM_199348 NM_199413 NM_199414 NM_199421 NM_199424 NM_199437 NM_199438 NM_199439 NM_199451 NM_199452 NM_199461 NM_199462 NM_199482 NM_199483 NM_199484 NM_199485 NM_199511 NM_199512 NM_201252 NM_201259 NM_201260 NM_201261 NM_201266 NM_201267 NM_201269 NM_201278 NM_201279 NM_201280 NM_201281 NM_201348 NM_201399 NM_201431 NM_201432 NM_201433 NM_201434 NM_201436 NM_201516 NM_201517 NM_201524 NM_201525 NM_201543 NM_201544 NM_201545 NM_201556 NM_201557 NM_201568 NM_201569 NM_201591 NM_201592 NM_201648 NM_201650 NM_203282 NM_203301 NM_203307 NM_203318 NM_203327 NM_203342 NM_203343 NM_203349 NM_203351 NM_203371 NM_203372 NM_203381 NM_203382 NM_203391 NM_203394 NM_203395 NM_203403 NM_203406 NM_203417 NM_203418 NM_203436 NM_203437 NM_203438 NM_203439 NM_203440 NM_203441 NM_203445 NM_203451 NM_203452 NM_203453 NM_203458 NM_203459 NM_203462 NM_203463 NM_203464 NM_203466 NM_203467 NM_203488 NM_203499 NM_203504 NM_203505 NM_203510 NM_205543 NM_205548 NM_205833 NM_205841 NM_205857 NM_206594 NM_206595 NM_206834 NM_206835 NM_206852 NM_206853 NM_206854 NM_206855 NM_206857 NM_206860 NM_206861 NM_206862 NM_206866 NM_206889 NM_206907 NM_206909 NM_206910 NM_206911 NM_206927 NM_206928 NM_206929 NM_206930 NM_206933 NM_206937 NM_206943 NM_206962 NM_206963 NM_207003 NM_207015 NM_207032 NM_207033 NM_207034 NM_207043 NM_207044 NM_207047 NM_207119 NM_207123 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207299 NM_207304 NM_207306 NM_207311 NM_207325 NM_207329 NM_207333 NM_207356 NM_207357 NM_207358 NM_207365 NM_207372 NM_207374 NM_207380 NM_207381 NM_207388 NM_207397 NM_207406 NM_207418 NM_207422 NM_207428 NM_207429 NM_207434 NM_207437 NM_207438 NM_207448 NM_207454 NM_207460 NM_207463 NM_207465 NM_207467 NM_207469 NM_207473 NM_207474 NM_207479 NM_207483 NM_207486 NM_207497 NM_207498 NM_207503 NM_207506 NM_207507 NM_207510 NM_207511 NM_207517 NM_207520 NM_207521 NM_207577 NM_207646 NM_212460 NM_212464 NM_212465 NM_212467 NM_212469 NM_212471 NM_212472 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212540 NM_212554 NM_212555 NM_212556 NM_212558 NM_213589 NM_213594 NM_213595 NM_213598 NM_213606 NM_213612 NM_213645 NM_213646 NM_213654 NM_213657 NM_213658 NM_213723 NM_213724 NM_214461 NM_214676 NM_214677 NM_214678 NM_214679 NM_214711 XM_027236 XM_029101 XM_030378 XM_031553 XM_032278 XM_032571 XM_032996 XM_034274 XM_034872 XM_035299 XM_036115 XM_038436 XM_039393 XM_039570 XM_039627 XM_039676 XM_041126 XM_042066 XM_042301 XM_042698 XM_042833 XM_042936 XM_043493 XM_043653 XM_044434 XM_045290 XM_046264 XM_046581 XM_047357 XM_047995 XM_048592 XM_048898 XM_049078 XM_055636 XM_057296 XM_058513 XM_058931 XM_058967 XM_059832 XM_059929 XM_063287 XM_064190 XM_067585 XM_071712 XM_084529 XM_085151 XM_085347 XM_086725 XM_086937 XM_087089 XM_087137 XM_093839 XM_097351 XM_097580 XM_097792 XM_113743 XM_113825 XM_113947 XM_117117 XM_117294 XM_165401 XM_166132 XM_166320 XM_167044 XM_167147 XM_167275 XM_168530 XM_168578 XM_171054 XM_171165 XM_172889 XM_173083 XM_208200 XM_208373 XM_208835 XM_208990 XM_209429 XM_209607 XM_209741 XM_209824 XM_211529 XM_211805 XM_211816 XM_290351 XM_290401 XM_290502 XM_290597 XM_290609 XM_290712 XM_290734 XM_290737 XM_290835 XM_290842 XM_291019 XM_291075 XM_291095 XM_291128 XM_291262 XM_291671 XM_291729 XM_291947 XM_292357 XM_292717 XM_293570 XM_293911 XM_294765 XM_295195 XM_298151 XM_370654 XM_370665 XM_370756 XM_370837 XM_370839 XM_370843 XM_370876 XM_370878 XM_370899 XM_370917 XM_370928 XM_370991 XM_371024 XM_371074 XM_371117 XM_371120 XM_371132 XM_371184 XM_371261 XM_371330 XM_371369 XM_371388 XM_371461 XM_371542 XM_371590 XM_371664 XM_371672 XM_371714 XM_371741 XM_371755 XM_371760 XM_371761 XM_371783 XM_371820 XM_371843 XM_371848 XM_371885 XM_371891 XM_371933 XM_372039 XM_372040 XM_372050 XM_372090 XM_372128 XM_372193 XM_372198 XM_372205 XM_372420 XM_372584 XM_372592 XM_372723 XM_372869 XM_373030 XM_373444 XM_373495 XM_373533 XM_373567 XM_373671 XM_373686 XM_373688 XM_373742 XM_373748 XM_373844 XM_373883 XM_373896 XM_373908 XM_374004 XM_374012 XM_374013 XM_374021 XM_374047 XM_374059 XM_374069 XM_374093 XM_374101 XM_374112 XM_374227 XM_374249 XM_374260 XM_374326 XM_374399 XM_374422 XM_374435 XM_374460 XM_374484 XM_374491 XM_374502 XM_374768 XM_374803 XM_374902 XM_374912 XM_374973 XM_375041 XM_375099 XM_375152 XM_375163 XM_375185 XM_375224 XM_375272 XM_375357 XM_375430 XM_375449 XM_375491 XM_375568 XM_375590 XM_375606 XM_375608 XM_375669 XM_375697 XM_375713 XM_375729 XM_375803 XM_375821 XM_375935 XM_376148 XM_376165 XM_376189 XM_376212 XM_376254 XM_376269 XM_376278 XM_376284 XM_376318 XM_376320 XM_376334 XM_376350 XM_376412 XM_376419 XM_376436 XM_376444 XM_376454 XM_376469 XM_376522 XM_376560 XM_376586 XM_376602 XM_376652 XM_376658 XM_376679 XM_376680 XM_376727 XM_376795 XM_376822 XM_376905 XM_376986 XM_377028 XM_377041 XM_377053 XM_377742 XM_377761 XM_378178 XM_378202 XM_378224 XM_378259 XM_378279 XM_378280 XM_378299 XM_378301 XM_378305 XM_378309 XM_378316 XM_378321 XM_378327 XM_378329 XM_378356 XM_378362 XM_378374 XM_378389 XM_378399 XM_378411 XM_378419 XM_378421 XM_378453 XM_378456 XM_378460 XM_378462 XM_378511 XM_378514 XM_378517 XM_378542 XM_378544 XM_378545 XM_378546 XM_378567 XM_378589 XM_378639 XM_378649 XM_378650 XM_378692 XM_378698 XM_378735 XM_378738 XM_378746 XM_378750 XM_378758 XM_378783 XM_378787 XM_378799 XM_378807 XM_378843 XM_378861 XM_378876 XM_378883 XM_378908 XM_378914 XM_378941 XM_378971 XM_379006 XM_379030 XM_379041 XM_379068 XM_379075 XM_379078 XM_379096 XM_379097 XM_379099 XM_379100 XM_379118 XM_379123 XM_379135 XM_379136 XM_379141 XM_379171 XM_379182 XM_379190 XM_379206 XM_379215 XM_379234 XM_379243 XM_379258 XM_379260 XM_379267 XM_379274 XM_379276 XM_379295 XM_379309 XM_379363 XM_379402 XM_379406 XM_379417 XM_379438 XM_379452 XM_379458 XM_379483 XM_379535 XM_379547 XM_379587 XM_379592 XM_379597 XM_379629 XM_379634 XM_379648 XM_379650 XM_379664 XM_379665 XM_379696 XM_379704 XM_379722 XM_379798 XM_379820 XM_379877 XM_379885 XM_379892 XM_379897 XM_379927 XM_379933 XM_379934 XM_379979 XM_380099 XM_380160 XM_380173 XM_380175 XM_495798 XM_495807 XM_495844 XM_495848 XM_495886 XM_495909 XM_495918 XM_495926 XM_495943 XM_495950 XM_495961 XM_496037 XM_496041 XM_496044 XM_496047 XM_496076 XM_496081 XM_496088 XM_496103 XM_496134 XM_496191 XM_496227 XM_496241 XM_496351 XM_496355 XM_496361 XM_496436 XM_496467 XM_496539 XM_496549 XM_496576 XM_496581 XM_496597 XM_496610 XM_496622 XM_496635 XM_496654 XM_496688 XM_496705 XM_496721 XM_496740 XM_496777 XM_496780 XM_496814 XM_496826 XM_496844 XM_496895 XM_496912 XM_496943 XM_496959 XM_496965 XM_496966 XM_497002 XM_497036 XM_497068 XM_497072 XM_497134 XM_497181 XM_498421 XM_498438 XM_498441 XM_498442 XM_498445 XM_498446 XM_498454 XM_498456 XM_498460 XM_498463 XM_498467 XM_498475 XM_498481 XM_498490 XM_498497 XM_498508 XM_498511 XM_498516 XM_498532 XM_498540 XM_498545 XM_498561 XM_498569 XM_498572 XM_498593 XM_498594 XM_498597 XM_498605 XM_498606 XM_498614 XM_498644 XM_498651 XM_498660 XM_498673 XM_498681 XM_498692 XM_498693 XM_498727 XM_498751 XM_498764 XM_498779 XM_498780 XM_498784 XM_498785 XM_498814 XM_498825 XM_498826 XM_498862 XM_498910 XM_498912 XM_498919 XM_498925 XM_498929 XM_498949 XM_498952 XM_498957 XM_498981 XM_498986 XM_498991 XM_498995 XM_498998 XM_499008 XM_499023 XM_499027 XM_499056 XM_499061 XM_499072 XM_499079 XM_499085 XM_499093 XM_499119 XM_499122 XM_499123 XM_499142 XM_499147 XM_499153 XM_499154 XM_499176 XM_499182 XM_499262 XM_499269 XM_499323 XM_499333 XM_499354 XM_499356 XM_499364 XM_499502 XM_499503 XM_499510 XM_499525 XM_499530 XM_499533 XM_499552 XM_499568 XM_499571 XM_499572 XM_499575 XM_499576 XM_499577 XM_499583 XM_499585 XM_499590 XM_499593 XM_499597 XR_000182 XR_000192 XR_000195 XR_000216 XR_000217 XR_000254 XR_000259 XR_000261 XR_000265 XR_000273 XR_000275 XR_000292
Genes with multiple seed matches:
NM_000021 NM_000027 NM_000038 NM_000043 NM_000046 NM_000052 NM_000091 NM_000097 NM_000103 NM_000104 NM_000112 NM_000114 NM_000133 NM_000153 NM_000158 NM_000161 NM_000165 NM_000176 NM_000214 NM_000216 NM_000222 NM_000237 NM_000242 NM_000245 NM_000250 NM_000254 NM_000296 NM_000334 NM_000337 NM_000361 NM_000378 NM_000448 NM_000450 NM_000452 NM_000462 NM_000492 NM_000527 NM_000538 NM_000555 NM_000588 NM_000618 NM_000629 NM_000632 NM_000664 NM_000671 NM_000681 NM_000706 NM_000782 NM_000793 NM_000809 NM_000814 NM_000843 NM_000860 NM_000868 NM_000872 NM_000899 NM_000901 NM_000910 NM_000933 NM_000944 NM_000945 NM_000950 NM_000956 NM_000984 NM_000997 NM_001001395 NM_001001396 NM_001001419 NM_001001420 NM_001001556 NM_001001664 NM_001001686 NM_001001702 NM_001001707 NM_001001709 NM_001001870 NM_001001873 NM_001001890 NM_001001927 NM_001001974 NM_001002231 NM_001002232 NM_001002233 NM_001002257 NM_001002295 NM_001002811 NM_001002812 NM_001002814 NM_001002860 NM_001002881 NM_001002914 NM_001003674 NM_001003675 NM_001003679 NM_001003688 NM_001003698 NM_001003699 NM_001003712 NM_001003800 NM_001003940 NM_001003942 NM_001003943 NM_001004300 NM_001004301 NM_001004306 NM_001004308 NM_001004315 NM_001004328 NM_001004339 NM_001004360 NM_001005375 NM_001005388 NM_001005463 NM_001005473 NM_001005609 NM_001005753 NM_001005785 NM_001005786 NM_001006635 NM_001006657 NM_001007023 NM_001007094 NM_001007098 NM_001007237 NM_001007246 NM_001007538 NM_001007559 NM_001008220 NM_001008226 NM_001008239 NM_001008390 NM_001008393 NM_001008397 NM_001008408 NM_001008493 NM_001008537 NM_001008539 NM_001008738 NM_001008777 NM_001008781 NM_001008938 NM_001009909 NM_001009944 NM_001009956 NM_001009960 NM_001010000 NM_001010853 NM_001010871 NM_001010874 NM_001010888 NM_001010917 NM_001010942 NM_001010984 NM_001011513 NM_001011514 NM_001011656 NM_001011666 NM_001011708 NM_001012274 NM_001012320 NM_001012420 NM_001012423 NM_001012614 NM_001012714 NM_001012733 NM_001012734 NM_001012755 NM_001012756 NM_001012981 NM_001013031 NM_001013438 NM_001013439 NM_001013619 NM_001013656 NM_001013680 NM_001013682 NM_001013710 NM_001013848 NM_001014380 NM_001014434 NM_001015045 NM_001015051 NM_001015877 NM_001017395 NM_001017408 NM_001017420 NM_001017919 NM_001017973 NM_001017974 NM_001017979 NM_001017992 NM_001017995 NM_001018009 NM_001018037 NM_001018054 NM_001018055 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018102 NM_001020825 NM_001023563 NM_001023587 NM_001024024 NM_001024070 NM_001024071 NM_001024094 NM_001024372 NM_001024401 NM_001024630 NM_001024649 NM_001024657 NM_001024680 NM_001024688 NM_001024843 NM_001024855 NM_001024948 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025105 NM_001025108 NM_001025233 NM_001025266 NM_001046 NM_001071 NM_001083 NM_001121 NM_001128 NM_001160 NM_001167 NM_001177 NM_001186 NM_001204 NM_001227 NM_001241 NM_001257 NM_001259 NM_001265 NM_001267 NM_001277 NM_001286 NM_001289 NM_001290 NM_001304 NM_001310 NM_001326 NM_001328 NM_001331 NM_001332 NM_001347 NM_001351 NM_001391 NM_001396 NM_001399 NM_001401 NM_001419 NM_001421 NM_001427 NM_001430 NM_001448 NM_001461 NM_001490 NM_001521 NM_001542 NM_001616 NM_001635 NM_001656 NM_001664 NM_001684 NM_001690 NM_001742 NM_001746 NM_001754 NM_001759 NM_001777 NM_001801 NM_001821 NM_001858 NM_001859 NM_001879 NM_001892 NM_001918 NM_001923 NM_001941 NM_001945 NM_001949 NM_001957 NM_001969 NM_001980 NM_001992 NM_002006 NM_002010 NM_002015 NM_002024 NM_002033 NM_002040 NM_002044 NM_002048 NM_002051 NM_002056 NM_002069 NM_002076 NM_002081 NM_002111 NM_002140 NM_002158 NM_002182 NM_002187 NM_002196 NM_002223 NM_002239 NM_002254 NM_002285 NM_002296 NM_002312 NM_002349 NM_002351 NM_002357 NM_002359 NM_002379 NM_002380 NM_002382 NM_002389 NM_002397 NM_002399 NM_002460 NM_002485 NM_002501 NM_002518 NM_002522 NM_002524 NM_002591 NM_002594 NM_002610 NM_002628 NM_002640 NM_002641 NM_002646 NM_002655 NM_002666 NM_002670 NM_002677 NM_002706 NM_002725 NM_002755 NM_002760 NM_002763 NM_002806 NM_002814 NM_002823 NM_002833 NM_002834 NM_002835 NM_002838 NM_002845 NM_002849 NM_002857 NM_002871 NM_002886 NM_002906 NM_002955 NM_002971 NM_003016 NM_003022 NM_003046 NM_003101 NM_003107 NM_003108 NM_003112 NM_003133 NM_003137 NM_003144 NM_003153 NM_003161 NM_003185 NM_003189 NM_003270 NM_003274 NM_003286 NM_003296 NM_003320 NM_003338 NM_003339 NM_003369 NM_003408 NM_003411 NM_003421 NM_003435 NM_003453 NM_003454 NM_003458 NM_003488 NM_003489 NM_003498 NM_003528 NM_003574 NM_003590 NM_003597 NM_003605 NM_003615 NM_003617 NM_003629 NM_003633 NM_003640 NM_003644 NM_003663 NM_003672 NM_003677 NM_003681 NM_003702 NM_003711 NM_003716 NM_003722 NM_003734 NM_003740 NM_003743 NM_003759 NM_003856 NM_003870 NM_003872 NM_003885 NM_003887 NM_003901 NM_003909 NM_003913 NM_003941 NM_003972 NM_003983 NM_003994 NM_004081 NM_004093 NM_004109 NM_004113 NM_004133 NM_004155 NM_004161 NM_004171 NM_004177 NM_004184 NM_004199 NM_004217 NM_004263 NM_004265 NM_004272 NM_004273 NM_004274 NM_004287 NM_004291 NM_004293 NM_004319 NM_004326 NM_004338 NM_004342 NM_004348 NM_004349 NM_004370 NM_004379 NM_004392 NM_004412 NM_004430 NM_004438 NM_004449 NM_004457 NM_004464 NM_004518 NM_004578 NM_004586 NM_004598 NM_004619 NM_004631 NM_004645 NM_004650 NM_004663 NM_004665 NM_004686 NM_004717 NM_004728 NM_004735 NM_004744 NM_004745 NM_004755 NM_004759 NM_004776 NM_004801 NM_004815 NM_004818 NM_004844 NM_004845 NM_004856 NM_004859 NM_004878 NM_004896 NM_004898 NM_004902 NM_004904 NM_004921 NM_004925 NM_004938 NM_004947 NM_004955 NM_004956 NM_005010 NM_005011 NM_005044 NM_005054 NM_005063 NM_005065 NM_005087 NM_005095 NM_005099 NM_005126 NM_005137 NM_005160 NM_005180 NM_005188 NM_005197 NM_005233 NM_005238 NM_005248 NM_005254 NM_005282 NM_005314 NM_005324 NM_005358 NM_005359 NM_005399 NM_005436 NM_005461 NM_005465 NM_005502 NM_005504 NM_005551 NM_005578 NM_005585 NM_005587 NM_005613 NM_005637 NM_005665 NM_005669 NM_005686 NM_005724 NM_005725 NM_005742 NM_005779 NM_005786 NM_005789 NM_005797 NM_005813 NM_005815 NM_005816 NM_005822 NM_005840 NM_005860 NM_005863 NM_005865 NM_005870 NM_005871 NM_005898 NM_005900 NM_005902 NM_005903 NM_005920 NM_005924 NM_005935 NM_005989 NM_006009 NM_006033 NM_006037 NM_006045 NM_006047 NM_006052 NM_006055 NM_006089 NM_006094 NM_006148 NM_006154 NM_006166 NM_006186 NM_006193 NM_006203 NM_006212 NM_006239 NM_006243 NM_006251 NM_006276 NM_006282 NM_006283 NM_006291 NM_006298 NM_006306 NM_006315 NM_006357 NM_006359 NM_006379 NM_006393 NM_006403 NM_006418 NM_006457 NM_006459 NM_006460 NM_006475 NM_006500 NM_006504 NM_006517 NM_006526 NM_006531 NM_006534 NM_006544 NM_006554 NM_006561 NM_006572 NM_006575 NM_006595 NM_006599 NM_006606 NM_006631 NM_006636 NM_006640 NM_006650 NM_006658 NM_006661 NM_006665 NM_006729 NM_006736 NM_006741 NM_006748 NM_006754 NM_006763 NM_006766 NM_006767 NM_006769 NM_006772 NM_006775 NM_006784 NM_006823 NM_006827 NM_006868 NM_006888 NM_006902 NM_006940 NM_006951 NM_006955 NM_006969 NM_006981 NM_006984 NM_007006 NM_007008 NM_007011 NM_007023 NM_007036 NM_007038 NM_007050 NM_007068 NM_007073 NM_007107 NM_007146 NM_007147 NM_007191 NM_007203 NM_007219 NM_007249 NM_007269 NM_007318 NM_007332 NM_007372 NM_007373 NM_012062 NM_012080 NM_012081 NM_012082 NM_012083 NM_012106 NM_012115 NM_012153 NM_012156 NM_012157 NM_012158 NM_012223 NM_012231 NM_012249 NM_012262 NM_012264 NM_012279 NM_012287 NM_012288 NM_012304 NM_012319 NM_012333 NM_012338 NM_012345 NM_012405 NM_012416 NM_012420 NM_012446 NM_012456 NM_012463 NM_012464 NM_012465 NM_013229 NM_013231 NM_013241 NM_013243 NM_013255 NM_013257 NM_013261 NM_013262 NM_013302 NM_013341 NM_013374 NM_013449 NM_013937 NM_013943 NM_013989 NM_013995 NM_014011 NM_014021 NM_014023 NM_014035 NM_014046 NM_014048 NM_014112 NM_014153 NM_014178 NM_014243 NM_014293 NM_014319 NM_014324 NM_014325 NM_014332 NM_014351 NM_014388 NM_014393 NM_014399 NM_014415 NM_014469 NM_014476 NM_014517 NM_014518 NM_014554 NM_014585 NM_014600 NM_014610 NM_014612 NM_014615 NM_014631 NM_014653 NM_014682 NM_014686 NM_014689 NM_014701 NM_014707 NM_014730 NM_014732 NM_014739 NM_014755 NM_014756 NM_014774 NM_014776 NM_014784 NM_014789 NM_014797 NM_014801 NM_014803 NM_014809 NM_014827 NM_014829 NM_014837 NM_014853 NM_014883 NM_014893 NM_014901 NM_014902 NM_014910 NM_014920 NM_014923 NM_014926 NM_014934 NM_014947 NM_014951 NM_014953 NM_014959 NM_014992 NM_015003 NM_015008 NM_015020 NM_015022 NM_015025 NM_015035 NM_015040 NM_015049 NM_015066 NM_015074 NM_015076 NM_015087 NM_015088 NM_015090 NM_015091 NM_015115 NM_015133 NM_015138 NM_015141 NM_015172 NM_015184 NM_015192 NM_015205 NM_015230 NM_015236 NM_015250 NM_015253 NM_015257 NM_015266 NM_015271 NM_015285 NM_015288 NM_015305 NM_015310 NM_015313 NM_015316 NM_015317 NM_015323 NM_015326 NM_015329 NM_015335 NM_015336 NM_015338 NM_015344 NM_015349 NM_015353 NM_015358 NM_015359 NM_015375 NM_015387 NM_015394 NM_015401 NM_015438 NM_015441 NM_015446 NM_015447 NM_015458 NM_015460 NM_015472 NM_015476 NM_015496 NM_015532 NM_015550 NM_015553 NM_015555 NM_015560 NM_015564 NM_015569 NM_015570 NM_015576 NM_015640 NM_015646 NM_015657 NM_015715 NM_015886 NM_015891 NM_015915 NM_015995 NM_016018 NM_016040 NM_016076 NM_016079 NM_016083 NM_016100 NM_016107 NM_016114 NM_016132 NM_016142 NM_016206 NM_016216 NM_016217 NM_016248 NM_016252 NM_016255 NM_016275 NM_016282 NM_016284 NM_016289 NM_016301 NM_016338 NM_016353 NM_016389 NM_016424 NM_016472 NM_016485 NM_016513 NM_016536 NM_016544 NM_016545 NM_016559 NM_016575 NM_016596 NM_016607 NM_016620 NM_016653 NM_016654 NM_016824 NM_017415 NM_017420 NM_017423 NM_017424 NM_017434 NM_017522 NM_017549 NM_017577 NM_017582 NM_017583 NM_017586 NM_017610 NM_017637 NM_017644 NM_017655 NM_017656 NM_017662 NM_017665 NM_017694 NM_017709 NM_017714 NM_017719 NM_017742 NM_017761 NM_017769 NM_017776 NM_017824 NM_017902 NM_017924 NM_017927 NM_017945 NM_017953 NM_017958 NM_017975 NM_017990 NM_018011 NM_018017 NM_018048 NM_018084 NM_018092 NM_018108 NM_018121 NM_018133 NM_018137 NM_018138 NM_018150 NM_018157 NM_018181 NM_018189 NM_018204 NM_018211 NM_018212 NM_018214 NM_018215 NM_018221 NM_018224 NM_018227 NM_018243 NM_018246 NM_018247 NM_018252 NM_018257 NM_018279 NM_018303 NM_018346 NM_018348 NM_018362 NM_018363 NM_018364 NM_018374 NM_018375 NM_018407 NM_018424 NM_018425 NM_018437 NM_018440 NM_018443 NM_018449 NM_018450 NM_018482 NM_018557 NM_018566 NM_018602 NM_018640 NM_018712 NM_018718 NM_018719 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018962 NM_018970 NM_018976 NM_019006 NM_019027 NM_019044 NM_019049 NM_019053 NM_019063 NM_019069 NM_019084 NM_019094 NM_019098 NM_019114 NM_019117 NM_019556 NM_019590 NM_019857 NM_019859 NM_019860 NM_019903 NM_020119 NM_020133 NM_020139 NM_020149 NM_020154 NM_020198 NM_020204 NM_020208 NM_020228 NM_020335 NM_020337 NM_020342 NM_020363 NM_020364 NM_020399 NM_020420 NM_020444 NM_020453 NM_020456 NM_020472 NM_020473 NM_020532 NM_020552 NM_020553 NM_020647 NM_020654 NM_020661 NM_020673 NM_020704 NM_020714 NM_020755 NM_020766 NM_020769 NM_020774 NM_020779 NM_020783 NM_020792 NM_020800 NM_020802 NM_020809 NM_020810 NM_020817 NM_020841 NM_020853 NM_020867 NM_020868 NM_020918 NM_020921 NM_020925 NM_020927 NM_020933 NM_020935 NM_020940 NM_020951 NM_020962 NM_021021 NM_021032 NM_021033 NM_021045 NM_021083 NM_021111 NM_021116 NM_021132 NM_021136 NM_021202 NM_021204 NM_021205 NM_021215 NM_021227 NM_021229 NM_021238 NM_021239 NM_021622 NM_021643 NM_021735 NM_021736 NM_021737 NM_021785 NM_021804 NM_021807 NM_021813 NM_021815 NM_021820 NM_021912 NM_021914 NM_021945 NM_021961 NM_021966 NM_022041 NM_022066 NM_022080 NM_022118 NM_022131 NM_022138 NM_022344 NM_022351 NM_022405 NM_022473 NM_022474 NM_022716 NM_022733 NM_022735 NM_022754 NM_022758 NM_022781 NM_022893 NM_022898 NM_022901 NM_022917 NM_024052 NM_024080 NM_024116 NM_024294 NM_024325 NM_024332 NM_024408 NM_024423 NM_024424 NM_024425 NM_024426 NM_024512 NM_024546 NM_024548 NM_024569 NM_024594 NM_024617 NM_024620 NM_024627 NM_024666 NM_024700 NM_024713 NM_024744 NM_024747 NM_024761 NM_024783 NM_024812 NM_024813 NM_024828 NM_024900 NM_024911 NM_024924 NM_024939 NM_024942 NM_024953 NM_024974 NM_025057 NM_025074 NM_025090 NM_025138 NM_025151 NM_025160 NM_025164 NM_025191 NM_025214 NM_025218 NM_025235 NM_030583 NM_030626 NM_030627 NM_030634 NM_030650 NM_030781 NM_030784 NM_030791 NM_030806 NM_030915 NM_030918 NM_030919 NM_030920 NM_030940 NM_031226 NM_031262 NM_031263 NM_031282 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031411 NM_031418 NM_031422 NM_031439 NM_031469 NM_031490 NM_031849 NM_031857 NM_031860 NM_031913 NM_031939 NM_031942 NM_031954 NM_032012 NM_032041 NM_032047 NM_032116 NM_032151 NM_032160 NM_032186 NM_032189 NM_032208 NM_032228 NM_032291 NM_032329 NM_032364 NM_032373 NM_032383 NM_032410 NM_032423 NM_032436 NM_032449 NM_032458 NM_032471 NM_032499 NM_032505 NM_032581 NM_032606 NM_032622 NM_032626 NM_032632 NM_032638 NM_032682 NM_032711 NM_032783 NM_032785 NM_032810 NM_032813 NM_032826 NM_032834 NM_032840 NM_032842 NM_032859 NM_032869 NM_032873 NM_032876 NM_032895 NM_032960 NM_032968 NM_032969 NM_032973 NM_032978 NM_032979 NM_032981 NM_033069 NM_033083 NM_033100 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033181 NM_033211 NM_033222 NM_033224 NM_033227 NM_033228 NM_033274 NM_033285 NM_033300 NM_033305 NM_033338 NM_033339 NM_033340 NM_033346 NM_033389 NM_033392 NM_033428 NM_033430 NM_033437 NM_033503 NM_033505 NM_033544 NM_033631 NM_033656 NM_052828 NM_052832 NM_052834 NM_052839 NM_052857 NM_052872 NM_052879 NM_052904 NM_052906 NM_052918 NM_052932 NM_052941 NM_052966 NM_053024 NM_053044 NM_053064 NM_054014 NM_057159 NM_057169 NM_057170 NM_058172 NM_058178 NM_058237 NM_058241 NM_078483 NM_078488 NM_078628 NM_080387 NM_080645 NM_080730 NM_080731 NM_080737 NM_080759 NM_080760 NM_080818 NM_080872 NM_080874 NM_080921 NM_080922 NM_101395 NM_130435 NM_130436 NM_130437 NM_130438 NM_130446 NM_130793 NM_130830 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130845 NM_130846 NM_133170 NM_133175 NM_133176 NM_133334 NM_133372 NM_133468 NM_133477 NM_133627 NM_134264 NM_134428 NM_134442 NM_138278 NM_138400 NM_138415 NM_138459 NM_138473 NM_138494 NM_138555 NM_138576 NM_138638 NM_138640 NM_138713 NM_138714 NM_138715 NM_138716 NM_138731 NM_138735 NM_138781 NM_138782 NM_138799 NM_139076 NM_139177 NM_139182 NM_139235 NM_139275 NM_139316 NM_144570 NM_144578 NM_144596 NM_144613 NM_144626 NM_144632 NM_144636 NM_144642 NM_144682 NM_144684 NM_144711 NM_144717 NM_144722 NM_144726 NM_144770 NM_144949 NM_144974 NM_145013 NM_145049 NM_145052 NM_145055 NM_145112 NM_145113 NM_145167 NM_145176 NM_145250 NM_145251 NM_145257 NM_145303 NM_145307 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145735 NM_145759 NM_145810 NM_147147 NM_147223 NM_147233 NM_148170 NM_148171 NM_148571 NM_152261 NM_152265 NM_152289 NM_152291 NM_152292 NM_152330 NM_152332 NM_152354 NM_152357 NM_152374 NM_152380 NM_152390 NM_152409 NM_152429 NM_152450 NM_152458 NM_152470 NM_152522 NM_152556 NM_152624 NM_152673 NM_152688 NM_152695 NM_152723 NM_152729 NM_152737 NM_152756 NM_152765 NM_152774 NM_152793 NM_152838 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152903 NM_152924 NM_152933 NM_152934 NM_152989 NM_152999 NM_153031 NM_153184 NM_153261 NM_153263 NM_153328 NM_153332 NM_153354 NM_153355 NM_153362 NM_153365 NM_153453 NM_153456 NM_153487 NM_153607 NM_153646 NM_153647 NM_153648 NM_153712 NM_153810 NM_153826 NM_153828 NM_170587 NM_170674 NM_170675 NM_170676 NM_170677 NM_170705 NM_170709 NM_170710 NM_170719 NM_170721 NM_170724 NM_170743 NM_170750 NM_171982 NM_171998 NM_172020 NM_172037 NM_172070 NM_172193 NM_172240 NM_172250 NM_172315 NM_172316 NM_172346 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_173064 NM_173065 NM_173076 NM_173156 NM_173171 NM_173172 NM_173173 NM_173198 NM_173200 NM_173214 NM_173354 NM_173459 NM_173463 NM_173464 NM_173468 NM_173470 NM_173471 NM_173487 NM_173510 NM_173522 NM_173528 NM_173531 NM_173536 NM_173545 NM_173547 NM_173551 NM_173557 NM_173578 NM_173582 NM_173589 NM_173611 NM_173644 NM_173650 NM_173661 NM_173677 NM_173683 NM_173698 NM_173701 NM_173793 NM_173822 NM_173830 NM_173851 NM_174911 NM_175075 NM_175605 NM_175607 NM_175612 NM_175634 NM_175635 NM_175636 NM_175859 NM_175883 NM_175892 NM_175911 NM_175921 NM_175940 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176792 NM_176811 NM_176824 NM_176863 NM_176874 NM_176895 NM_177405 NM_177452 NM_177453 NM_177554 NM_177947 NM_177948 NM_177951 NM_177968 NM_177969 NM_177972 NM_177996 NM_178010 NM_178033 NM_178126 NM_178140 NM_178151 NM_178152 NM_178153 NM_178324 NM_178450 NM_178470 NM_178509 NM_178818 NM_178836 NM_178839 NM_181076 NM_181077 NM_181265 NM_181358 NM_181481 NM_181482 NM_181483 NM_181504 NM_181523 NM_181524 NM_181527 NM_181528 NM_181598 NM_181659 NM_181723 NM_181782 NM_181784 NM_181794 NM_181795 NM_181838 NM_181839 NM_181846 NM_181861 NM_181868 NM_181869 NM_182485 NM_182511 NM_182540 NM_182546 NM_182551 NM_182564 NM_182643 NM_182645 NM_182646 NM_182678 NM_182701 NM_182715 NM_182734 NM_182758 NM_182797 NM_182848 NM_182898 NM_182899 NM_182918 NM_182920 NM_183004 NM_183006 NM_183050 NM_183238 NM_183376 NM_183382 NM_183393 NM_183394 NM_183397 NM_183414 NM_184234 NM_184237 NM_184241 NM_184244 NM_194282 NM_194285 NM_194298 NM_194303 NM_194314 NM_194328 NM_194329 NM_194330 NM_194331 NM_194332 NM_194356 NM_194434 NM_194442 NM_197939 NM_197968 NM_197978 NM_198058 NM_198086 NM_198087 NM_198088 NM_198098 NM_198181 NM_198196 NM_198236 NM_198256 NM_198257 NM_198258 NM_198268 NM_198269 NM_198270 NM_198309 NM_198310 NM_198325 NM_198392 NM_198400 NM_198484 NM_198493 NM_198511 NM_198539 NM_198550 NM_198793 NM_198794 NM_198797 NM_198833 NM_198835 NM_198902 NM_198904 NM_198939 NM_198968 NM_198990 NM_199040 NM_199168 NM_199188 NM_199190 NM_199324 NM_199328 NM_199437 NM_199438 NM_199439 NM_199462 NM_199482 NM_201266 NM_201269 NM_201279 NM_201348 NM_201432 NM_201433 NM_201568 NM_201569 NM_203349 NM_203371 NM_203372 NM_203382 NM_203451 NM_203452 NM_203459 NM_203463 NM_203499 NM_205857 NM_206835 NM_206852 NM_206853 NM_206854 NM_206855 NM_206857 NM_206866 NM_206907 NM_206909 NM_206937 NM_207015 NM_207032 NM_207033 NM_207034 NM_207306 NM_207311 NM_207329 NM_207333 NM_207357 NM_207372 NM_207434 NM_207454 NM_207460 NM_207463 NM_207465 NM_207473 NM_207479 NM_207506 NM_207510 NM_207520 NM_207521 NM_212464 NM_212467 NM_212469 NM_212558 NM_213589 NM_213645 NM_213646 NM_213723 XM_030378 XM_031553 XM_034274 XM_035299 XM_036115 XM_038436 XM_039393 XM_039570 XM_039627 XM_039676 XM_042698 XM_043493 XM_044434 XM_046581 XM_049078 XM_058931 XM_059832 XM_086937 XM_087137 XM_093839 XM_113743 XM_117117 XM_117294 XM_166132 XM_166320 XM_167147 XM_171054 XM_209429 XM_209824 XM_290401 XM_290597 XM_291075 XM_291095 XM_293911 XM_294765 XM_298151 XM_370837 XM_370839 XM_370843 XM_370878 XM_370899 XM_370917 XM_371074 XM_371461 XM_371542 XM_371590 XM_371664 XM_371741 XM_371755 XM_371760 XM_372205 XM_372584 XM_373030 XM_373533 XM_373742 XM_374013 XM_374399 XM_374435 XM_375041 XM_375152 XM_375606 XM_375608 XM_375697 XM_375713 XM_375729 XM_376269 XM_376320 XM_376436 XM_376444 XM_376454 XM_376522 XM_376560 XM_376679 XM_376727 XM_376795 XM_376822 XM_378279 XM_378301 XM_378305 XM_378316 XM_378327 XM_378362 XM_378389 XM_378421 XM_378462 XM_378511 XM_378517 XM_378649 XM_378746 XM_378799 XM_378908 XM_378914 XM_379030 XM_379075 XM_379135 XM_379136 XM_379206 XM_379267 XM_379276 XM_379402 XM_379406 XM_379452 XM_379483 XM_379535 XM_379547 XM_379634 XM_379648 XM_379664 XM_379665 XM_379722 XM_379877 XM_379927 XM_379933 XM_379979 XM_380099 XM_380160 XM_495798 XM_495886 XM_495909 XM_495950 XM_496081 XM_496088 XM_496103 XM_496134 XM_496191 XM_496549 XM_496576 XM_496597 XM_496622 XM_496654 XM_496705 XM_496740 XM_496814 XM_496895 XM_496912 XM_496959 XM_496966 XM_498438 XM_498442 XM_498446 XM_498467 XM_498497 XM_498532 XM_498545 XM_498569 XM_498572 XM_498660 XM_498673 XM_498727 XM_498910 XM_498912 XM_498925 XM_498929 XM_498995 XM_498998 XM_499056 XM_499147 XM_499176 XM_499182 XM_499323 XM_499354 XM_499356 XM_499503 XM_499568 XM_499572 XM_499576 XM_499577 XM_499597 XR_000182 XR_000195 XR_000216 XR_000217 XR_000275
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)