VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"ggaacuacuaugacagcuuca"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6140
.
Total Genes with multiple seed matches:
1446
.
Genes with at least one seed match:
NM_000021 NM_000024 NM_000031 NM_000038 NM_000046 NM_000052 NM_000054 NM_000061 NM_000069 NM_000091 NM_000092 NM_000100 NM_000103 NM_000104 NM_000108 NM_000109 NM_000112 NM_000116 NM_000125 NM_000131 NM_000140 NM_000144 NM_000148 NM_000150 NM_000153 NM_000156 NM_000159 NM_000161 NM_000165 NM_000172 NM_000176 NM_000192 NM_000195 NM_000208 NM_000210 NM_000212 NM_000216 NM_000218 NM_000219 NM_000220 NM_000221 NM_000222 NM_000226 NM_000228 NM_000230 NM_000232 NM_000237 NM_000242 NM_000246 NM_000248 NM_000252 NM_000264 NM_000268 NM_000272 NM_000273 NM_000277 NM_000278 NM_000283 NM_000285 NM_000297 NM_000299 NM_000302 NM_000308 NM_000314 NM_000319 NM_000321 NM_000322 NM_000324 NM_000328 NM_000329 NM_000330 NM_000332 NM_000334 NM_000340 NM_000341 NM_000348 NM_000356 NM_000358 NM_000361 NM_000362 NM_000363 NM_000368 NM_000369 NM_000373 NM_000375 NM_000385 NM_000387 NM_000388 NM_000391 NM_000397 NM_000406 NM_000409 NM_000415 NM_000418 NM_000428 NM_000429 NM_000430 NM_000439 NM_000440 NM_000448 NM_000449 NM_000457 NM_000458 NM_000466 NM_000481 NM_000486 NM_000494 NM_000497 NM_000498 NM_000500 NM_000503 NM_000508 NM_000509 NM_000512 NM_000526 NM_000529 NM_000533 NM_000539 NM_000544 NM_000547 NM_000555 NM_000562 NM_000566 NM_000569 NM_000570 NM_000572 NM_000573 NM_000577 NM_000579 NM_000582 NM_000583 NM_000587 NM_000599 NM_000604 NM_000607 NM_000608 NM_000609 NM_000610 NM_000611 NM_000615 NM_000617 NM_000618 NM_000623 NM_000629 NM_000632 NM_000634 NM_000651 NM_000655 NM_000663 NM_000664 NM_000668 NM_000671 NM_000681 NM_000682 NM_000689 NM_000690 NM_000693 NM_000696 NM_000702 NM_000713 NM_000714 NM_000719 NM_000721 NM_000723 NM_000725 NM_000732 NM_000743 NM_000750 NM_000757 NM_000767 NM_000788 NM_000791 NM_000793 NM_000794 NM_000800 NM_000801 NM_000805 NM_000809 NM_000811 NM_000814 NM_000838 NM_000843 NM_000844 NM_000849 NM_000851 NM_000854 NM_000857 NM_000860 NM_000861 NM_000869 NM_000870 NM_000872 NM_000875 NM_000876 NM_000877 NM_000887 NM_000890 NM_000899 NM_000901 NM_000902 NM_000907 NM_000911 NM_000921 NM_000923 NM_000924 NM_000929 NM_000948 NM_000949 NM_000961 NM_000962 NM_000965 NM_000968 NM_000994 NM_000997 NM_001001188 NM_001001323 NM_001001343 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001394 NM_001001395 NM_001001396 NM_001001412 NM_001001414 NM_001001417 NM_001001418 NM_001001433 NM_001001434 NM_001001437 NM_001001481 NM_001001482 NM_001001484 NM_001001523 NM_001001549 NM_001001550 NM_001001555 NM_001001556 NM_001001557 NM_001001664 NM_001001669 NM_001001671 NM_001001681 NM_001001682 NM_001001685 NM_001001686 NM_001001691 NM_001001694 NM_001001696 NM_001001699 NM_001001704 NM_001001711 NM_001001732 NM_001001734 NM_001001851 NM_001001873 NM_001001890 NM_001001894 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001933 NM_001001936 NM_001001974 NM_001001975 NM_001001995 NM_001002233 NM_001002254 NM_001002256 NM_001002257 NM_001002258 NM_001002260 NM_001002261 NM_001002262 NM_001002269 NM_001002295 NM_001002296 NM_001002760 NM_001002761 NM_001002810 NM_001002811 NM_001002812 NM_001002814 NM_001002860 NM_001002861 NM_001002862 NM_001002880 NM_001002881 NM_001002912 NM_001002914 NM_001003399 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003698 NM_001003699 NM_001003789 NM_001003794 NM_001003796 NM_001003800 NM_001003807 NM_001003809 NM_001003818 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001003962 NM_001004055 NM_001004127 NM_001004128 NM_001004301 NM_001004302 NM_001004315 NM_001004317 NM_001004322 NM_001004325 NM_001004326 NM_001004330 NM_001004335 NM_001004338 NM_001004339 NM_001004342 NM_001004345 NM_001004348 NM_001004351 NM_001004352 NM_001004354 NM_001004355 NM_001004416 NM_001004431 NM_001004434 NM_001004470 NM_001005291 NM_001005337 NM_001005340 NM_001005354 NM_001005355 NM_001005360 NM_001005361 NM_001005362 NM_001005386 NM_001005387 NM_001005404 NM_001005405 NM_001005407 NM_001005414 NM_001005415 NM_001005416 NM_001005463 NM_001005502 NM_001005609 NM_001005737 NM_001005738 NM_001005743 NM_001005744 NM_001005745 NM_001005753 NM_001005766 NM_001005781 NM_001005782 NM_001005845 NM_001006114 NM_001006600 NM_001006603 NM_001006615 NM_001006616 NM_001006617 NM_001006619 NM_001006620 NM_001006621 NM_001006636 NM_001006656 NM_001006657 NM_001006658 NM_001006665 NM_001006932 NM_001007023 NM_001007024 NM_001007025 NM_001007073 NM_001007074 NM_001007094 NM_001007097 NM_001007102 NM_001007214 NM_001007224 NM_001007239 NM_001007246 NM_001007247 NM_001007248 NM_001007250 NM_001007258 NM_001007262 NM_001007278 NM_001007279 NM_001007466 NM_001007525 NM_001007531 NM_001007534 NM_001007536 NM_001007543 NM_001007553 NM_001007560 NM_001007565 NM_001008222 NM_001008239 NM_001008390 NM_001008392 NM_001008393 NM_001008401 NM_001008409 NM_001008493 NM_001008495 NM_001008528 NM_001008537 NM_001008541 NM_001008563 NM_001008564 NM_001008656 NM_001008657 NM_001008660 NM_001008701 NM_001008710 NM_001008711 NM_001008736 NM_001008744 NM_001008745 NM_001008756 NM_001008781 NM_001008801 NM_001008917 NM_001008925 NM_001009186 NM_001009553 NM_001009567 NM_001009612 NM_001009813 NM_001009883 NM_001009894 NM_001009899 NM_001009909 NM_001009922 NM_001009938 NM_001009955 NM_001009956 NM_001009959 NM_001010000 NM_001010846 NM_001010853 NM_001010854 NM_001010864 NM_001010866 NM_001010867 NM_001010871 NM_001010875 NM_001010882 NM_001010888 NM_001010891 NM_001010898 NM_001010903 NM_001010910 NM_001010913 NM_001010915 NM_001010925 NM_001010980 NM_001010982 NM_001010983 NM_001010985 NM_001011514 NM_001011538 NM_001011544 NM_001011545 NM_001011546 NM_001011548 NM_001011549 NM_001011550 NM_001011554 NM_001011666 NM_001011703 NM_001011708 NM_001011720 NM_001011880 NM_001012270 NM_001012271 NM_001012279 NM_001012329 NM_001012339 NM_001012361 NM_001012393 NM_001012418 NM_001012419 NM_001012420 NM_001012423 NM_001012452 NM_001012508 NM_001012511 NM_001012515 NM_001012642 NM_001012651 NM_001012659 NM_001012710 NM_001012711 NM_001012714 NM_001012715 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012756 NM_001012761 NM_001012763 NM_001012960 NM_001012968 NM_001012969 NM_001012973 NM_001012981 NM_001012988 NM_001012993 NM_001013031 NM_001013617 NM_001013622 NM_001013624 NM_001013634 NM_001013639 NM_001013642 NM_001013649 NM_001013653 NM_001013669 NM_001013675 NM_001013676 NM_001013679 NM_001013681 NM_001013682 NM_001013693 NM_001013697 NM_001013698 NM_001013707 NM_001013708 NM_001013710 NM_001013712 NM_001013713 NM_001013714 NM_001013720 NM_001013721 NM_001013726 NM_001013727 NM_001013734 NM_001013738 NM_001013739 NM_001013839 NM_001013840 NM_001013842 NM_001014283 NM_001014374 NM_001014380 NM_001014450 NM_001014797 NM_001014839 NM_001014841 NM_001015048 NM_001015049 NM_001015051 NM_001015053 NM_001015881 NM_001015886 NM_001017368 NM_001017369 NM_001017370 NM_001017373 NM_001017395 NM_001017402 NM_001017403 NM_001017404 NM_001017408 NM_001017415 NM_001017416 NM_001017418 NM_001017421 NM_001017423 NM_001017424 NM_001017425 NM_001017440 NM_001017915 NM_001017919 NM_001017923 NM_001017929 NM_001017930 NM_001017981 NM_001017995 NM_001018003 NM_001018029 NM_001018041 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018061 NM_001018062 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018070 NM_001018071 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018078 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018100 NM_001018101 NM_001018102 NM_001018103 NM_001018111 NM_001018837 NM_001020658 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001023560 NM_001023562 NM_001023563 NM_001023565 NM_001023566 NM_001023567 NM_001023582 NM_001024024 NM_001024070 NM_001024071 NM_001024075 NM_001024094 NM_001024209 NM_001024210 NM_001024211 NM_001024212 NM_001024213 NM_001024216 NM_001024457 NM_001024592 NM_001024593 NM_001024610 NM_001024630 NM_001024631 NM_001024649 NM_001024654 NM_001024655 NM_001024676 NM_001024688 NM_001024733 NM_001024736 NM_001024808 NM_001024843 NM_001024858 NM_001024912 NM_001024937 NM_001024948 NM_001024959 NM_001024960 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025081 NM_001025090 NM_001025091 NM_001025092 NM_001025094 NM_001025096 NM_001025097 NM_001025098 NM_001025100 NM_001025101 NM_001025107 NM_001025108 NM_001025160 NM_001025202 NM_001025205 NM_001025231 NM_001025232 NM_001025252 NM_001025253 NM_001025266 NM_001034 NM_001044 NM_001050 NM_001056 NM_001077 NM_001079 NM_001083 NM_001090 NM_001092 NM_001096 NM_001103 NM_001111 NM_001112 NM_001114 NM_001119 NM_001125 NM_001128 NM_001130 NM_001131 NM_001135 NM_001144 NM_001148 NM_001153 NM_001155 NM_001167 NM_001168 NM_001176 NM_001183 NM_001186 NM_001188 NM_001204 NM_001219 NM_001222 NM_001224 NM_001229 NM_001230 NM_001259 NM_001264 NM_001265 NM_001273 NM_001280 NM_001282 NM_001286 NM_001287 NM_001289 NM_001290 NM_001291 NM_001303 NM_001304 NM_001305 NM_001306 NM_001310 NM_001319 NM_001330 NM_001337 NM_001343 NM_001346 NM_001351 NM_001355 NM_001387 NM_001388 NM_001396 NM_001399 NM_001407 NM_001412 NM_001417 NM_001419 NM_001420 NM_001424 NM_001430 NM_001432 NM_001438 NM_001439 NM_001440 NM_001462 NM_001478 NM_001490 NM_001491 NM_001495 NM_001515 NM_001518 NM_001543 NM_001548 NM_001551 NM_001556 NM_001558 NM_001560 NM_001585 NM_001609 NM_001611 NM_001616 NM_001618 NM_001619 NM_001625 NM_001627 NM_001630 NM_001631 NM_001634 NM_001649 NM_001652 NM_001682 NM_001684 NM_001686 NM_001687 NM_001689 NM_001690 NM_001696 NM_001697 NM_001701 NM_001707 NM_001709 NM_001712 NM_001715 NM_001716 NM_001722 NM_001725 NM_001732 NM_001742 NM_001744 NM_001746 NM_001748 NM_001749 NM_001753 NM_001754 NM_001755 NM_001760 NM_001761 NM_001762 NM_001774 NM_001776 NM_001777 NM_001784 NM_001789 NM_001795 NM_001797 NM_001804 NM_001806 NM_001815 NM_001821 NM_001830 NM_001833 NM_001835 NM_001838 NM_001858 NM_001870 NM_001871 NM_001874 NM_001877 NM_001878 NM_001879 NM_001889 NM_001895 NM_001903 NM_001908 NM_001918 NM_001925 NM_001941 NM_001944 NM_001950 NM_001952 NM_001954 NM_001964 NM_001978 NM_001980 NM_001981 NM_001982 NM_001986 NM_001991 NM_001993 NM_002006 NM_002015 NM_002017 NM_002025 NM_002026 NM_002029 NM_002030 NM_002033 NM_002039 NM_002040 NM_002044 NM_002051 NM_002053 NM_002054 NM_002060 NM_002071 NM_002073 NM_002076 NM_002080 NM_002086 NM_002099 NM_002111 NM_002112 NM_002119 NM_002120 NM_002129 NM_002131 NM_002137 NM_002143 NM_002154 NM_002182 NM_002187 NM_002189 NM_002190 NM_002193 NM_002196 NM_002199 NM_002218 NM_002222 NM_002228 NM_002230 NM_002232 NM_002235 NM_002241 NM_002248 NM_002253 NM_002256 NM_002267 NM_002269 NM_002271 NM_002284 NM_002285 NM_002297 NM_002299 NM_002313 NM_002318 NM_002332 NM_002340 NM_002341 NM_002342 NM_002345 NM_002351 NM_002357 NM_002362 NM_002372 NM_002384 NM_002385 NM_002386 NM_002390 NM_002397 NM_002399 NM_002402 NM_002404 NM_002416 NM_002417 NM_002421 NM_002427 NM_002428 NM_002436 NM_002438 NM_002441 NM_002442 NM_002448 NM_002463 NM_002466 NM_002468 NM_002479 NM_002481 NM_002483 NM_002485 NM_002499 NM_002500 NM_002501 NM_002509 NM_002510 NM_002519 NM_002522 NM_002541 NM_002543 NM_002545 NM_002547 NM_002553 NM_002556 NM_002558 NM_002561 NM_002562 NM_002570 NM_002572 NM_002576 NM_002579 NM_002581 NM_002588 NM_002594 NM_002596 NM_002604 NM_002609 NM_002610 NM_002613 NM_002614 NM_002616 NM_002622 NM_002632 NM_002644 NM_002648 NM_002654 NM_002655 NM_002660 NM_002667 NM_002670 NM_002693 NM_002694 NM_002709 NM_002710 NM_002711 NM_002714 NM_002716 NM_002718 NM_002730 NM_002734 NM_002735 NM_002740 NM_002742 NM_002744 NM_002745 NM_002746 NM_002751 NM_002753 NM_002758 NM_002773 NM_002780 NM_002783 NM_002809 NM_002813 NM_002816 NM_002819 NM_002820 NM_002826 NM_002828 NM_002829 NM_002832 NM_002833 NM_002834 NM_002847 NM_002848 NM_002849 NM_002857 NM_002858 NM_002860 NM_002861 NM_002862 NM_002863 NM_002868 NM_002869 NM_002872 NM_002873 NM_002875 NM_002880 NM_002881 NM_002883 NM_002886 NM_002896 NM_002898 NM_002911 NM_002918 NM_002923 NM_002924 NM_002926 NM_002931 NM_002937 NM_002938 NM_002953 NM_002955 NM_002956 NM_002957 NM_002959 NM_002966 NM_002971 NM_002977 NM_002983 NM_002985 NM_003002 NM_003006 NM_003012 NM_003013 NM_003022 NM_003023 NM_003038 NM_003045 NM_003071 NM_003076 NM_003079 NM_003081 NM_003082 NM_003088 NM_003094 NM_003099 NM_003102 NM_003104 NM_003107 NM_003108 NM_003112 NM_003118 NM_003121 NM_003123 NM_003126 NM_003131 NM_003150 NM_003151 NM_003153 NM_003155 NM_003156 NM_003165 NM_003178 NM_003179 NM_003180 NM_003182 NM_003190 NM_003192 NM_003195 NM_003202 NM_003204 NM_003205 NM_003214 NM_003216 NM_003217 NM_003222 NM_003234 NM_003236 NM_003243 NM_003244 NM_003247 NM_003255 NM_003258 NM_003262 NM_003266 NM_003272 NM_003276 NM_003281 NM_003291 NM_003297 NM_003304 NM_003307 NM_003316 NM_003317 NM_003320 NM_003321 NM_003330 NM_003331 NM_003337 NM_003339 NM_003342 NM_003347 NM_003352 NM_003362 NM_003368 NM_003370 NM_003374 NM_003381 NM_003388 NM_003392 NM_003399 NM_003404 NM_003411 NM_003415 NM_003417 NM_003421 NM_003438 NM_003439 NM_003444 NM_003453 NM_003454 NM_003455 NM_003457 NM_003462 NM_003463 NM_003466 NM_003471 NM_003472 NM_003483 NM_003488 NM_003496 NM_003502 NM_003503 NM_003505 NM_003535 NM_003558 NM_003559 NM_003567 NM_003568 NM_003571 NM_003574 NM_003590 NM_003593 NM_003594 NM_003597 NM_003605 NM_003607 NM_003609 NM_003611 NM_003613 NM_003615 NM_003617 NM_003622 NM_003636 NM_003637 NM_003640 NM_003642 NM_003644 NM_003654 NM_003655 NM_003663 NM_003665 NM_003668 NM_003669 NM_003670 NM_003676 NM_003679 NM_003680 NM_003681 NM_003686 NM_003689 NM_003706 NM_003714 NM_003715 NM_003719 NM_003721 NM_003722 NM_003735 NM_003736 NM_003742 NM_003743 NM_003744 NM_003759 NM_003763 NM_003784 NM_003800 NM_003804 NM_003810 NM_003816 NM_003822 NM_003827 NM_003831 NM_003834 NM_003838 NM_003839 NM_003840 NM_003842 NM_003846 NM_003848 NM_003851 NM_003856 NM_003858 NM_003869 NM_003873 NM_003882 NM_003884 NM_003888 NM_003898 NM_003899 NM_003901 NM_003907 NM_003909 NM_003913 NM_003916 NM_003917 NM_003918 NM_003926 NM_003927 NM_003933 NM_003939 NM_003943 NM_003947 NM_003949 NM_003950 NM_003953 NM_003954 NM_003955 NM_003958 NM_003966 NM_003974 NM_003981 NM_003982 NM_003983 NM_003985 NM_003987 NM_003988 NM_003994 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004030 NM_004033 NM_004037 NM_004040 NM_004045 NM_004050 NM_004055 NM_004056 NM_004060 NM_004063 NM_004065 NM_004066 NM_004068 NM_004077 NM_004078 NM_004082 NM_004089 NM_004090 NM_004093 NM_004096 NM_004099 NM_004101 NM_004109 NM_004112 NM_004117 NM_004133 NM_004154 NM_004161 NM_004166 NM_004167 NM_004169 NM_004170 NM_004171 NM_004176 NM_004177 NM_004181 NM_004184 NM_004185 NM_004200 NM_004206 NM_004210 NM_004226 NM_004227 NM_004229 NM_004234 NM_004241 NM_004258 NM_004259 NM_004261 NM_004262 NM_004273 NM_004274 NM_004277 NM_004278 NM_004283 NM_004285 NM_004287 NM_004293 NM_004301 NM_004305 NM_004311 NM_004313 NM_004321 NM_004329 NM_004332 NM_004337 NM_004339 NM_004346 NM_004348 NM_004350 NM_004357 NM_004358 NM_004359 NM_004362 NM_004363 NM_004370 NM_004371 NM_004376 NM_004382 NM_004394 NM_004397 NM_004401 NM_004412 NM_004414 NM_004427 NM_004437 NM_004438 NM_004442 NM_004456 NM_004458 NM_004459 NM_004463 NM_004464 NM_004475 NM_004479 NM_004481 NM_004482 NM_004505 NM_004506 NM_004507 NM_004510 NM_004513 NM_004514 NM_004518 NM_004527 NM_004537 NM_004540 NM_004543 NM_004544 NM_004550 NM_004554 NM_004560 NM_004567 NM_004571 NM_004584 NM_004586 NM_004594 NM_004598 NM_004600 NM_004603 NM_004612 NM_004614 NM_004618 NM_004624 NM_004645 NM_004656 NM_004660 NM_004665 NM_004666 NM_004672 NM_004678 NM_004683 NM_004709 NM_004710 NM_004712 NM_004715 NM_004727 NM_004728 NM_004729 NM_004730 NM_004736 NM_004737 NM_004738 NM_004739 NM_004745 NM_004746 NM_004748 NM_004752 NM_004758 NM_004759 NM_004761 NM_004762 NM_004768 NM_004775 NM_004778 NM_004781 NM_004783 NM_004784 NM_004788 NM_004789 NM_004796 NM_004797 NM_004798 NM_004799 NM_004807 NM_004814 NM_004818 NM_004821 NM_004824 NM_004827 NM_004838 NM_004839 NM_004845 NM_004848 NM_004850 NM_004862 NM_004863 NM_004866 NM_004871 NM_004873 NM_004876 NM_004883 NM_004887 NM_004904 NM_004907 NM_004914 NM_004922 NM_004926 NM_004932 NM_004945 NM_004947 NM_004951 NM_004952 NM_004956 NM_004957 NM_004959 NM_004961 NM_004963 NM_004977 NM_004983 NM_004988 NM_004992 NM_005006 NM_005008 NM_005016 NM_005020 NM_005036 NM_005038 NM_005041 NM_005042 NM_005053 NM_005057 NM_005060 NM_005063 NM_005065 NM_005069 NM_005076 NM_005079 NM_005080 NM_005082 NM_005085 NM_005093 NM_005096 NM_005098 NM_005099 NM_005105 NM_005110 NM_005137 NM_005140 NM_005142 NM_005153 NM_005155 NM_005165 NM_005170 NM_005180 NM_005188 NM_005197 NM_005198 NM_005202 NM_005206 NM_005207 NM_005219 NM_005220 NM_005224 NM_005225 NM_005229 NM_005231 NM_005233 NM_005235 NM_005238 NM_005253 NM_005262 NM_005264 NM_005271 NM_005276 NM_005284 NM_005311 NM_005324 NM_005327 NM_005329 NM_005342 NM_005345 NM_005347 NM_005356 NM_005361 NM_005366 NM_005374 NM_005379 NM_005382 NM_005385 NM_005397 NM_005398 NM_005402 NM_005407 NM_005415 NM_005420 NM_005423 NM_005431 NM_005434 NM_005436 NM_005437 NM_005445 NM_005446 NM_005458 NM_005462 NM_005468 NM_005469 NM_005474 NM_005491 NM_005500 NM_005504 NM_005506 NM_005508 NM_005515 NM_005518 NM_005521 NM_005523 NM_005541 NM_005542 NM_005546 NM_005552 NM_005554 NM_005556 NM_005560 NM_005562 NM_005567 NM_005578 NM_005582 NM_005589 NM_005590 NM_005591 NM_005598 NM_005599 NM_005600 NM_005604 NM_005615 NM_005629 NM_005630 NM_005631 NM_005632 NM_005634 NM_005642 NM_005647 NM_005658 NM_005670 NM_005671 NM_005676 NM_005677 NM_005678 NM_005680 NM_005687 NM_005698 NM_005704 NM_005707 NM_005710 NM_005714 NM_005715 NM_005718 NM_005722 NM_005729 NM_005730 NM_005739 NM_005740 NM_005749 NM_005775 NM_005779 NM_005780 NM_005785 NM_005788 NM_005798 NM_005804 NM_005808 NM_005813 NM_005816 NM_005817 NM_005819 NM_005821 NM_005826 NM_005829 NM_005831 NM_005832 NM_005840 NM_005844 NM_005854 NM_005855 NM_005857 NM_005858 NM_005860 NM_005865 NM_005866 NM_005879 NM_005885 NM_005894 NM_005897 NM_005898 NM_005899 NM_005901 NM_005902 NM_005909 NM_005911 NM_005920 NM_005924 NM_005927 NM_005928 NM_005930 NM_005933 NM_005937 NM_005941 NM_005957 NM_005962 NM_005965 NM_005966 NM_005973 NM_005977 NM_005979 NM_005981 NM_005988 NM_005993 NM_006004 NM_006005 NM_006015 NM_006016 NM_006018 NM_006021 NM_006034 NM_006037 NM_006038 NM_006040 NM_006041 NM_006043 NM_006045 NM_006055 NM_006056 NM_006060 NM_006065 NM_006066 NM_006070 NM_006082 NM_006087 NM_006089 NM_006091 NM_006092 NM_006099 NM_006103 NM_006106 NM_006108 NM_006109 NM_006113 NM_006114 NM_006117 NM_006118 NM_006120 NM_006122 NM_006125 NM_006129 NM_006133 NM_006134 NM_006135 NM_006138 NM_006139 NM_006141 NM_006148 NM_006154 NM_006159 NM_006166 NM_006172 NM_006184 NM_006187 NM_006194 NM_006203 NM_006209 NM_006210 NM_006212 NM_006224 NM_006226 NM_006237 NM_006238 NM_006239 NM_006240 NM_006242 NM_006251 NM_006255 NM_006256 NM_006258 NM_006267 NM_006268 NM_006276 NM_006277 NM_006282 NM_006283 NM_006286 NM_006288 NM_006289 NM_006295 NM_006298 NM_006306 NM_006314 NM_006315 NM_006330 NM_006336 NM_006343 NM_006344 NM_006352 NM_006365 NM_006371 NM_006373 NM_006378 NM_006380 NM_006386 NM_006391 NM_006393 NM_006400 NM_006405 NM_006409 NM_006413 NM_006415 NM_006419 NM_006425 NM_006426 NM_006449 NM_006454 NM_006458 NM_006460 NM_006462 NM_006464 NM_006465 NM_006467 NM_006477 NM_006479 NM_006480 NM_006485 NM_006488 NM_006496 NM_006499 NM_006500 NM_006504 NM_006505 NM_006510 NM_006516 NM_006532 NM_006538 NM_006541 NM_006546 NM_006547 NM_006549 NM_006555 NM_006560 NM_006561 NM_006578 NM_006589 NM_006590 NM_006591 NM_006603 NM_006606 NM_006608 NM_006618 NM_006620 NM_006635 NM_006640 NM_006646 NM_006661 NM_006665 NM_006673 NM_006675 NM_006676 NM_006684 NM_006688 NM_006691 NM_006697 NM_006698 NM_006699 NM_006707 NM_006720 NM_006722 NM_006729 NM_006731 NM_006736 NM_006738 NM_006741 NM_006742 NM_006745 NM_006746 NM_006748 NM_006749 NM_006752 NM_006753 NM_006760 NM_006762 NM_006771 NM_006772 NM_006773 NM_006775 NM_006777 NM_006785 NM_006788 NM_006793 NM_006795 NM_006803 NM_006809 NM_006815 NM_006818 NM_006826 NM_006827 NM_006828 NM_006830 NM_006836 NM_006847 NM_006852 NM_006854 NM_006867 NM_006868 NM_006869 NM_006870 NM_006876 NM_006877 NM_006880 NM_006885 NM_006888 NM_006895 NM_006908 NM_006922 NM_006923 NM_006927 NM_006943 NM_006945 NM_006946 NM_006948 NM_006951 NM_006955 NM_006974 NM_006977 NM_006981 NM_006995 NM_007006 NM_007010 NM_007026 NM_007030 NM_007031 NM_007033 NM_007035 NM_007036 NM_007038 NM_007040 NM_007042 NM_007048 NM_007050 NM_007052 NM_007053 NM_007055 NM_007071 NM_007081 NM_007085 NM_007096 NM_007098 NM_007100 NM_007101 NM_007107 NM_007117 NM_007118 NM_007123 NM_007131 NM_007136 NM_007146 NM_007150 NM_007151 NM_007157 NM_007158 NM_007166 NM_007175 NM_007176 NM_007177 NM_007187 NM_007191 NM_007198 NM_007200 NM_007202 NM_007204 NM_007208 NM_007210 NM_007212 NM_007227 NM_007249 NM_007257 NM_007259 NM_007261 NM_007265 NM_007266 NM_007271 NM_007282 NM_007283 NM_007287 NM_007288 NM_007289 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007311 NM_007318 NM_007324 NM_007332 NM_007335 NM_007336 NM_007338 NM_007342 NM_007345 NM_007359 NM_007368 NM_007372 NM_009588 NM_012062 NM_012064 NM_012069 NM_012072 NM_012074 NM_012082 NM_012095 NM_012098 NM_012102 NM_012104 NM_012106 NM_012115 NM_012120 NM_012133 NM_012134 NM_012151 NM_012153 NM_012163 NM_012170 NM_012171 NM_012174 NM_012180 NM_012186 NM_012190 NM_012193 NM_012199 NM_012215 NM_012218 NM_012219 NM_012224 NM_012225 NM_012231 NM_012232 NM_012233 NM_012237 NM_012238 NM_012244 NM_012247 NM_012262 NM_012264 NM_012275 NM_012279 NM_012281 NM_012282 NM_012287 NM_012288 NM_012297 NM_012300 NM_012301 NM_012304 NM_012306 NM_012308 NM_012309 NM_012318 NM_012320 NM_012327 NM_012334 NM_012342 NM_012344 NM_012346 NM_012384 NM_012388 NM_012392 NM_012395 NM_012398 NM_012411 NM_012429 NM_012436 NM_012448 NM_012453 NM_012464 NM_012465 NM_012478 NM_012484 NM_012485 NM_013227 NM_013230 NM_013231 NM_013236 NM_013252 NM_013255 NM_013260 NM_013261 NM_013262 NM_013274 NM_013275 NM_013279 NM_013281 NM_013286 NM_013293 NM_013309 NM_013313 NM_013315 NM_013322 NM_013325 NM_013328 NM_013336 NM_013337 NM_013341 NM_013347 NM_013352 NM_013356 NM_013361 NM_013364 NM_013374 NM_013382 NM_013385 NM_013386 NM_013390 NM_013397 NM_013412 NM_013422 NM_013433 NM_013438 NM_013441 NM_013442 NM_013444 NM_013446 NM_013447 NM_013449 NM_013937 NM_013951 NM_013952 NM_013953 NM_013976 NM_013981 NM_013982 NM_013983 NM_013989 NM_013992 NM_013993 NM_013994 NM_013996 NM_013997 NM_013998 NM_013999 NM_014015 NM_014023 NM_014030 NM_014033 NM_014035 NM_014048 NM_014049 NM_014056 NM_014057 NM_014059 NM_014077 NM_014089 NM_014096 NM_014098 NM_014106 NM_014112 NM_014117 NM_014139 NM_014141 NM_014154 NM_014157 NM_014160 NM_014182 NM_014183 NM_014188 NM_014189 NM_014190 NM_014211 NM_014217 NM_014231 NM_014235 NM_014240 NM_014242 NM_014256 NM_014265 NM_014276 NM_014278 NM_014284 NM_014289 NM_014292 NM_014293 NM_014296 NM_014300 NM_014321 NM_014324 NM_014334 NM_014335 NM_014342 NM_014350 NM_014352 NM_014356 NM_014358 NM_014363 NM_014368 NM_014369 NM_014372 NM_014380 NM_014381 NM_014382 NM_014386 NM_014388 NM_014391 NM_014392 NM_014394 NM_014398 NM_014400 NM_014405 NM_014412 NM_014421 NM_014424 NM_014426 NM_014430 NM_014431 NM_014442 NM_014445 NM_014446 NM_014449 NM_014450 NM_014454 NM_014470 NM_014472 NM_014480 NM_014481 NM_014485 NM_014496 NM_014498 NM_014506 NM_014517 NM_014521 NM_014522 NM_014551 NM_014553 NM_014554 NM_014556 NM_014562 NM_014569 NM_014570 NM_014586 NM_014587 NM_014594 NM_014603 NM_014607 NM_014614 NM_014615 NM_014616 NM_014629 NM_014631 NM_014633 NM_014636 NM_014641 NM_014646 NM_014647 NM_014653 NM_014661 NM_014663 NM_014665 NM_014667 NM_014674 NM_014676 NM_014683 NM_014689 NM_014690 NM_014694 NM_014698 NM_014700 NM_014701 NM_014702 NM_014711 NM_014712 NM_014721 NM_014723 NM_014730 NM_014734 NM_014735 NM_014737 NM_014742 NM_014743 NM_014744 NM_014746 NM_014747 NM_014751 NM_014754 NM_014755 NM_014757 NM_014758 NM_014760 NM_014765 NM_014766 NM_014767 NM_014771 NM_014772 NM_014776 NM_014786 NM_014788 NM_014795 NM_014798 NM_014801 NM_014803 NM_014804 NM_014809 NM_014810 NM_014821 NM_014824 NM_014826 NM_014835 NM_014839 NM_014844 NM_014847 NM_014850 NM_014854 NM_014860 NM_014864 NM_014867 NM_014868 NM_014869 NM_014870 NM_014873 NM_014874 NM_014875 NM_014876 NM_014888 NM_014897 NM_014901 NM_014904 NM_014905 NM_014906 NM_014909 NM_014910 NM_014912 NM_014919 NM_014920 NM_014921 NM_014923 NM_014924 NM_014925 NM_014930 NM_014931 NM_014932 NM_014933 NM_014934 NM_014936 NM_014953 NM_014955 NM_014957 NM_014959 NM_014964 NM_014965 NM_014978 NM_014988 NM_014990 NM_014994 NM_015003 NM_015008 NM_015011 NM_015015 NM_015020 NM_015022 NM_015023 NM_015025 NM_015027 NM_015033 NM_015035 NM_015039 NM_015040 NM_015044 NM_015051 NM_015052 NM_015053 NM_015055 NM_015059 NM_015064 NM_015071 NM_015074 NM_015077 NM_015084 NM_015085 NM_015086 NM_015088 NM_015092 NM_015093 NM_015094 NM_015100 NM_015101 NM_015111 NM_015116 NM_015129 NM_015130 NM_015133 NM_015138 NM_015141 NM_015144 NM_015149 NM_015155 NM_015160 NM_015161 NM_015162 NM_015176 NM_015191 NM_015193 NM_015194 NM_015199 NM_015200 NM_015202 NM_015205 NM_015214 NM_015219 NM_015226 NM_015229 NM_015233 NM_015242 NM_015247 NM_015251 NM_015252 NM_015253 NM_015254 NM_015259 NM_015266 NM_015271 NM_015272 NM_015275 NM_015282 NM_015286 NM_015288 NM_015289 NM_015293 NM_015299 NM_015305 NM_015310 NM_015313 NM_015314 NM_015315 NM_015318 NM_015323 NM_015327 NM_015328 NM_015329 NM_015330 NM_015331 NM_015335 NM_015336 NM_015344 NM_015345 NM_015349 NM_015353 NM_015359 NM_015361 NM_015367 NM_015373 NM_015378 NM_015379 NM_015381 NM_015382 NM_015383 NM_015385 NM_015387 NM_015392 NM_015393 NM_015394 NM_015397 NM_015401 NM_015404 NM_015411 NM_015417 NM_015428 NM_015433 NM_015436 NM_015439 NM_015443 NM_015449 NM_015450 NM_015455 NM_015463 NM_015466 NM_015470 NM_015476 NM_015477 NM_015488 NM_015497 NM_015507 NM_015509 NM_015510 NM_015511 NM_015516 NM_015528 NM_015532 NM_015533 NM_015534 NM_015541 NM_015542 NM_015550 NM_015553 NM_015554 NM_015559 NM_015560 NM_015567 NM_015568 NM_015569 NM_015570 NM_015576 NM_015577 NM_015584 NM_015590 NM_015602 NM_015604 NM_015608 NM_015609 NM_015610 NM_015621 NM_015631 NM_015633 NM_015635 NM_015640 NM_015651 NM_015680 NM_015690 NM_015691 NM_015693 NM_015695 NM_015716 NM_015717 NM_015719 NM_015721 NM_015725 NM_015833 NM_015834 NM_015836 NM_015840 NM_015841 NM_015844 NM_015846 NM_015847 NM_015850 NM_015852 NM_015855 NM_015886 NM_015892 NM_015894 NM_015910 NM_015913 NM_015920 NM_015922 NM_015926 NM_015935 NM_015945 NM_015959 NM_015963 NM_015964 NM_015974 NM_015980 NM_015995 NM_015999 NM_016002 NM_016003 NM_016009 NM_016018 NM_016019 NM_016020 NM_016021 NM_016023 NM_016026 NM_016028 NM_016032 NM_016039 NM_016040 NM_016042 NM_016046 NM_016053 NM_016057 NM_016059 NM_016061 NM_016076 NM_016079 NM_016080 NM_016083 NM_016096 NM_016099 NM_016107 NM_016109 NM_016114 NM_016115 NM_016118 NM_016123 NM_016128 NM_016131 NM_016140 NM_016142 NM_016144 NM_016147 NM_016152 NM_016156 NM_016169 NM_016174 NM_016176 NM_016183 NM_016190 NM_016194 NM_016195 NM_016196 NM_016205 NM_016206 NM_016211 NM_016217 NM_016221 NM_016223 NM_016226 NM_016231 NM_016233 NM_016242 NM_016243 NM_016248 NM_016249 NM_016255 NM_016257 NM_016263 NM_016267 NM_016272 NM_016275 NM_016277 NM_016280 NM_016289 NM_016320 NM_016322 NM_016339 NM_016351 NM_016353 NM_016359 NM_016407 NM_016417 NM_016418 NM_016436 NM_016437 NM_016440 NM_016448 NM_016456 NM_016458 NM_016463 NM_016467 NM_016474 NM_016484 NM_016488 NM_016496 NM_016513 NM_016519 NM_016521 NM_016525 NM_016526 NM_016531 NM_016533 NM_016534 NM_016542 NM_016544 NM_016553 NM_016562 NM_016575 NM_016577 NM_016590 NM_016596 NM_016599 NM_016605 NM_016606 NM_016607 NM_016616 NM_016617 NM_016642 NM_016647 NM_016734 NM_016735 NM_016823 NM_016827 NM_016828 NM_016829 NM_016830 NM_016831 NM_016848 NM_016929 NM_016930 NM_016937 NM_016938 NM_016946 NM_016947 NM_016953 NM_016954 NM_017409 NM_017410 NM_017413 NM_017415 NM_017417 NM_017438 NM_017444 NM_017449 NM_017450 NM_017451 NM_017456 NM_017495 NM_017506 NM_017514 NM_017540 NM_017549 NM_017550 NM_017554 NM_017556 NM_017559 NM_017564 NM_017581 NM_017586 NM_017590 NM_017592 NM_017599 NM_017602 NM_017611 NM_017621 NM_017628 NM_017643 NM_017644 NM_017652 NM_017656 NM_017666 NM_017668 NM_017670 NM_017679 NM_017697 NM_017699 NM_017705 NM_017709 NM_017712 NM_017713 NM_017714 NM_017719 NM_017725 NM_017727 NM_017731 NM_017736 NM_017738 NM_017744 NM_017749 NM_017752 NM_017758 NM_017760 NM_017761 NM_017765 NM_017769 NM_017770 NM_017771 NM_017773 NM_017785 NM_017786 NM_017799 NM_017801 NM_017811 NM_017813 NM_017818 NM_017822 NM_017825 NM_017826 NM_017830 NM_017847 NM_017849 NM_017850 NM_017855 NM_017857 NM_017887 NM_017888 NM_017891 NM_017902 NM_017904 NM_017921 NM_017927 NM_017928 NM_017929 NM_017933 NM_017945 NM_017952 NM_017953 NM_017958 NM_017967 NM_017968 NM_017979 NM_017980 NM_017983 NM_017990 NM_017993 NM_017998 NM_017999 NM_018000 NM_018004 NM_018011 NM_018017 NM_018019 NM_018023 NM_018026 NM_018036 NM_018040 NM_018045 NM_018046 NM_018049 NM_018053 NM_018059 NM_018061 NM_018066 NM_018069 NM_018070 NM_018071 NM_018073 NM_018074 NM_018086 NM_018088 NM_018090 NM_018091 NM_018101 NM_018108 NM_018109 NM_018121 NM_018137 NM_018140 NM_018141 NM_018156 NM_018167 NM_018172 NM_018178 NM_018185 NM_018191 NM_018192 NM_018194 NM_018199 NM_018200 NM_018205 NM_018210 NM_018211 NM_018212 NM_018215 NM_018221 NM_018226 NM_018231 NM_018239 NM_018243 NM_018245 NM_018246 NM_018254 NM_018257 NM_018260 NM_018263 NM_018267 NM_018276 NM_018277 NM_018280 NM_018281 NM_018283 NM_018284 NM_018290 NM_018291 NM_018295 NM_018296 NM_018299 NM_018304 NM_018319 NM_018320 NM_018326 NM_018327 NM_018330 NM_018334 NM_018340 NM_018342 NM_018346 NM_018348 NM_018352 NM_018353 NM_018361 NM_018362 NM_018370 NM_018371 NM_018375 NM_018381 NM_018382 NM_018383 NM_018388 NM_018403 NM_018404 NM_018414 NM_018416 NM_018423 NM_018440 NM_018444 NM_018446 NM_018448 NM_018450 NM_018454 NM_018457 NM_018463 NM_018472 NM_018476 NM_018479 NM_018484 NM_018498 NM_018509 NM_018556 NM_018566 NM_018579 NM_018602 NM_018607 NM_018640 NM_018656 NM_018659 NM_018660 NM_018667 NM_018679 NM_018683 NM_018688 NM_018689 NM_018695 NM_018696 NM_018697 NM_018698 NM_018706 NM_018715 NM_018717 NM_018718 NM_018841 NM_018842 NM_018845 NM_018890 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018938 NM_018941 NM_018943 NM_018947 NM_018950 NM_018959 NM_018987 NM_018999 NM_019000 NM_019001 NM_019008 NM_019009 NM_019016 NM_019034 NM_019035 NM_019049 NM_019055 NM_019060 NM_019064 NM_019065 NM_019069 NM_019080 NM_019081 NM_019084 NM_019089 NM_019099 NM_019107 NM_019109 NM_019116 NM_019117 NM_019119 NM_019557 NM_019594 NM_019595 NM_019597 NM_019600 NM_019605 NM_019610 NM_019613 NM_019616 NM_019855 NM_019858 NM_019859 NM_019860 NM_019885 NM_019895 NM_020038 NM_020119 NM_020125 NM_020130 NM_020133 NM_020134 NM_020141 NM_020148 NM_020149 NM_020150 NM_020152 NM_020160 NM_020162 NM_020163 NM_020168 NM_020169 NM_020170 NM_020178 NM_020181 NM_020182 NM_020184 NM_020186 NM_020200 NM_020208 NM_020215 NM_020228 NM_020239 NM_020243 NM_020245 NM_020248 NM_020310 NM_020311 NM_020335 NM_020338 NM_020342 NM_020347 NM_020348 NM_020350 NM_020357 NM_020362 NM_020367 NM_020377 NM_020378 NM_020384 NM_020390 NM_020398 NM_020399 NM_020405 NM_020429 NM_020431 NM_020432 NM_020433 NM_020435 NM_020438 NM_020439 NM_020440 NM_020441 NM_020443 NM_020448 NM_020451 NM_020462 NM_020463 NM_020525 NM_020546 NM_020638 NM_020648 NM_020661 NM_020672 NM_020673 NM_020674 NM_020675 NM_020686 NM_020689 NM_020698 NM_020702 NM_020703 NM_020708 NM_020711 NM_020713 NM_020715 NM_020717 NM_020728 NM_020739 NM_020746 NM_020749 NM_020760 NM_020761 NM_020762 NM_020766 NM_020768 NM_020769 NM_020772 NM_020779 NM_020781 NM_020782 NM_020784 NM_020786 NM_020801 NM_020802 NM_020804 NM_020810 NM_020813 NM_020820 NM_020825 NM_020830 NM_020831 NM_020839 NM_020850 NM_020853 NM_020860 NM_020871 NM_020877 NM_020880 NM_020888 NM_020889 NM_020892 NM_020893 NM_020896 NM_020897 NM_020898 NM_020899 NM_020909 NM_020914 NM_020917 NM_020918 NM_020919 NM_020933 NM_020947 NM_020948 NM_020956 NM_020957 NM_020958 NM_020961 NM_020962 NM_020967 NM_020970 NM_020974 NM_020975 NM_020977 NM_020980 NM_020993 NM_021003 NM_021006 NM_021020 NM_021023 NM_021033 NM_021035 NM_021067 NM_021079 NM_021097 NM_021098 NM_021100 NM_021106 NM_021116 NM_021127 NM_021135 NM_021136 NM_021137 NM_021146 NM_021149 NM_021155 NM_021156 NM_021164 NM_021167 NM_021168 NM_021183 NM_021187 NM_021188 NM_021189 NM_021198 NM_021200 NM_021202 NM_021215 NM_021220 NM_021229 NM_021230 NM_021235 NM_021238 NM_021239 NM_021249 NM_021251 NM_021255 NM_021257 NM_021258 NM_021267 NM_021571 NM_021612 NM_021615 NM_021622 NM_021624 NM_021625 NM_021626 NM_021628 NM_021629 NM_021632 NM_021636 NM_021638 NM_021639 NM_021641 NM_021645 NM_021646 NM_021648 NM_021649 NM_021722 NM_021723 NM_021735 NM_021736 NM_021737 NM_021777 NM_021798 NM_021808 NM_021810 NM_021812 NM_021813 NM_021815 NM_021820 NM_021827 NM_021831 NM_021872 NM_021873 NM_021874 NM_021912 NM_021914 NM_021916 NM_021922 NM_021925 NM_021945 NM_021947 NM_021950 NM_021957 NM_021959 NM_021960 NM_021961 NM_021962 NM_021966 NM_021967 NM_021976 NM_021978 NM_021984 NM_021987 NM_021990 NM_021991 NM_022054 NM_022058 NM_022062 NM_022063 NM_022073 NM_022080 NM_022081 NM_022085 NM_022086 NM_022093 NM_022097 NM_022106 NM_022112 NM_022128 NM_022131 NM_022134 NM_022138 NM_022140 NM_022143 NM_022153 NM_022169 NM_022170 NM_022343 NM_022344 NM_022359 NM_022367 NM_022372 NM_022405 NM_022451 NM_022452 NM_022454 NM_022459 NM_022460 NM_022461 NM_022465 NM_022469 NM_022471 NM_022473 NM_022474 NM_022481 NM_022482 NM_022486 NM_022491 NM_022492 NM_022497 NM_022552 NM_022567 NM_022572 NM_022720 NM_022725 NM_022730 NM_022736 NM_022739 NM_022750 NM_022755 NM_022756 NM_022766 NM_022769 NM_022770 NM_022774 NM_022782 NM_022784 NM_022791 NM_022817 NM_022819 NM_022821 NM_022822 NM_022824 NM_022829 NM_022832 NM_022833 NM_022836 NM_022842 NM_022845 NM_022899 NM_022905 NM_022912 NM_022916 NM_022918 NM_022977 NM_022978 NM_023005 NM_023009 NM_023011 NM_023018 NM_023019 NM_023077 NM_023080 NM_023083 NM_023084 NM_023085 NM_023086 NM_023087 NM_023088 NM_023105 NM_023106 NM_023111 NM_023112 NM_023914 NM_023928 NM_023931 NM_023934 NM_024014 NM_024016 NM_024017 NM_024022 NM_024028 NM_024033 NM_024036 NM_024043 NM_024046 NM_024048 NM_024052 NM_024065 NM_024071 NM_024072 NM_024076 NM_024090 NM_024096 NM_024098 NM_024102 NM_024104 NM_024107 NM_024110 NM_024114 NM_024117 NM_024293 NM_024298 NM_024312 NM_024322 NM_024325 NM_024327 NM_024329 NM_024334 NM_024342 NM_024345 NM_024408 NM_024416 NM_024423 NM_024430 NM_024490 NM_024494 NM_024496 NM_024510 NM_024511 NM_024513 NM_024523 NM_024537 NM_024539 NM_024544 NM_024546 NM_024551 NM_024557 NM_024563 NM_024569 NM_024573 NM_024583 NM_024584 NM_024585 NM_024586 NM_024588 NM_024591 NM_024592 NM_024594 NM_024607 NM_024613 NM_024618 NM_024623 NM_024625 NM_024626 NM_024629 NM_024636 NM_024639 NM_024643 NM_024645 NM_024646 NM_024647 NM_024653 NM_024659 NM_024665 NM_024667 NM_024670 NM_024675 NM_024677 NM_024692 NM_024705 NM_024709 NM_024711 NM_024713 NM_024721 NM_024722 NM_024729 NM_024735 NM_024738 NM_024749 NM_024754 NM_024758 NM_024761 NM_024763 NM_024766 NM_024782 NM_024785 NM_024787 NM_024796 NM_024807 NM_024827 NM_024834 NM_024837 NM_024841 NM_024855 NM_024859 NM_024870 NM_024877 NM_024878 NM_024881 NM_024882 NM_024887 NM_024900 NM_024907 NM_024909 NM_024910 NM_024917 NM_024922 NM_024923 NM_024924 NM_024926 NM_024930 NM_024933 NM_024935 NM_024938 NM_024939 NM_024940 NM_024944 NM_024953 NM_024989 NM_024996 NM_024997 NM_025026 NM_025049 NM_025058 NM_025082 NM_025083 NM_025084 NM_025090 NM_025104 NM_025112 NM_025126 NM_025135 NM_025137 NM_025141 NM_025146 NM_025149 NM_025151 NM_025160 NM_025161 NM_025168 NM_025182 NM_025194 NM_025195 NM_025197 NM_025198 NM_025201 NM_025204 NM_025214 NM_025218 NM_025220 NM_025224 NM_025225 NM_025230 NM_025231 NM_025235 NM_025237 NM_025239 NM_025240 NM_025243 NM_025250 NM_025251 NM_025259 NM_030569 NM_030593 NM_030621 NM_030623 NM_030625 NM_030626 NM_030627 NM_030629 NM_030633 NM_030636 NM_030639 NM_030650 NM_030655 NM_030661 NM_030664 NM_030667 NM_030668 NM_030669 NM_030670 NM_030671 NM_030760 NM_030767 NM_030773 NM_030774 NM_030775 NM_030776 NM_030777 NM_030780 NM_030789 NM_030800 NM_030809 NM_030810 NM_030877 NM_030881 NM_030885 NM_030899 NM_030916 NM_030918 NM_030919 NM_030925 NM_030939 NM_030944 NM_030949 NM_030950 NM_030953 NM_030962 NM_030964 NM_030965 NM_030971 NM_030972 NM_031215 NM_031216 NM_031226 NM_031227 NM_031228 NM_031229 NM_031243 NM_031244 NM_031268 NM_031271 NM_031277 NM_031281 NM_031283 NM_031289 NM_031294 NM_031296 NM_031304 NM_031305 NM_031306 NM_031309 NM_031310 NM_031313 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031411 NM_031416 NM_031420 NM_031426 NM_031431 NM_031433 NM_031437 NM_031439 NM_031442 NM_031445 NM_031449 NM_031453 NM_031455 NM_031461 NM_031462 NM_031465 NM_031466 NM_031468 NM_031469 NM_031483 NM_031490 NM_031849 NM_031857 NM_031858 NM_031860 NM_031862 NM_031890 NM_031892 NM_031899 NM_031904 NM_031908 NM_031912 NM_031920 NM_031924 NM_031935 NM_031936 NM_031949 NM_031950 NM_031954 NM_031957 NM_031961 NM_031962 NM_031988 NM_031989 NM_031990 NM_031991 NM_031992 NM_032010 NM_032015 NM_032017 NM_032021 NM_032028 NM_032034 NM_032038 NM_032039 NM_032041 NM_032042 NM_032044 NM_032046 NM_032052 NM_032088 NM_032092 NM_032105 NM_032116 NM_032121 NM_032124 NM_032136 NM_032137 NM_032144 NM_032149 NM_032151 NM_032160 NM_032174 NM_032178 NM_032179 NM_032182 NM_032189 NM_032207 NM_032208 NM_032221 NM_032226 NM_032233 NM_032242 NM_032246 NM_032251 NM_032258 NM_032262 NM_032264 NM_032268 NM_032272 NM_032281 NM_032283 NM_032289 NM_032291 NM_032295 NM_032296 NM_032303 NM_032308 NM_032310 NM_032311 NM_032314 NM_032319 NM_032329 NM_032349 NM_032351 NM_032367 NM_032369 NM_032374 NM_032375 NM_032385 NM_032401 NM_032403 NM_032404 NM_032408 NM_032421 NM_032423 NM_032431 NM_032432 NM_032433 NM_032435 NM_032436 NM_032438 NM_032445 NM_032449 NM_032466 NM_032468 NM_032476 NM_032484 NM_032486 NM_032492 NM_032494 NM_032495 NM_032496 NM_032497 NM_032508 NM_032513 NM_032529 NM_032532 NM_032538 NM_032547 NM_032550 NM_032554 NM_032558 NM_032562 NM_032569 NM_032575 NM_032576 NM_032578 NM_032582 NM_032583 NM_032587 NM_032594 NM_032597 NM_032599 NM_032603 NM_032621 NM_032622 NM_032632 NM_032642 NM_032644 NM_032667 NM_032679 NM_032682 NM_032689 NM_032709 NM_032710 NM_032717 NM_032728 NM_032737 NM_032750 NM_032777 NM_032778 NM_032788 NM_032799 NM_032800 NM_032801 NM_032809 NM_032815 NM_032817 NM_032818 NM_032825 NM_032826 NM_032828 NM_032832 NM_032834 NM_032842 NM_032846 NM_032848 NM_032853 NM_032859 NM_032865 NM_032867 NM_032871 NM_032873 NM_032874 NM_032875 NM_032876 NM_032882 NM_032886 NM_032900 NM_032906 NM_032916 NM_032932 NM_032933 NM_032936 NM_032940 NM_032958 NM_032959 NM_032960 NM_032961 NM_032962 NM_032963 NM_032964 NM_032966 NM_032976 NM_032977 NM_032982 NM_032983 NM_032984 NM_032988 NM_032991 NM_032996 NM_032999 NM_033000 NM_033001 NM_033014 NM_033017 NM_033030 NM_033035 NM_033052 NM_033071 NM_033083 NM_033084 NM_033086 NM_033087 NM_033088 NM_033091 NM_033102 NM_033131 NM_033133 NM_033136 NM_033137 NM_033141 NM_033143 NM_033151 NM_033181 NM_033185 NM_033191 NM_033195 NM_033206 NM_033210 NM_033212 NM_033221 NM_033222 NM_033224 NM_033238 NM_033240 NM_033245 NM_033262 NM_033274 NM_033276 NM_033278 NM_033281 NM_033302 NM_033315 NM_033317 NM_033318 NM_033332 NM_033346 NM_033348 NM_033357 NM_033364 NM_033388 NM_033389 NM_033392 NM_033393 NM_033394 NM_033397 NM_033410 NM_033419 NM_033420 NM_033425 NM_033426 NM_033428 NM_033430 NM_033437 NM_033439 NM_033455 NM_033456 NM_033467 NM_033495 NM_033503 NM_033505 NM_033510 NM_033512 NM_033516 NM_033544 NM_033549 NM_033550 NM_033551 NM_033637 NM_033644 NM_033645 NM_033656 NM_033671 NM_048368 NM_052811 NM_052818 NM_052822 NM_052837 NM_052838 NM_052840 NM_052842 NM_052843 NM_052846 NM_052849 NM_052851 NM_052854 NM_052864 NM_052874 NM_052879 NM_052880 NM_052884 NM_052892 NM_052896 NM_052898 NM_052899 NM_052900 NM_052906 NM_052910 NM_052917 NM_052918 NM_052919 NM_052928 NM_052934 NM_052937 NM_052941 NM_052948 NM_052949 NM_052960 NM_052966 NM_052978 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053044 NM_053056 NM_053277 NM_053286 NM_054035 NM_054110 NM_054111 NM_057089 NM_057161 NM_057169 NM_057170 NM_057175 NM_057176 NM_057177 NM_057178 NM_057180 NM_058166 NM_058172 NM_058174 NM_058175 NM_058178 NM_058189 NM_058192 NM_058237 NM_058240 NM_058242 NM_058244 NM_078470 NM_078474 NM_078476 NM_078481 NM_078488 NM_079834 NM_080473 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080545 NM_080551 NM_080588 NM_080589 NM_080591 NM_080593 NM_080599 NM_080607 NM_080614 NM_080625 NM_080628 NM_080645 NM_080665 NM_080669 NM_080671 NM_080678 NM_080679 NM_080680 NM_080681 NM_080687 NM_080717 NM_080733 NM_080734 NM_080735 NM_080737 NM_080751 NM_080764 NM_080816 NM_080818 NM_080819 NM_080836 NM_080863 NM_080867 NM_080876 NM_080911 NM_080927 NM_080928 NM_101395 NM_130435 NM_130436 NM_130437 NM_130438 NM_130439 NM_130446 NM_130465 NM_130771 NM_130773 NM_130783 NM_130784 NM_130795 NM_130807 NM_130811 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130842 NM_130843 NM_130844 NM_130846 NM_130847 NM_130848 NM_130852 NM_133168 NM_133169 NM_133170 NM_133171 NM_133175 NM_133176 NM_133177 NM_133178 NM_133265 NM_133328 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133338 NM_133339 NM_133340 NM_133341 NM_133342 NM_133343 NM_133344 NM_133367 NM_133371 NM_133443 NM_133445 NM_133451 NM_133452 NM_133463 NM_133467 NM_133476 NM_133483 NM_133484 NM_133487 NM_133490 NM_133493 NM_133496 NM_133498 NM_133625 NM_133627 NM_133628 NM_133642 NM_133646 NM_133650 NM_134325 NM_134422 NM_134423 NM_134427 NM_134440 NM_138280 NM_138284 NM_138287 NM_138294 NM_138298 NM_138319 NM_138333 NM_138337 NM_138338 NM_138355 NM_138360 NM_138362 NM_138368 NM_138373 NM_138384 NM_138390 NM_138412 NM_138415 NM_138416 NM_138426 NM_138428 NM_138462 NM_138463 NM_138467 NM_138468 NM_138473 NM_138492 NM_138499 NM_138551 NM_138554 NM_138556 NM_138557 NM_138565 NM_138566 NM_138574 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138638 NM_138640 NM_138694 NM_138699 NM_138701 NM_138715 NM_138716 NM_138717 NM_138724 NM_138727 NM_138728 NM_138740 NM_138771 NM_138774 NM_138778 NM_138782 NM_138797 NM_138799 NM_138804 NM_138934 NM_138958 NM_138959 NM_138970 NM_138971 NM_138972 NM_138973 NM_138980 NM_138981 NM_138982 NM_138983 NM_138995 NM_138998 NM_139024 NM_139028 NM_139030 NM_139048 NM_139071 NM_139075 NM_139078 NM_139125 NM_139132 NM_139135 NM_139156 NM_139158 NM_139162 NM_139167 NM_139168 NM_139170 NM_139177 NM_139178 NM_139181 NM_139207 NM_139211 NM_139212 NM_139214 NM_139245 NM_139246 NM_139248 NM_139273 NM_139275 NM_139276 NM_139278 NM_139280 NM_139283 NM_139314 NM_139321 NM_139323 NM_139343 NM_139344 NM_139345 NM_139346 NM_139347 NM_139348 NM_139349 NM_139350 NM_139351 NM_144488 NM_144489 NM_144498 NM_144499 NM_144502 NM_144503 NM_144504 NM_144563 NM_144567 NM_144569 NM_144570 NM_144579 NM_144582 NM_144583 NM_144586 NM_144588 NM_144594 NM_144598 NM_144599 NM_144601 NM_144607 NM_144621 NM_144622 NM_144623 NM_144628 NM_144629 NM_144641 NM_144643 NM_144652 NM_144662 NM_144667 NM_144671 NM_144677 NM_144678 NM_144679 NM_144688 NM_144692 NM_144699 NM_144707 NM_144710 NM_144721 NM_144723 NM_144724 NM_144732 NM_144733 NM_144734 NM_144767 NM_144775 NM_144778 NM_144964 NM_144969 NM_144984 NM_145003 NM_145006 NM_145024 NM_145029 NM_145037 NM_145039 NM_145050 NM_145051 NM_145055 NM_145056 NM_145060 NM_145061 NM_145068 NM_145102 NM_145115 NM_145117 NM_145166 NM_145172 NM_145173 NM_145177 NM_145186 NM_145201 NM_145212 NM_145213 NM_145231 NM_145233 NM_145237 NM_145239 NM_145241 NM_145245 NM_145252 NM_145255 NM_145259 NM_145263 NM_145278 NM_145284 NM_145291 NM_145298 NM_145308 NM_145315 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145342 NM_145349 NM_145350 NM_145351 NM_145638 NM_145646 NM_145649 NM_145650 NM_145652 NM_145655 NM_145716 NM_145728 NM_145735 NM_145753 NM_145793 NM_145798 NM_145799 NM_145808 NM_145809 NM_145863 NM_145891 NM_145892 NM_145893 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145906 NM_145909 NM_147128 NM_147152 NM_147157 NM_147158 NM_147159 NM_147160 NM_147180 NM_147187 NM_147189 NM_147192 NM_147194 NM_147195 NM_147196 NM_147197 NM_147202 NM_147204 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148169 NM_148171 NM_148886 NM_148887 NM_148894 NM_148903 NM_148904 NM_148905 NM_148906 NM_148907 NM_148908 NM_148909 NM_148910 NM_148918 NM_148921 NM_148955 NM_148957 NM_148960 NM_152222 NM_152223 NM_152224 NM_152225 NM_152226 NM_152227 NM_152233 NM_152235 NM_152251 NM_152253 NM_152257 NM_152267 NM_152268 NM_152270 NM_152272 NM_152284 NM_152287 NM_152289 NM_152300 NM_152303 NM_152305 NM_152306 NM_152309 NM_152311 NM_152319 NM_152321 NM_152325 NM_152335 NM_152350 NM_152355 NM_152367 NM_152371 NM_152374 NM_152380 NM_152384 NM_152395 NM_152398 NM_152405 NM_152407 NM_152409 NM_152412 NM_152424 NM_152428 NM_152435 NM_152436 NM_152439 NM_152441 NM_152456 NM_152461 NM_152466 NM_152470 NM_152472 NM_152475 NM_152477 NM_152478 NM_152483 NM_152488 NM_152489 NM_152493 NM_152496 NM_152499 NM_152500 NM_152503 NM_152506 NM_152511 NM_152519 NM_152520 NM_152524 NM_152531 NM_152544 NM_152557 NM_152563 NM_152583 NM_152594 NM_152609 NM_152611 NM_152618 NM_152619 NM_152622 NM_152624 NM_152628 NM_152635 NM_152641 NM_152643 NM_152653 NM_152655 NM_152667 NM_152678 NM_152679 NM_152684 NM_152687 NM_152688 NM_152689 NM_152695 NM_152701 NM_152702 NM_152716 NM_152722 NM_152723 NM_152732 NM_152734 NM_152735 NM_152736 NM_152737 NM_152738 NM_152745 NM_152749 NM_152753 NM_152757 NM_152760 NM_152776 NM_152777 NM_152780 NM_152785 NM_152793 NM_152826 NM_152828 NM_152834 NM_152835 NM_152840 NM_152841 NM_152842 NM_152843 NM_152856 NM_152866 NM_152869 NM_152896 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152932 NM_152933 NM_152934 NM_152939 NM_152943 NM_152990 NM_152995 NM_152998 NM_153008 NM_153022 NM_153029 NM_153032 NM_153035 NM_153038 NM_153041 NM_153042 NM_153044 NM_153184 NM_153191 NM_153202 NM_153207 NM_153214 NM_153220 NM_153229 NM_153231 NM_153234 NM_153235 NM_153239 NM_153252 NM_153255 NM_153266 NM_153274 NM_153320 NM_153326 NM_153334 NM_153336 NM_153343 NM_153345 NM_153347 NM_153348 NM_153350 NM_153442 NM_153456 NM_153488 NM_153499 NM_153500 NM_153607 NM_153609 NM_153611 NM_153619 NM_153631 NM_153632 NM_153646 NM_153647 NM_153648 NM_153686 NM_153705 NM_153708 NM_153714 NM_153717 NM_153718 NM_153719 NM_153757 NM_153759 NM_153764 NM_153765 NM_153766 NM_153767 NM_153809 NM_153810 NM_153812 NM_153825 NM_153827 NM_153832 NM_153836 NM_156038 NM_170601 NM_170607 NM_170609 NM_170662 NM_170663 NM_170674 NM_170675 NM_170676 NM_170677 NM_170678 NM_170686 NM_170695 NM_170696 NM_170697 NM_170706 NM_170707 NM_170708 NM_170711 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170743 NM_170744 NM_170751 NM_170752 NM_170773 NM_170774 NM_170781 NM_171982 NM_171999 NM_172020 NM_172058 NM_172059 NM_172060 NM_172096 NM_172097 NM_172115 NM_172127 NM_172128 NM_172130 NM_172159 NM_172160 NM_172165 NM_172166 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172193 NM_172200 NM_172211 NM_172216 NM_172217 NM_172225 NM_172226 NM_172230 NM_172234 NM_172236 NM_172239 NM_172240 NM_172315 NM_172316 NM_172345 NM_172346 NM_172364 NM_172367 NM_172369 NM_172390 NM_173044 NM_173064 NM_173065 NM_173073 NM_173079 NM_173086 NM_173158 NM_173170 NM_173179 NM_173198 NM_173200 NM_173207 NM_173208 NM_173209 NM_173210 NM_173211 NM_173342 NM_173352 NM_173353 NM_173354 NM_173452 NM_173459 NM_173462 NM_173464 NM_173466 NM_173469 NM_173473 NM_173475 NM_173476 NM_173491 NM_173509 NM_173511 NM_173522 NM_173528 NM_173529 NM_173536 NM_173542 NM_173547 NM_173551 NM_173555 NM_173562 NM_173568 NM_173597 NM_173607 NM_173611 NM_173618 NM_173619 NM_173625 NM_173629 NM_173631 NM_173632 NM_173638 NM_173639 NM_173643 NM_173649 NM_173651 NM_173653 NM_173661 NM_173664 NM_173667 NM_173669 NM_173673 NM_173677 NM_173680 NM_173689 NM_173695 NM_173698 NM_173700 NM_173701 NM_173728 NM_173793 NM_173795 NM_173798 NM_173802 NM_173804 NM_173807 NM_173832 NM_173841 NM_173842 NM_173843 NM_173844 NM_173846 NM_173851 NM_173854 NM_173859 NM_174871 NM_174880 NM_174886 NM_174892 NM_174908 NM_174911 NM_174914 NM_174921 NM_174929 NM_174934 NM_174962 NM_174975 NM_174977 NM_175053 NM_175054 NM_175056 NM_175058 NM_175061 NM_175063 NM_175064 NM_175075 NM_175077 NM_175080 NM_175569 NM_175629 NM_175709 NM_175719 NM_175721 NM_175722 NM_175733 NM_175736 NM_175742 NM_175743 NM_175847 NM_175852 NM_175861 NM_175864 NM_175871 NM_175873 NM_175876 NM_175898 NM_175901 NM_175908 NM_175913 NM_175921 NM_175922 NM_176081 NM_176083 NM_176084 NM_176085 NM_176086 NM_176095 NM_176677 NM_176783 NM_176787 NM_176799 NM_176800 NM_176801 NM_176812 NM_176815 NM_176822 NM_176823 NM_176825 NM_176894 NM_177402 NM_177417 NM_177424 NM_177427 NM_177436 NM_177438 NM_177454 NM_177524 NM_177525 NM_177532 NM_177551 NM_177559 NM_177560 NM_177947 NM_177948 NM_177951 NM_177952 NM_177953 NM_177954 NM_177966 NM_177972 NM_177977 NM_177978 NM_177979 NM_177980 NM_177989 NM_178006 NM_178007 NM_178014 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178042 NM_178122 NM_178136 NM_178140 NM_178151 NM_178152 NM_178153 NM_178172 NM_178175 NM_178229 NM_178231 NM_178275 NM_178314 NM_178326 NM_178335 NM_178422 NM_178423 NM_178448 NM_178505 NM_178509 NM_178514 NM_178519 NM_178520 NM_178549 NM_178557 NM_178579 NM_178580 NM_178581 NM_178584 NM_178812 NM_178818 NM_178820 NM_178831 NM_178832 NM_178836 NM_178839 NM_178842 NM_178849 NM_178858 NM_178864 NM_180981 NM_181041 NM_181050 NM_181076 NM_181077 NM_181078 NM_181079 NM_181293 NM_181298 NM_181299 NM_181311 NM_181312 NM_181313 NM_181314 NM_181337 NM_181340 NM_181341 NM_181349 NM_181351 NM_181354 NM_181357 NM_181358 NM_181361 NM_181425 NM_181430 NM_181431 NM_181486 NM_181489 NM_181491 NM_181502 NM_181504 NM_181522 NM_181523 NM_181524 NM_181525 NM_181530 NM_181531 NM_181553 NM_181554 NM_181555 NM_181558 NM_181571 NM_181618 NM_181643 NM_181645 NM_181661 NM_181701 NM_181705 NM_181712 NM_181720 NM_181727 NM_181784 NM_181785 NM_181787 NM_181788 NM_181789 NM_181797 NM_181798 NM_181825 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181838 NM_181846 NM_181874 NM_181897 NM_182470 NM_182471 NM_182481 NM_182482 NM_182485 NM_182487 NM_182499 NM_182501 NM_182503 NM_182506 NM_182507 NM_182508 NM_182509 NM_182510 NM_182517 NM_182518 NM_182530 NM_182533 NM_182534 NM_182540 NM_182548 NM_182551 NM_182554 NM_182558 NM_182560 NM_182566 NM_182568 NM_182572 NM_182577 NM_182579 NM_182580 NM_182584 NM_182587 NM_182589 NM_182605 NM_182619 NM_182635 NM_182637 NM_182638 NM_182641 NM_182646 NM_182661 NM_182665 NM_182679 NM_182682 NM_182686 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182728 NM_182729 NM_182740 NM_182742 NM_182743 NM_182752 NM_182755 NM_182757 NM_182758 NM_182763 NM_182764 NM_182769 NM_182770 NM_182771 NM_182772 NM_182811 NM_182812 NM_182831 NM_182832 NM_182850 NM_182853 NM_182854 NM_182895 NM_182898 NM_182899 NM_182906 NM_182920 NM_182932 NM_182933 NM_182936 NM_182947 NM_182960 NM_182961 NM_182964 NM_182970 NM_182978 NM_183002 NM_183011 NM_183012 NM_183013 NM_183040 NM_183043 NM_183044 NM_183045 NM_183059 NM_183060 NM_183075 NM_183078 NM_183227 NM_183238 NM_183337 NM_183372 NM_183373 NM_183381 NM_183382 NM_183383 NM_183384 NM_183385 NM_183386 NM_183425 NM_194071 NM_194271 NM_194277 NM_194279 NM_194283 NM_194286 NM_194289 NM_194290 NM_194294 NM_194295 NM_194299 NM_194301 NM_194303 NM_194309 NM_194312 NM_194313 NM_194316 NM_194317 NM_194318 NM_194324 NM_194352 NM_194356 NM_194358 NM_194359 NM_194428 NM_194430 NM_194431 NM_194434 NM_194435 NM_194452 NM_194453 NM_194463 NM_197939 NM_197941 NM_197953 NM_197968 NM_197970 NM_197973 NM_197975 NM_197976 NM_198040 NM_198057 NM_198061 NM_198081 NM_198085 NM_198086 NM_198087 NM_198088 NM_198098 NM_198123 NM_198124 NM_198138 NM_198147 NM_198148 NM_198152 NM_198157 NM_198158 NM_198159 NM_198177 NM_198178 NM_198194 NM_198196 NM_198204 NM_198205 NM_198213 NM_198240 NM_198256 NM_198257 NM_198258 NM_198264 NM_198268 NM_198269 NM_198271 NM_198274 NM_198281 NM_198320 NM_198321 NM_198324 NM_198325 NM_198327 NM_198328 NM_198336 NM_198337 NM_198390 NM_198391 NM_198392 NM_198400 NM_198402 NM_198404 NM_198431 NM_198440 NM_198441 NM_198442 NM_198449 NM_198457 NM_198462 NM_198465 NM_198466 NM_198477 NM_198478 NM_198480 NM_198483 NM_198484 NM_198490 NM_198496 NM_198501 NM_198502 NM_198506 NM_198508 NM_198513 NM_198526 NM_198529 NM_198533 NM_198545 NM_198547 NM_198553 NM_198554 NM_198569 NM_198571 NM_198572 NM_198580 NM_198581 NM_198582 NM_198584 NM_198595 NM_198597 NM_198682 NM_198700 NM_198704 NM_198705 NM_198706 NM_198707 NM_198708 NM_198722 NM_198723 NM_198793 NM_198829 NM_198830 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198841 NM_198851 NM_198859 NM_198887 NM_198896 NM_198900 NM_198926 NM_198939 NM_198943 NM_198955 NM_198964 NM_198968 NM_198969 NM_198970 NM_198976 NM_198988 NM_198989 NM_198990 NM_199004 NM_199005 NM_199050 NM_199075 NM_199126 NM_199131 NM_199132 NM_199133 NM_199160 NM_199163 NM_199169 NM_199170 NM_199171 NM_199175 NM_199182 NM_199184 NM_199188 NM_199190 NM_199245 NM_199246 NM_199259 NM_199260 NM_199261 NM_199262 NM_199265 NM_199280 NM_199296 NM_199324 NM_199329 NM_199330 NM_199331 NM_199332 NM_199343 NM_199351 NM_199355 NM_199367 NM_199413 NM_199414 NM_199416 NM_199421 NM_199423 NM_199427 NM_199437 NM_199438 NM_199439 NM_199451 NM_199452 NM_199461 NM_199478 NM_199482 NM_201263 NM_201278 NM_201280 NM_201281 NM_201349 NM_201399 NM_201431 NM_201432 NM_201433 NM_201542 NM_201543 NM_201544 NM_201545 NM_201550 NM_201564 NM_201567 NM_201599 NM_201623 NM_201625 NM_201632 NM_201634 NM_201648 NM_201994 NM_203282 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203298 NM_203306 NM_203329 NM_203330 NM_203331 NM_203341 NM_203342 NM_203343 NM_203354 NM_203355 NM_203356 NM_203357 NM_203364 NM_203376 NM_203381 NM_203382 NM_203390 NM_203394 NM_203395 NM_203397 NM_203400 NM_203404 NM_203405 NM_203411 NM_203417 NM_203418 NM_203445 NM_203447 NM_203448 NM_203459 NM_203499 NM_203504 NM_203505 NM_203506 NM_205768 NM_205833 NM_205846 NM_205848 NM_205852 NM_205857 NM_205860 NM_205861 NM_206538 NM_206594 NM_206595 NM_206817 NM_206818 NM_206834 NM_206836 NM_206841 NM_206852 NM_206854 NM_206855 NM_206857 NM_206866 NM_206876 NM_206877 NM_206907 NM_206909 NM_206914 NM_206915 NM_206917 NM_206926 NM_206933 NM_206996 NM_207003 NM_207009 NM_207012 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207113 NM_207119 NM_207123 NM_207171 NM_207303 NM_207304 NM_207318 NM_207327 NM_207333 NM_207335 NM_207338 NM_207346 NM_207358 NM_207362 NM_207367 NM_207368 NM_207378 NM_207383 NM_207386 NM_207404 NM_207407 NM_207412 NM_207417 NM_207419 NM_207430 NM_207432 NM_207434 NM_207442 NM_207443 NM_207444 NM_207449 NM_207454 NM_207458 NM_207460 NM_207465 NM_207469 NM_207470 NM_207473 NM_207478 NM_207479 NM_207483 NM_207486 NM_207488 NM_207489 NM_207491 NM_207495 NM_207497 NM_207500 NM_207504 NM_207506 NM_207511 NM_207514 NM_207517 NM_207518 NM_207519 NM_207577 NM_207644 NM_207645 NM_212464 NM_212467 NM_212471 NM_212472 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212502 NM_212503 NM_212530 NM_212540 NM_212551 NM_212555 NM_212556 NM_213566 NM_213568 NM_213589 NM_213590 NM_213596 NM_213598 NM_213605 NM_213608 NM_213621 NM_213633 NM_213636 NM_213645 NM_213646 NM_213648 NM_213651 NM_213654 NM_213662 NM_213723 NM_214677 NM_214678 NM_214679 XM_016532 XM_027236 XM_030378 XM_031553 XM_031689 XM_032901 XM_032945 XM_032996 XM_034086 XM_034872 XM_035601 XM_036115 XM_037523 XM_037557 XM_038150 XM_038436 XM_039393 XM_039515 XM_039570 XM_039627 XM_039733 XM_039908 XM_041126 XM_042698 XM_042833 XM_042936 XM_043493 XM_044178 XM_044921 XM_046581 XM_047357 XM_047610 XM_048592 XM_049237 XM_051200 XM_051264 XM_051862 XM_055636 XM_056455 XM_057107 XM_057296 XM_059037 XM_059384 XM_059689 XM_059832 XM_059929 XM_064190 XM_064856 XM_065166 XM_066058 XM_084529 XM_085634 XM_087137 XM_087208 XM_087353 XM_088459 XM_097278 XM_097580 XM_097977 XM_098164 XM_098828 XM_114166 XM_114618 XM_117117 XM_166320 XM_168073 XM_171054 XM_171855 XM_172801 XM_208204 XM_208333 XM_208522 XM_208545 XM_208658 XM_208835 XM_208847 XM_208930 XM_209234 XM_209489 XM_209597 XM_209607 XM_209655 XM_209700 XM_209824 XM_210048 XM_211028 XM_211086 XM_211088 XM_211092 XM_211367 XM_211764 XM_211805 XM_211871 XM_212319 XM_290342 XM_290401 XM_290502 XM_290527 XM_290629 XM_290811 XM_290949 XM_291054 XM_291105 XM_291128 XM_291270 XM_291729 XM_291947 XM_293380 XM_293398 XM_293828 XM_294450 XM_294521 XM_294775 XM_295155 XM_297816 XM_350880 XM_370575 XM_370648 XM_370716 XM_370756 XM_370837 XM_370838 XM_370843 XM_370845 XM_370849 XM_370878 XM_370917 XM_370932 XM_370995 XM_371074 XM_371116 XM_371132 XM_371167 XM_371176 XM_371204 XM_371230 XM_371254 XM_371369 XM_371388 XM_371461 XM_371469 XM_371470 XM_371486 XM_371488 XM_371558 XM_371588 XM_371668 XM_371694 XM_371741 XM_371759 XM_371760 XM_371838 XM_371891 XM_371943 XM_372004 XM_372013 XM_372019 XM_372028 XM_372030 XM_372038 XM_372090 XM_372198 XM_372233 XM_372267 XM_372273 XM_372556 XM_372579 XM_372592 XM_372869 XM_373030 XM_373431 XM_373456 XM_373477 XM_373500 XM_373509 XM_373533 XM_373543 XM_373561 XM_373562 XM_373616 XM_373704 XM_373737 XM_373748 XM_373771 XM_373772 XM_373786 XM_373795 XM_373826 XM_373848 XM_373906 XM_373950 XM_373981 XM_374002 XM_374010 XM_374021 XM_374025 XM_374051 XM_374059 XM_374110 XM_374112 XM_374131 XM_374159 XM_374161 XM_374175 XM_374185 XM_374249 XM_374256 XM_374326 XM_374343 XM_374399 XM_374414 XM_374422 XM_374435 XM_374460 XM_374589 XM_374766 XM_374767 XM_374817 XM_374915 XM_375042 XM_375065 XM_375090 XM_375099 XM_375152 XM_375185 XM_375272 XM_375275 XM_375357 XM_375373 XM_375443 XM_375456 XM_375491 XM_375602 XM_375608 XM_375646 XM_375669 XM_375697 XM_376018 XM_376049 XM_376062 XM_376241 XM_376254 XM_376284 XM_376303 XM_376318 XM_376320 XM_376334 XM_376350 XM_376386 XM_376412 XM_376423 XM_376444 XM_376454 XM_376522 XM_376550 XM_376558 XM_376560 XM_376573 XM_376586 XM_376587 XM_376607 XM_376677 XM_376679 XM_376680 XM_376720 XM_376727 XM_376784 XM_376821 XM_376843 XM_376905 XM_377073 XM_377076 XM_378211 XM_378236 XM_378238 XM_378273 XM_378299 XM_378316 XM_378350 XM_378360 XM_378362 XM_378367 XM_378389 XM_378394 XM_378411 XM_378421 XM_378434 XM_378456 XM_378491 XM_378507 XM_378512 XM_378514 XM_378517 XM_378529 XM_378542 XM_378544 XM_378549 XM_378550 XM_378573 XM_378606 XM_378608 XM_378620 XM_378623 XM_378625 XM_378628 XM_378642 XM_378649 XM_378661 XM_378667 XM_378678 XM_378686 XM_378698 XM_378738 XM_378741 XM_378747 XM_378751 XM_378758 XM_378783 XM_378807 XM_378825 XM_378843 XM_378855 XM_378858 XM_378859 XM_378865 XM_378876 XM_378883 XM_378886 XM_378908 XM_378914 XM_378941 XM_378946 XM_378964 XM_378970 XM_378993 XM_379006 XM_379025 XM_379030 XM_379041 XM_379060 XM_379075 XM_379079 XM_379086 XM_379096 XM_379099 XM_379100 XM_379108 XM_379111 XM_379114 XM_379118 XM_379121 XM_379135 XM_379136 XM_379141 XM_379149 XM_379154 XM_379161 XM_379163 XM_379173 XM_379177 XM_379190 XM_379203 XM_379207 XM_379214 XM_379215 XM_379231 XM_379234 XM_379235 XM_379243 XM_379255 XM_379267 XM_379273 XM_379276 XM_379295 XM_379309 XM_379320 XM_379324 XM_379355 XM_379363 XM_379373 XM_379378 XM_379380 XM_379381 XM_379391 XM_379395 XM_379402 XM_379409 XM_379437 XM_379452 XM_379454 XM_379456 XM_379459 XM_379510 XM_379520 XM_379535 XM_379547 XM_379573 XM_379595 XM_379605 XM_379623 XM_379629 XM_379637 XM_379651 XM_379657 XM_379665 XM_379668 XM_379702 XM_379704 XM_379720 XM_379722 XM_379781 XM_379786 XM_379798 XM_379827 XM_379858 XM_379877 XM_379904 XM_379927 XM_379931 XM_379933 XM_379934 XM_379967 XM_379979 XM_380131 XM_380146 XM_380160 XM_495807 XM_495835 XM_495836 XM_495842 XM_495868 XM_495873 XM_495886 XM_495888 XM_495907 XM_495909 XM_495950 XM_496036 XM_496041 XM_496044 XM_496050 XM_496056 XM_496093 XM_496134 XM_496202 XM_496271 XM_496328 XM_496335 XM_496348 XM_496351 XM_496388 XM_496390 XM_496391 XM_496394 XM_496399 XM_496436 XM_496467 XM_496547 XM_496579 XM_496608 XM_496637 XM_496654 XM_496682 XM_496690 XM_496692 XM_496701 XM_496704 XM_496705 XM_496724 XM_496746 XM_496836 XM_496892 XM_496894 XM_496895 XM_496898 XM_496899 XM_496904 XM_496905 XM_496907 XM_496912 XM_496931 XM_496943 XM_496945 XM_496946 XM_496947 XM_496948 XM_496949 XM_496951 XM_496952 XM_496953 XM_496954 XM_496955 XM_496956 XM_496957 XM_496960 XM_496961 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497002 XM_497014 XM_497036 XM_497080 XM_497098 XM_498422 XM_498427 XM_498429 XM_498436 XM_498437 XM_498438 XM_498440 XM_498442 XM_498449 XM_498451 XM_498452 XM_498454 XM_498460 XM_498463 XM_498464 XM_498466 XM_498478 XM_498488 XM_498490 XM_498497 XM_498512 XM_498513 XM_498515 XM_498532 XM_498534 XM_498540 XM_498545 XM_498552 XM_498553 XM_498555 XM_498563 XM_498567 XM_498569 XM_498572 XM_498582 XM_498608 XM_498611 XM_498614 XM_498620 XM_498624 XM_498629 XM_498647 XM_498649 XM_498659 XM_498660 XM_498662 XM_498681 XM_498683 XM_498693 XM_498717 XM_498724 XM_498739 XM_498751 XM_498758 XM_498760 XM_498761 XM_498767 XM_498770 XM_498772 XM_498773 XM_498774 XM_498777 XM_498778 XM_498779 XM_498780 XM_498781 XM_498782 XM_498783 XM_498784 XM_498785 XM_498786 XM_498789 XM_498801 XM_498802 XM_498804 XM_498824 XM_498829 XM_498835 XM_498841 XM_498900 XM_498901 XM_498902 XM_498906 XM_498907 XM_498910 XM_498922 XM_498924 XM_498925 XM_498945 XM_498954 XM_498958 XM_498992 XM_498998 XM_499005 XM_499028 XM_499046 XM_499047 XM_499051 XM_499065 XM_499092 XM_499101 XM_499105 XM_499107 XM_499119 XM_499123 XM_499125 XM_499142 XM_499147 XM_499151 XM_499160 XM_499161 XM_499171 XM_499173 XM_499182 XM_499188 XM_499260 XM_499301 XM_499309 XM_499314 XM_499317 XM_499321 XM_499323 XM_499328 XM_499330 XM_499333 XM_499336 XM_499338 XM_499343 XM_499348 XM_499351 XM_499354 XM_499356 XM_499385 XM_499495 XM_499501 XM_499515 XM_499550 XM_499558 XM_499566 XM_499568 XM_499570 XM_499572 XM_499579 XM_499581 XM_499583 XM_499590 XM_499593 XM_499594 XM_499596 XR_000167 XR_000182 XR_000190 XR_000192 XR_000194 XR_000216 XR_000227 XR_000254 XR_000261 XR_000266 XR_000272 XR_000292
Genes with multiple seed matches:
NM_000021 NM_000109 NM_000125 NM_000150 NM_000161 NM_000176 NM_000222 NM_000230 NM_000232 NM_000278 NM_000299 NM_000321 NM_000348 NM_000368 NM_000369 NM_000406 NM_000409 NM_000418 NM_000457 NM_000498 NM_000529 NM_000533 NM_000572 NM_000599 NM_000609 NM_000610 NM_000611 NM_000629 NM_000634 NM_000664 NM_000689 NM_000702 NM_000721 NM_000723 NM_000725 NM_000793 NM_000809 NM_000838 NM_000843 NM_000872 NM_000961 NM_000997 NM_001001188 NM_001001323 NM_001001343 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001418 NM_001001434 NM_001001484 NM_001001671 NM_001001694 NM_001001704 NM_001001711 NM_001001732 NM_001001873 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001936 NM_001001974 NM_001002257 NM_001002260 NM_001003407 NM_001003408 NM_001003665 NM_001003698 NM_001003699 NM_001003796 NM_001003800 NM_001003940 NM_001003942 NM_001003943 NM_001004127 NM_001004302 NM_001004317 NM_001004335 NM_001005337 NM_001005386 NM_001005387 NM_001005414 NM_001005463 NM_001005502 NM_001005609 NM_001005753 NM_001006656 NM_001007023 NM_001007024 NM_001007025 NM_001007094 NM_001007097 NM_001007246 NM_001007258 NM_001007262 NM_001007466 NM_001007525 NM_001007553 NM_001007565 NM_001008239 NM_001008390 NM_001008409 NM_001008537 NM_001008657 NM_001008736 NM_001008781 NM_001008801 NM_001009186 NM_001009553 NM_001009567 NM_001009956 NM_001010853 NM_001010867 NM_001010888 NM_001010898 NM_001010913 NM_001010915 NM_001010980 NM_001011545 NM_001011666 NM_001011720 NM_001012270 NM_001012271 NM_001012329 NM_001012418 NM_001012420 NM_001012511 NM_001012651 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012763 NM_001013617 NM_001013624 NM_001013649 NM_001013669 NM_001013676 NM_001013681 NM_001013693 NM_001013710 NM_001013720 NM_001013726 NM_001013842 NM_001014374 NM_001014380 NM_001014450 NM_001014797 NM_001017369 NM_001017370 NM_001017418 NM_001017915 NM_001017995 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018097 NM_001023560 NM_001023565 NM_001023566 NM_001024024 NM_001024070 NM_001024094 NM_001024209 NM_001024592 NM_001024654 NM_001024808 NM_001024843 NM_001024912 NM_001024937 NM_001024959 NM_001024960 NM_001025076 NM_001025077 NM_001025080 NM_001025081 NM_001025090 NM_001025091 NM_001025092 NM_001025094 NM_001025098 NM_001025100 NM_001025101 NM_001025107 NM_001025108 NM_001025266 NM_001050 NM_001083 NM_001090 NM_001092 NM_001111 NM_001119 NM_001128 NM_001131 NM_001168 NM_001183 NM_001224 NM_001259 NM_001286 NM_001304 NM_001310 NM_001337 NM_001399 NM_001419 NM_001420 NM_001430 NM_001432 NM_001543 NM_001558 NM_001619 NM_001631 NM_001682 NM_001684 NM_001696 NM_001712 NM_001755 NM_001762 NM_001797 NM_001858 NM_001874 NM_001978 NM_001993 NM_002006 NM_002025 NM_002026 NM_002030 NM_002129 NM_002199 NM_002230 NM_002235 NM_002241 NM_002253 NM_002269 NM_002285 NM_002313 NM_002385 NM_002399 NM_002417 NM_002438 NM_002468 NM_002481 NM_002500 NM_002541 NM_002547 NM_002604 NM_002622 NM_002648 NM_002655 NM_002718 NM_002758 NM_002813 NM_002826 NM_002829 NM_002857 NM_002868 NM_002869 NM_002880 NM_002881 NM_002886 NM_002911 NM_002918 NM_002955 NM_002957 NM_002959 NM_002985 NM_003023 NM_003076 NM_003079 NM_003156 NM_003178 NM_003190 NM_003204 NM_003262 NM_003281 NM_003320 NM_003388 NM_003392 NM_003411 NM_003417 NM_003421 NM_003438 NM_003439 NM_003462 NM_003472 NM_003502 NM_003574 NM_003605 NM_003609 NM_003622 NM_003663 NM_003670 NM_003679 NM_003681 NM_003719 NM_003722 NM_003827 NM_003840 NM_003851 NM_003926 NM_003939 NM_003949 NM_003953 NM_003955 NM_003958 NM_003985 NM_003987 NM_003988 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004020 NM_004021 NM_004022 NM_004023 NM_004096 NM_004109 NM_004117 NM_004154 NM_004167 NM_004171 NM_004185 NM_004227 NM_004229 NM_004273 NM_004274 NM_004278 NM_004311 NM_004321 NM_004329 NM_004339 NM_004376 NM_004437 NM_004438 NM_004464 NM_004482 NM_004518 NM_004554 NM_004586 NM_004728 NM_004738 NM_004745 NM_004752 NM_004759 NM_004762 NM_004781 NM_004788 NM_004797 NM_004798 NM_004824 NM_004845 NM_004848 NM_004871 NM_004904 NM_004914 NM_004922 NM_004926 NM_004992 NM_005008 NM_005036 NM_005063 NM_005065 NM_005069 NM_005082 NM_005093 NM_005105 NM_005188 NM_005197 NM_005207 NM_005219 NM_005233 NM_005253 NM_005276 NM_005407 NM_005415 NM_005434 NM_005436 NM_005437 NM_005458 NM_005504 NM_005506 NM_005518 NM_005541 NM_005546 NM_005578 NM_005604 NM_005631 NM_005658 NM_005687 NM_005718 NM_005722 NM_005730 NM_005779 NM_005785 NM_005813 NM_005860 NM_005894 NM_005898 NM_005920 NM_005937 NM_005988 NM_006034 NM_006037 NM_006040 NM_006041 NM_006055 NM_006070 NM_006092 NM_006134 NM_006141 NM_006184 NM_006212 NM_006224 NM_006238 NM_006251 NM_006276 NM_006282 NM_006298 NM_006306 NM_006315 NM_006378 NM_006393 NM_006413 NM_006454 NM_006464 NM_006465 NM_006496 NM_006504 NM_006549 NM_006555 NM_006561 NM_006591 NM_006665 NM_006684 NM_006707 NM_006720 NM_006731 NM_006738 NM_006742 NM_006745 NM_006773 NM_006777 NM_006869 NM_006945 NM_006955 NM_007030 NM_007040 NM_007042 NM_007050 NM_007085 NM_007136 NM_007151 NM_007158 NM_007176 NM_007177 NM_007198 NM_007200 NM_007249 NM_007306 NM_007318 NM_007332 NM_012062 NM_012072 NM_012074 NM_012098 NM_012102 NM_012153 NM_012180 NM_012199 NM_012218 NM_012219 NM_012224 NM_012244 NM_012281 NM_012288 NM_012300 NM_012301 NM_012304 NM_012306 NM_012318 NM_012327 NM_012334 NM_012388 NM_012395 NM_012464 NM_012465 NM_012478 NM_013255 NM_013261 NM_013279 NM_013313 NM_013322 NM_013325 NM_013382 NM_013385 NM_013390 NM_013433 NM_013447 NM_013449 NM_013989 NM_014023 NM_014030 NM_014189 NM_014190 NM_014231 NM_014240 NM_014256 NM_014289 NM_014293 NM_014358 NM_014369 NM_014388 NM_014394 NM_014400 NM_014431 NM_014506 NM_014517 NM_014553 NM_014556 NM_014569 NM_014586 NM_014607 NM_014615 NM_014616 NM_014629 NM_014646 NM_014653 NM_014661 NM_014663 NM_014674 NM_014721 NM_014723 NM_014730 NM_014734 NM_014743 NM_014746 NM_014751 NM_014755 NM_014758 NM_014765 NM_014766 NM_014771 NM_014772 NM_014795 NM_014801 NM_014810 NM_014824 NM_014835 NM_014844 NM_014854 NM_014864 NM_014867 NM_014904 NM_014905 NM_014906 NM_014909 NM_014912 NM_014919 NM_014924 NM_014959 NM_014965 NM_014994 NM_015035 NM_015039 NM_015064 NM_015071 NM_015077 NM_015088 NM_015093 NM_015101 NM_015141 NM_015149 NM_015191 NM_015199 NM_015200 NM_015202 NM_015205 NM_015253 NM_015254 NM_015259 NM_015271 NM_015282 NM_015288 NM_015299 NM_015310 NM_015327 NM_015329 NM_015335 NM_015393 NM_015411 NM_015428 NM_015455 NM_015553 NM_015569 NM_015570 NM_015608 NM_015621 NM_015651 NM_015690 NM_015691 NM_015695 NM_015716 NM_015717 NM_015833 NM_015840 NM_015841 NM_015886 NM_016079 NM_016096 NM_016114 NM_016115 NM_016156 NM_016169 NM_016221 NM_016263 NM_016272 NM_016275 NM_016339 NM_016359 NM_016436 NM_016458 NM_016525 NM_016526 NM_016544 NM_016562 NM_016607 NM_016827 NM_016828 NM_016829 NM_016929 NM_016937 NM_017438 NM_017451 NM_017456 NM_017554 NM_017586 NM_017590 NM_017628 NM_017668 NM_017670 NM_017705 NM_017709 NM_017744 NM_017760 NM_017769 NM_017770 NM_017785 NM_017801 NM_017891 NM_017952 NM_017958 NM_017967 NM_017968 NM_017990 NM_017998 NM_018019 NM_018036 NM_018045 NM_018069 NM_018073 NM_018074 NM_018108 NM_018172 NM_018194 NM_018200 NM_018205 NM_018210 NM_018211 NM_018215 NM_018239 NM_018243 NM_018246 NM_018257 NM_018267 NM_018277 NM_018295 NM_018346 NM_018362 NM_018382 NM_018383 NM_018423 NM_018444 NM_018450 NM_018454 NM_018509 NM_018566 NM_018579 NM_018659 NM_018667 NM_018683 NM_018697 NM_018698 NM_018706 NM_018715 NM_018718 NM_018841 NM_018941 NM_018999 NM_019001 NM_019009 NM_019859 NM_019860 NM_020038 NM_020119 NM_020133 NM_020134 NM_020148 NM_020149 NM_020152 NM_020168 NM_020170 NM_020182 NM_020200 NM_020215 NM_020245 NM_020248 NM_020338 NM_020362 NM_020367 NM_020429 NM_020431 NM_020433 NM_020439 NM_020440 NM_020443 NM_020638 NM_020689 NM_020739 NM_020781 NM_020813 NM_020820 NM_020825 NM_020831 NM_020839 NM_020853 NM_020880 NM_020888 NM_020899 NM_020918 NM_020919 NM_020947 NM_020956 NM_020970 NM_020974 NM_020980 NM_020993 NM_021100 NM_021116 NM_021156 NM_021168 NM_021188 NM_021189 NM_021200 NM_021235 NM_021257 NM_021612 NM_021615 NM_021622 NM_021624 NM_021638 NM_021648 NM_021735 NM_021736 NM_021737 NM_021813 NM_021925 NM_021945 NM_021962 NM_021966 NM_021991 NM_022062 NM_022081 NM_022131 NM_022451 NM_022452 NM_022459 NM_022473 NM_022492 NM_022739 NM_022756 NM_022817 NM_022824 NM_022845 NM_022912 NM_023005 NM_023018 NM_023112 NM_024046 NM_024072 NM_024102 NM_024298 NM_024325 NM_024329 NM_024494 NM_024511 NM_024557 NM_024569 NM_024591 NM_024629 NM_024643 NM_024709 NM_024738 NM_024754 NM_024761 NM_024782 NM_024807 NM_024859 NM_024878 NM_024881 NM_024882 NM_024922 NM_024923 NM_024933 NM_024938 NM_024953 NM_025026 NM_025083 NM_025126 NM_025137 NM_025160 NM_025182 NM_025195 NM_025218 NM_025224 NM_025235 NM_025239 NM_030623 NM_030626 NM_030650 NM_030664 NM_030670 NM_030671 NM_030800 NM_030918 NM_030964 NM_031296 NM_031426 NM_031437 NM_031449 NM_031462 NM_031924 NM_031961 NM_031962 NM_031988 NM_032028 NM_032039 NM_032044 NM_032105 NM_032116 NM_032121 NM_032124 NM_032144 NM_032178 NM_032182 NM_032189 NM_032233 NM_032272 NM_032281 NM_032296 NM_032303 NM_032311 NM_032329 NM_032369 NM_032408 NM_032421 NM_032433 NM_032435 NM_032508 NM_032529 NM_032538 NM_032550 NM_032578 NM_032587 NM_032632 NM_032682 NM_032689 NM_032709 NM_032728 NM_032737 NM_032801 NM_032809 NM_032826 NM_032832 NM_032846 NM_032876 NM_032882 NM_032886 NM_032900 NM_032916 NM_032932 NM_032958 NM_032959 NM_032960 NM_032964 NM_032982 NM_032983 NM_032984 NM_033035 NM_033083 NM_033086 NM_033133 NM_033141 NM_033143 NM_033191 NM_033224 NM_033238 NM_033262 NM_033274 NM_033315 NM_033318 NM_033332 NM_033364 NM_033389 NM_033392 NM_033397 NM_033426 NM_033430 NM_033437 NM_033495 NM_033503 NM_033510 NM_033637 NM_033644 NM_033645 NM_052818 NM_052822 NM_052880 NM_052910 NM_052934 NM_052966 NM_053044 NM_053056 NM_058175 NM_058178 NM_058240 NM_078470 NM_078476 NM_080473 NM_080551 NM_080593 NM_080628 NM_080836 NM_080867 NM_130435 NM_133170 NM_133171 NM_133332 NM_133333 NM_133334 NM_133367 NM_133443 NM_133445 NM_133463 NM_133646 NM_138294 NM_138298 NM_138473 NM_138551 NM_138574 NM_138624 NM_138625 NM_138640 NM_138694 NM_138727 NM_138728 NM_138958 NM_139028 NM_139071 NM_139125 NM_139162 NM_139177 NM_139245 NM_139248 NM_139275 NM_139278 NM_144498 NM_144499 NM_144570 NM_144579 NM_144582 NM_144599 NM_144623 NM_144628 NM_144677 NM_144692 NM_144732 NM_144733 NM_144734 NM_144767 NM_144984 NM_145055 NM_145102 NM_145115 NM_145117 NM_145212 NM_145245 NM_145284 NM_145308 NM_145323 NM_145324 NM_145342 NM_145349 NM_145351 NM_145646 NM_145808 NM_145863 NM_147180 NM_147195 NM_147196 NM_148171 NM_148886 NM_148903 NM_152225 NM_152235 NM_152253 NM_152257 NM_152335 NM_152355 NM_152395 NM_152436 NM_152488 NM_152519 NM_152520 NM_152563 NM_152583 NM_152624 NM_152641 NM_152736 NM_152738 NM_152780 NM_152793 NM_152840 NM_152841 NM_152842 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_153029 NM_153035 NM_153207 NM_153239 NM_153343 NM_153347 NM_153350 NM_153456 NM_153499 NM_153500 NM_153607 NM_153611 NM_153619 NM_153646 NM_153647 NM_153648 NM_153686 NM_153708 NM_153717 NM_153810 NM_153827 NM_153832 NM_170609 NM_170663 NM_170674 NM_170675 NM_170676 NM_170677 NM_170686 NM_170706 NM_170743 NM_170751 NM_170752 NM_170773 NM_172127 NM_172216 NM_172226 NM_172236 NM_172239 NM_172315 NM_172316 NM_172346 NM_173064 NM_173065 NM_173354 NM_173462 NM_173522 NM_173555 NM_173625 NM_173651 NM_173677 NM_173689 NM_173793 NM_173832 NM_173859 NM_174921 NM_174929 NM_174934 NM_174977 NM_175056 NM_175709 NM_175733 NM_175736 NM_175864 NM_175873 NM_175876 NM_175898 NM_175908 NM_176084 NM_176085 NM_176095 NM_176677 NM_176787 NM_176801 NM_177532 NM_177947 NM_177948 NM_177972 NM_177977 NM_177978 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178122 NM_178136 NM_178229 NM_178326 NM_178505 NM_178509 NM_178514 NM_178818 NM_178842 NM_178849 NM_178858 NM_181050 NM_181349 NM_181351 NM_181489 NM_181504 NM_181523 NM_181524 NM_181712 NM_181825 NM_181826 NM_181827 NM_181834 NM_181846 NM_181897 NM_182507 NM_182508 NM_182509 NM_182517 NM_182551 NM_182558 NM_182568 NM_182579 NM_182584 NM_182637 NM_182665 NM_182686 NM_182728 NM_182740 NM_182764 NM_182898 NM_182899 NM_182932 NM_182933 NM_182936 NM_182964 NM_182970 NM_183002 NM_183059 NM_183075 NM_183078 NM_183238 NM_183382 NM_183425 NM_194271 NM_194286 NM_194295 NM_194299 NM_194352 NM_194358 NM_194359 NM_194434 NM_197975 NM_198086 NM_198098 NM_198138 NM_198213 NM_198320 NM_198327 NM_198328 NM_198392 NM_198462 NM_198483 NM_198484 NM_198513 NM_198545 NM_198569 NM_198595 NM_198597 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198841 NM_198851 NM_198859 NM_198896 NM_198900 NM_198955 NM_198989 NM_199050 NM_199131 NM_199132 NM_199169 NM_199170 NM_199171 NM_199245 NM_199280 NM_199331 NM_199332 NM_199421 NM_199461 NM_199478 NM_201278 NM_201281 NM_201431 NM_201550 NM_201994 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203329 NM_203330 NM_203331 NM_203342 NM_203343 NM_205833 NM_206907 NM_206909 NM_206914 NM_207043 NM_207044 NM_207047 NM_207119 NM_207318 NM_207333 NM_207368 NM_207383 NM_207404 NM_207430 NM_207442 NM_207460 NM_207470 NM_207483 NM_207486 NM_207488 NM_207495 NM_207497 NM_207506 NM_207577 NM_212467 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_213598 NM_213723 XM_031689 XM_032901 XM_032945 XM_034872 XM_037523 XM_038150 XM_038436 XM_039515 XM_039570 XM_039733 XM_042833 XM_042936 XM_043493 XM_046581 XM_051200 XM_051862 XM_056455 XM_059689 XM_066058 XM_084529 XM_085634 XM_087353 XM_171054 XM_208522 XM_208545 XM_209655 XM_209824 XM_290502 XM_294521 XM_295155 XM_370838 XM_370843 XM_370878 XM_371116 XM_371254 XM_371369 XM_371461 XM_371488 XM_371759 XM_371838 XM_372019 XM_372028 XM_372030 XM_372267 XM_373030 XM_373737 XM_373906 XM_374112 XM_374185 XM_374256 XM_374399 XM_375090 XM_375373 XM_375697 XM_376018 XM_376049 XM_376386 XM_376550 XM_376558 XM_376677 XM_376679 XM_376680 XM_376784 XM_378236 XM_378273 XM_378362 XM_378411 XM_378434 XM_378456 XM_378512 XM_378573 XM_378625 XM_378661 XM_378678 XM_378741 XM_378747 XM_378751 XM_378843 XM_378855 XM_378859 XM_378883 XM_378908 XM_378914 XM_379030 XM_379041 XM_379075 XM_379096 XM_379099 XM_379108 XM_379114 XM_379267 XM_379276 XM_379309 XM_379320 XM_379363 XM_379402 XM_379409 XM_379437 XM_379452 XM_379454 XM_379459 XM_379535 XM_379547 XM_379595 XM_379605 XM_379637 XM_379657 XM_379668 XM_379702 XM_379720 XM_379931 XM_379933 XM_379934 XM_380160 XM_495807 XM_495886 XM_495909 XM_496050 XM_496436 XM_496467 XM_496608 XM_496705 XM_496836 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497080 XM_498427 XM_498436 XM_498438 XM_498440 XM_498452 XM_498463 XM_498466 XM_498490 XM_498497 XM_498563 XM_498572 XM_498614 XM_498693 XM_498824 XM_498829 XM_498901 XM_498992 XM_499047 XM_499125 XM_499147 XM_499566 XM_499568 XM_499570 XM_499593 XM_499596 XR_000192 XR_000227 XR_000266
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)