VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"uuaauaguuaauagcguacuu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
709
.
Total Genes with multiple seed matches:
28
.
Genes with at least one seed match:
NM_000028 NM_000053 NM_000141 NM_000161 NM_000237 NM_000254 NM_000268 NM_000296 NM_000307 NM_000332 NM_000428 NM_000458 NM_000546 NM_000573 NM_000628 NM_000629 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000661 NM_000743 NM_000809 NM_000887 NM_000916 NM_000917 NM_000944 NM_001001560 NM_001001675 NM_001002857 NM_001002858 NM_001004305 NM_001004430 NM_001005217 NM_001005386 NM_001005388 NM_001005463 NM_001005609 NM_001005918 NM_001007254 NM_001007529 NM_001008388 NM_001008392 NM_001008744 NM_001009566 NM_001009944 NM_001010846 NM_001010853 NM_001010924 NM_001010925 NM_001010985 NM_001011537 NM_001011658 NM_001012329 NM_001012418 NM_001012426 NM_001012427 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001013438 NM_001013677 NM_001013693 NM_001013696 NM_001013697 NM_001013712 NM_001013738 NM_001013746 NM_001013842 NM_001015508 NM_001017440 NM_001017962 NM_001018064 NM_001018100 NM_001018101 NM_001023563 NM_001024921 NM_001025079 NM_001025080 NM_001068 NM_001071 NM_001076 NM_001105 NM_001167 NM_001174 NM_001230 NM_001246 NM_001249 NM_001257 NM_001310 NM_001332 NM_001384 NM_001399 NM_001440 NM_001449 NM_001490 NM_001616 NM_001695 NM_001759 NM_001763 NM_001767 NM_001777 NM_001837 NM_001957 NM_001964 NM_001999 NM_002015 NM_002065 NM_002074 NM_002131 NM_002207 NM_002209 NM_002229 NM_002314 NM_002395 NM_002416 NM_002451 NM_002462 NM_002463 NM_002505 NM_002563 NM_002584 NM_002588 NM_002596 NM_002633 NM_002705 NM_002719 NM_002748 NM_002827 NM_002845 NM_002874 NM_002893 NM_002898 NM_002945 NM_003044 NM_003110 NM_003155 NM_003167 NM_003189 NM_003190 NM_003234 NM_003269 NM_003320 NM_003388 NM_003458 NM_003479 NM_003502 NM_003507 NM_003597 NM_003605 NM_003615 NM_003644 NM_003714 NM_003724 NM_003735 NM_003736 NM_003774 NM_003826 NM_003842 NM_003860 NM_003895 NM_003909 NM_003996 NM_004039 NM_004101 NM_004105 NM_004109 NM_004112 NM_004308 NM_004350 NM_004386 NM_004441 NM_004531 NM_004569 NM_004586 NM_004614 NM_004657 NM_004660 NM_004700 NM_004703 NM_004717 NM_004725 NM_004738 NM_004764 NM_004798 NM_004817 NM_004859 NM_004906 NM_004914 NM_004932 NM_004937 NM_004974 NM_005027 NM_005056 NM_005088 NM_005098 NM_005116 NM_005160 NM_005207 NM_005416 NM_005417 NM_005433 NM_005436 NM_005470 NM_005480 NM_005494 NM_005519 NM_005528 NM_005566 NM_005604 NM_005722 NM_005808 NM_005920 NM_005986 NM_006023 NM_006056 NM_006074 NM_006135 NM_006136 NM_006145 NM_006180 NM_006190 NM_006208 NM_006241 NM_006364 NM_006380 NM_006387 NM_006435 NM_006493 NM_006627 NM_006661 NM_006710 NM_006731 NM_006751 NM_006803 NM_006913 NM_006916 NM_006981 NM_006984 NM_007038 NM_007174 NM_007348 NM_012075 NM_012095 NM_012156 NM_012170 NM_012173 NM_012234 NM_012458 NM_013231 NM_013365 NM_013423 NM_013427 NM_013943 NM_013945 NM_014021 NM_014048 NM_014160 NM_014242 NM_014246 NM_014421 NM_014563 NM_014598 NM_014604 NM_014665 NM_014682 NM_014723 NM_014755 NM_014809 NM_014850 NM_014851 NM_014890 NM_014924 NM_014944 NM_014974 NM_015025 NM_015026 NM_015050 NM_015055 NM_015056 NM_015075 NM_015090 NM_015100 NM_015116 NM_015192 NM_015205 NM_015245 NM_015251 NM_015266 NM_015271 NM_015338 NM_015367 NM_015381 NM_015423 NM_015560 NM_015568 NM_015900 NM_015946 NM_016019 NM_016098 NM_016147 NM_016162 NM_016169 NM_016220 NM_016322 NM_016410 NM_016418 NM_016544 NM_016603 NM_016604 NM_016735 NM_017420 NM_017549 NM_017583 NM_017635 NM_017637 NM_017668 NM_017694 NM_017763 NM_017887 NM_018018 NM_018024 NM_018044 NM_018056 NM_018063 NM_018084 NM_018199 NM_018222 NM_018233 NM_018242 NM_018254 NM_018319 NM_018320 NM_018374 NM_018383 NM_018388 NM_018424 NM_018430 NM_018444 NM_018555 NM_018644 NM_018689 NM_018710 NM_018894 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018977 NM_019022 NM_019055 NM_019067 NM_019079 NM_019111 NM_019117 NM_020066 NM_020123 NM_020133 NM_020148 NM_020165 NM_020193 NM_020197 NM_020248 NM_020315 NM_020335 NM_020337 NM_020438 NM_020552 NM_020553 NM_020647 NM_020657 NM_020663 NM_020701 NM_020727 NM_020771 NM_020777 NM_020807 NM_020825 NM_020919 NM_020927 NM_020933 NM_020962 NM_021013 NM_021034 NM_021044 NM_021637 NM_021705 NM_021807 NM_021813 NM_021814 NM_021943 NM_021947 NM_022042 NM_022063 NM_022450 NM_022466 NM_022474 NM_022843 NM_022969 NM_022970 NM_022972 NM_022975 NM_023038 NM_023079 NM_023926 NM_024420 NM_024563 NM_024612 NM_024653 NM_024749 NM_024780 NM_024831 NM_024834 NM_024920 NM_024929 NM_024939 NM_024941 NM_025141 NM_025195 NM_030626 NM_030661 NM_030802 NM_030814 NM_031418 NM_031427 NM_031431 NM_031468 NM_031887 NM_031888 NM_031913 NM_032088 NM_032092 NM_032151 NM_032158 NM_032189 NM_032288 NM_032357 NM_032373 NM_032377 NM_032403 NM_032420 NM_032421 NM_032837 NM_032853 NM_032854 NM_032874 NM_032885 NM_032968 NM_032969 NM_032973 NM_032976 NM_032977 NM_033034 NM_033045 NM_033106 NM_033224 NM_033259 NM_033267 NM_033315 NM_033397 NM_033426 NM_033446 NM_033505 NM_052932 NM_058169 NM_058217 NM_058238 NM_078474 NM_080551 NM_080605 NM_080627 NM_080836 NM_080867 NM_130760 NM_130761 NM_130762 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_133334 NM_133466 NM_133510 NM_138390 NM_138444 NM_138457 NM_138693 NM_138726 NM_138969 NM_139015 NM_139283 NM_144621 NM_144632 NM_144691 NM_144718 NM_145117 NM_145645 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145911 NM_147128 NM_147187 NM_148936 NM_148956 NM_148980 NM_149379 NM_152305 NM_152429 NM_152551 NM_152629 NM_152641 NM_152655 NM_152789 NM_152793 NM_153010 NM_153256 NM_153381 NM_153631 NM_153632 NM_172163 NM_172240 NM_173055 NM_173056 NM_173057 NM_173058 NM_173198 NM_173200 NM_173536 NM_173579 NM_173582 NM_173602 NM_173633 NM_173639 NM_173644 NM_173664 NM_174878 NM_174978 NM_175736 NM_175878 NM_176806 NM_176811 NM_176815 NM_176823 NM_177972 NM_177996 NM_178033 NM_178329 NM_178456 NM_178520 NM_178583 NM_178586 NM_178818 NM_178842 NM_181050 NM_181359 NM_181672 NM_181673 NM_181701 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_182501 NM_182734 NM_182755 NM_182760 NM_182848 NM_182964 NM_183050 NM_183418 NM_183420 NM_183421 NM_194452 NM_194453 NM_198189 NM_198287 NM_198291 NM_198401 NM_198537 NM_198793 NM_198849 NM_198900 NM_198992 NM_199000 NM_199126 NM_199133 NM_199229 NM_199421 NM_199511 NM_199512 NM_201399 NM_201432 NM_201433 NM_201629 NM_203327 NM_203364 NM_203381 NM_203446 NM_203468 NM_207012 NM_207171 NM_207325 NM_207348 NM_207359 NM_207400 NM_207419 NM_207432 NM_207461 NM_207469 NM_207577 NM_207646 NM_212502 NM_212503 NM_213604 NM_213612 NM_213613 XM_035601 XM_038150 XM_038436 XM_039393 XM_045421 XM_051017 XM_059954 XM_067585 XM_087672 XM_113641 XM_208990 XM_209913 XM_290615 XM_291095 XM_293828 XM_370665 XM_370758 XM_371488 XM_372039 XM_373498 XM_373539 XM_375185 XM_375491 XM_376148 XM_376269 XM_376303 XM_376305 XM_376680 XM_378340 XM_378356 XM_378367 XM_378558 XM_378735 XM_378843 XM_378848 XM_378859 XM_378861 XM_378981 XM_379075 XM_379123 XM_379206 XM_379391 XM_379459 XM_379510 XM_379927 XM_379934 XM_380131 XM_495814 XM_496156 XM_496637 XM_496907 XM_497056 XM_498488 XM_498557 XM_498631 XM_498825 XM_498905 XM_499009 XM_499164 XM_499182 XM_499343 XR_000192 XR_000266
Genes with multiple seed matches:
NM_000332 NM_001007254 NM_001012733 NM_001012734 NM_001695 NM_001759 NM_002015 NM_003479 NM_003644 NM_003860 NM_004660 NM_004717 NM_006803 NM_015568 NM_016019 NM_020133 NM_020193 NM_020927 NM_031887 NM_032973 NM_144718 NM_153381 NM_175878 NM_183050 NM_201432 NM_201433 NM_207461 XM_379123
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)