VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacaggcagcguggucauugu"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
5878
.
Total Genes with multiple seed matches:
1665
.
Genes with at least one seed match:
NM_000026 NM_000028 NM_000046 NM_000052 NM_000053 NM_000080 NM_000082 NM_000090 NM_000091 NM_000100 NM_000103 NM_000104 NM_000109 NM_000112 NM_000115 NM_000125 NM_000126 NM_000131 NM_000133 NM_000136 NM_000138 NM_000139 NM_000140 NM_000148 NM_000153 NM_000161 NM_000165 NM_000167 NM_000182 NM_000189 NM_000192 NM_000195 NM_000201 NM_000204 NM_000210 NM_000219 NM_000221 NM_000222 NM_000232 NM_000233 NM_000235 NM_000237 NM_000240 NM_000242 NM_000245 NM_000248 NM_000264 NM_000268 NM_000269 NM_000274 NM_000282 NM_000299 NM_000313 NM_000317 NM_000318 NM_000321 NM_000330 NM_000332 NM_000337 NM_000344 NM_000345 NM_000351 NM_000353 NM_000369 NM_000373 NM_000382 NM_000389 NM_000391 NM_000401 NM_000409 NM_000410 NM_000411 NM_000415 NM_000418 NM_000428 NM_000436 NM_000437 NM_000439 NM_000441 NM_000447 NM_000450 NM_000452 NM_000459 NM_000462 NM_000463 NM_000465 NM_000474 NM_000484 NM_000486 NM_000495 NM_000503 NM_000511 NM_000512 NM_000518 NM_000538 NM_000550 NM_000551 NM_000555 NM_000561 NM_000565 NM_000569 NM_000570 NM_000574 NM_000576 NM_000578 NM_000584 NM_000585 NM_000594 NM_000602 NM_000605 NM_000609 NM_000610 NM_000611 NM_000615 NM_000617 NM_000620 NM_000621 NM_000623 NM_000629 NM_000633 NM_000637 NM_000639 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000660 NM_000661 NM_000663 NM_000664 NM_000668 NM_000671 NM_000676 NM_000677 NM_000681 NM_000686 NM_000692 NM_000696 NM_000702 NM_000706 NM_000723 NM_000728 NM_000729 NM_000743 NM_000780 NM_000785 NM_000788 NM_000791 NM_000793 NM_000799 NM_000800 NM_000806 NM_000809 NM_000817 NM_000824 NM_000828 NM_000834 NM_000837 NM_000838 NM_000843 NM_000848 NM_000851 NM_000855 NM_000856 NM_000859 NM_000861 NM_000862 NM_000868 NM_000875 NM_000876 NM_000879 NM_000883 NM_000896 NM_000899 NM_000902 NM_000903 NM_000905 NM_000918 NM_000919 NM_000922 NM_000924 NM_000935 NM_000945 NM_000950 NM_000953 NM_000959 NM_000960 NM_000961 NM_000963 NM_000997 NM_001001188 NM_001001323 NM_001001330 NM_001001344 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001394 NM_001001395 NM_001001396 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001484 NM_001001523 NM_001001551 NM_001001552 NM_001001557 NM_001001560 NM_001001664 NM_001001677 NM_001001684 NM_001001685 NM_001001686 NM_001001688 NM_001001691 NM_001001696 NM_001001702 NM_001001707 NM_001001709 NM_001001711 NM_001001716 NM_001001723 NM_001001732 NM_001001788 NM_001001789 NM_001001873 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001935 NM_001001936 NM_001001937 NM_001001938 NM_001001971 NM_001001974 NM_001001991 NM_001001995 NM_001002000 NM_001002001 NM_001002002 NM_001002006 NM_001002014 NM_001002015 NM_001002231 NM_001002232 NM_001002233 NM_001002243 NM_001002257 NM_001002260 NM_001002269 NM_001002296 NM_001002760 NM_001002761 NM_001002762 NM_001002799 NM_001002811 NM_001002812 NM_001002814 NM_001002844 NM_001002860 NM_001002862 NM_001002926 NM_001003398 NM_001003407 NM_001003408 NM_001003652 NM_001003656 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003681 NM_001003686 NM_001003687 NM_001003689 NM_001003690 NM_001003712 NM_001003715 NM_001003716 NM_001003792 NM_001003793 NM_001003796 NM_001003800 NM_001003810 NM_001003897 NM_001003954 NM_001004053 NM_001004054 NM_001004197 NM_001004299 NM_001004301 NM_001004305 NM_001004306 NM_001004308 NM_001004309 NM_001004328 NM_001004331 NM_001004332 NM_001004339 NM_001004346 NM_001004347 NM_001004348 NM_001004349 NM_001004360 NM_001004707 NM_001005158 NM_001005159 NM_001005266 NM_001005267 NM_001005268 NM_001005269 NM_001005337 NM_001005339 NM_001005356 NM_001005357 NM_001005359 NM_001005364 NM_001005368 NM_001005387 NM_001005388 NM_001005404 NM_001005412 NM_001005413 NM_001005414 NM_001005463 NM_001005473 NM_001005474 NM_001005502 NM_001005505 NM_001005527 NM_001005609 NM_001005732 NM_001005733 NM_001005743 NM_001005744 NM_001005745 NM_001005753 NM_001005782 NM_001005845 NM_001005849 NM_001005918 NM_001006115 NM_001006116 NM_001006600 NM_001006612 NM_001006613 NM_001006614 NM_001006616 NM_001006623 NM_001006624 NM_001006625 NM_001006633 NM_001006657 NM_001006658 NM_001006684 NM_001006932 NM_001006947 NM_001007023 NM_001007024 NM_001007025 NM_001007072 NM_001007094 NM_001007097 NM_001007098 NM_001007102 NM_001007156 NM_001007176 NM_001007224 NM_001007233 NM_001007234 NM_001007237 NM_001007246 NM_001007247 NM_001007248 NM_001007254 NM_001007257 NM_001007258 NM_001007262 NM_001007267 NM_001007277 NM_001007278 NM_001007279 NM_001007464 NM_001007466 NM_001007529 NM_001007535 NM_001007538 NM_001007543 NM_001007565 NM_001007794 NM_001008211 NM_001008212 NM_001008213 NM_001008215 NM_001008220 NM_001008239 NM_001008390 NM_001008391 NM_001008392 NM_001008393 NM_001008397 NM_001008405 NM_001008408 NM_001008411 NM_001008491 NM_001008492 NM_001008493 NM_001008529 NM_001008536 NM_001008539 NM_001008563 NM_001008564 NM_001008566 NM_001008660 NM_001008693 NM_001008707 NM_001008710 NM_001008711 NM_001008723 NM_001008736 NM_001008737 NM_001008738 NM_001008783 NM_001008784 NM_001008801 NM_001008860 NM_001008892 NM_001008894 NM_001008910 NM_001008925 NM_001008938 NM_001009184 NM_001009185 NM_001009551 NM_001009554 NM_001009555 NM_001009571 NM_001009584 NM_001009610 NM_001009880 NM_001009909 NM_001009921 NM_001009922 NM_001009923 NM_001009924 NM_001009925 NM_001009937 NM_001009938 NM_001009939 NM_001009956 NM_001009959 NM_001009960 NM_001009997 NM_001010000 NM_001010846 NM_001010852 NM_001010853 NM_001010861 NM_001010862 NM_001010867 NM_001010883 NM_001010888 NM_001010891 NM_001010898 NM_001010909 NM_001010910 NM_001010915 NM_001010925 NM_001010934 NM_001010935 NM_001010980 NM_001011513 NM_001011514 NM_001011537 NM_001011545 NM_001011546 NM_001011552 NM_001011553 NM_001011656 NM_001011663 NM_001011664 NM_001011708 NM_001011709 NM_001011713 NM_001011720 NM_001012267 NM_001012270 NM_001012271 NM_001012278 NM_001012279 NM_001012339 NM_001012393 NM_001012418 NM_001012419 NM_001012420 NM_001012423 NM_001012424 NM_001012426 NM_001012427 NM_001012446 NM_001012452 NM_001012508 NM_001012514 NM_001012515 NM_001012516 NM_001012626 NM_001012642 NM_001012651 NM_001012709 NM_001012715 NM_001012729 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012756 NM_001012968 NM_001012977 NM_001012981 NM_001012988 NM_001012993 NM_001013000 NM_001013005 NM_001013031 NM_001013253 NM_001013254 NM_001013255 NM_001013399 NM_001013415 NM_001013615 NM_001013617 NM_001013627 NM_001013642 NM_001013648 NM_001013649 NM_001013659 NM_001013669 NM_001013670 NM_001013675 NM_001013679 NM_001013681 NM_001013682 NM_001013687 NM_001013693 NM_001013697 NM_001013704 NM_001013705 NM_001013713 NM_001013718 NM_001013719 NM_001013724 NM_001013727 NM_001013746 NM_001013839 NM_001013840 NM_001013842 NM_001013843 NM_001013848 NM_001014279 NM_001014283 NM_001014291 NM_001014342 NM_001014380 NM_001014797 NM_001014809 NM_001014839 NM_001014841 NM_001014977 NM_001015048 NM_001015049 NM_001015051 NM_001015877 NM_001015880 NM_001015882 NM_001015885 NM_001015886 NM_001015892 NM_001017368 NM_001017370 NM_001017371 NM_001017395 NM_001017408 NM_001017440 NM_001017916 NM_001017917 NM_001017918 NM_001017922 NM_001017924 NM_001017970 NM_001017972 NM_001017975 NM_001017979 NM_001017980 NM_001017989 NM_001017995 NM_001018021 NM_001018038 NM_001018053 NM_001018057 NM_001018058 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018081 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001018100 NM_001018101 NM_001018102 NM_001018109 NM_001018676 NM_001018677 NM_001023563 NM_001023565 NM_001023566 NM_001023587 NM_001024024 NM_001024070 NM_001024071 NM_001024216 NM_001024218 NM_001024372 NM_001024463 NM_001024465 NM_001024466 NM_001024593 NM_001024630 NM_001024649 NM_001024657 NM_001024688 NM_001024843 NM_001024847 NM_001024855 NM_001024858 NM_001024912 NM_001024916 NM_001024921 NM_001024933 NM_001024956 NM_001025 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025108 NM_001025201 NM_001025233 NM_001025247 NM_001025266 NM_001039 NM_001045 NM_001046 NM_001049 NM_001050 NM_001068 NM_001072 NM_001080 NM_001083 NM_001096 NM_001098 NM_001105 NM_001117 NM_001119 NM_001126 NM_001128 NM_001131 NM_001144 NM_001145 NM_001146 NM_001148 NM_001149 NM_001151 NM_001157 NM_001160 NM_001167 NM_001168 NM_001178 NM_001181 NM_001186 NM_001187 NM_001198 NM_001206 NM_001219 NM_001222 NM_001224 NM_001227 NM_001230 NM_001233 NM_001241 NM_001253 NM_001256 NM_001259 NM_001270 NM_001271 NM_001286 NM_001290 NM_001296 NM_001303 NM_001304 NM_001313 NM_001326 NM_001327 NM_001329 NM_001331 NM_001333 NM_001334 NM_001337 NM_001343 NM_001347 NM_001349 NM_001356 NM_001357 NM_001363 NM_001380 NM_001382 NM_001383 NM_001385 NM_001386 NM_001387 NM_001390 NM_001391 NM_001399 NM_001401 NM_001412 NM_001419 NM_001421 NM_001422 NM_001423 NM_001426 NM_001427 NM_001428 NM_001431 NM_001432 NM_001433 NM_001438 NM_001447 NM_001454 NM_001455 NM_001460 NM_001461 NM_001465 NM_001468 NM_001481 NM_001490 NM_001493 NM_001511 NM_001516 NM_001532 NM_001537 NM_001542 NM_001554 NM_001560 NM_001584 NM_001608 NM_001609 NM_001614 NM_001616 NM_001620 NM_001624 NM_001634 NM_001635 NM_001668 NM_001671 NM_001674 NM_001682 NM_001684 NM_001688 NM_001690 NM_001695 NM_001699 NM_001701 NM_001704 NM_001709 NM_001712 NM_001714 NM_001718 NM_001719 NM_001721 NM_001723 NM_001725 NM_001732 NM_001733 NM_001736 NM_001743 NM_001744 NM_001746 NM_001754 NM_001755 NM_001756 NM_001759 NM_001763 NM_001777 NM_001788 NM_001789 NM_001791 NM_001802 NM_001816 NM_001817 NM_001819 NM_001821 NM_001822 NM_001829 NM_001830 NM_001833 NM_001845 NM_001858 NM_001860 NM_001863 NM_001872 NM_001874 NM_001875 NM_001877 NM_001880 NM_001884 NM_001902 NM_001903 NM_001905 NM_001912 NM_001915 NM_001918 NM_001920 NM_001923 NM_001928 NM_001931 NM_001933 NM_001934 NM_001938 NM_001942 NM_001948 NM_001952 NM_001963 NM_001966 NM_001967 NM_001969 NM_001975 NM_001986 NM_001991 NM_001995 NM_002000 NM_002006 NM_002009 NM_002015 NM_002025 NM_002026 NM_002027 NM_002033 NM_002039 NM_002040 NM_002043 NM_002048 NM_002060 NM_002061 NM_002063 NM_002065 NM_002071 NM_002074 NM_002076 NM_002078 NM_002080 NM_002090 NM_002092 NM_002099 NM_002111 NM_002119 NM_002131 NM_002138 NM_002156 NM_002158 NM_002160 NM_002164 NM_002170 NM_002172 NM_002173 NM_002177 NM_002182 NM_002187 NM_002188 NM_002193 NM_002198 NM_002202 NM_002207 NM_002210 NM_002243 NM_002252 NM_002254 NM_002259 NM_002260 NM_002262 NM_002264 NM_002265 NM_002267 NM_002268 NM_002269 NM_002271 NM_002284 NM_002285 NM_002296 NM_002301 NM_002302 NM_002304 NM_002312 NM_002313 NM_002339 NM_002340 NM_002357 NM_002358 NM_002359 NM_002367 NM_002372 NM_002373 NM_002380 NM_002388 NM_002389 NM_002396 NM_002397 NM_002398 NM_002399 NM_002402 NM_002417 NM_002423 NM_002424 NM_002451 NM_002460 NM_002463 NM_002467 NM_002468 NM_002474 NM_002480 NM_002481 NM_002484 NM_002485 NM_002499 NM_002501 NM_002503 NM_002505 NM_002514 NM_002515 NM_002518 NM_002519 NM_002522 NM_002535 NM_002540 NM_002545 NM_002547 NM_002556 NM_002570 NM_002572 NM_002576 NM_002577 NM_002579 NM_002582 NM_002588 NM_002595 NM_002609 NM_002610 NM_002612 NM_002613 NM_002628 NM_002641 NM_002642 NM_002647 NM_002655 NM_002657 NM_002661 NM_002662 NM_002666 NM_002677 NM_002688 NM_002705 NM_002709 NM_002710 NM_002711 NM_002715 NM_002716 NM_002718 NM_002719 NM_002721 NM_002731 NM_002734 NM_002736 NM_002737 NM_002738 NM_002740 NM_002742 NM_002750 NM_002754 NM_002758 NM_002760 NM_002765 NM_002768 NM_002772 NM_002785 NM_002797 NM_002816 NM_002820 NM_002827 NM_002834 NM_002838 NM_002840 NM_002847 NM_002849 NM_002852 NM_002858 NM_002862 NM_002867 NM_002869 NM_002871 NM_002874 NM_002875 NM_002879 NM_002881 NM_002884 NM_002886 NM_002896 NM_002906 NM_002911 NM_002915 NM_002920 NM_002922 NM_002925 NM_002928 NM_002938 NM_002941 NM_002942 NM_002959 NM_002971 NM_002986 NM_002994 NM_002995 NM_002996 NM_002998 NM_003001 NM_003003 NM_003011 NM_003012 NM_003022 NM_003023 NM_003024 NM_003027 NM_003032 NM_003035 NM_003038 NM_003042 NM_003046 NM_003051 NM_003053 NM_003059 NM_003060 NM_003063 NM_003071 NM_003074 NM_003076 NM_003092 NM_003094 NM_003104 NM_003108 NM_003111 NM_003112 NM_003115 NM_003124 NM_003130 NM_003131 NM_003137 NM_003144 NM_003147 NM_003156 NM_003161 NM_003167 NM_003169 NM_003176 NM_003178 NM_003182 NM_003187 NM_003188 NM_003189 NM_003203 NM_003204 NM_003211 NM_003216 NM_003217 NM_003218 NM_003227 NM_003239 NM_003240 NM_003242 NM_003246 NM_003247 NM_003249 NM_003262 NM_003269 NM_003274 NM_003281 NM_003296 NM_003304 NM_003307 NM_003309 NM_003322 NM_003326 NM_003328 NM_003333 NM_003337 NM_003338 NM_003340 NM_003342 NM_003345 NM_003348 NM_003349 NM_003352 NM_003355 NM_003360 NM_003364 NM_003369 NM_003382 NM_003384 NM_003390 NM_003392 NM_003404 NM_003406 NM_003409 NM_003417 NM_003419 NM_003421 NM_003428 NM_003435 NM_003438 NM_003439 NM_003442 NM_003444 NM_003446 NM_003449 NM_003452 NM_003454 NM_003457 NM_003458 NM_003463 NM_003471 NM_003478 NM_003480 NM_003483 NM_003484 NM_003486 NM_003488 NM_003528 NM_003531 NM_003557 NM_003558 NM_003559 NM_003562 NM_003574 NM_003580 NM_003586 NM_003590 NM_003591 NM_003594 NM_003595 NM_003596 NM_003597 NM_003602 NM_003604 NM_003605 NM_003610 NM_003615 NM_003617 NM_003618 NM_003620 NM_003622 NM_003626 NM_003629 NM_003643 NM_003644 NM_003648 NM_003661 NM_003662 NM_003663 NM_003664 NM_003671 NM_003676 NM_003681 NM_003691 NM_003714 NM_003719 NM_003722 NM_003724 NM_003729 NM_003735 NM_003736 NM_003743 NM_003744 NM_003749 NM_003750 NM_003756 NM_003757 NM_003759 NM_003763 NM_003772 NM_003774 NM_003778 NM_003783 NM_003784 NM_003787 NM_003789 NM_003794 NM_003799 NM_003811 NM_003816 NM_003822 NM_003834 NM_003839 NM_003842 NM_003848 NM_003850 NM_003851 NM_003855 NM_003856 NM_003857 NM_003858 NM_003870 NM_003872 NM_003873 NM_003887 NM_003889 NM_003895 NM_003898 NM_003899 NM_003901 NM_003902 NM_003908 NM_003909 NM_003913 NM_003916 NM_003918 NM_003924 NM_003926 NM_003929 NM_003930 NM_003932 NM_003946 NM_003950 NM_003955 NM_003958 NM_003979 NM_003994 NM_003998 NM_004004 NM_004006 NM_004007 NM_004009 NM_004010 NM_004011 NM_004012 NM_004013 NM_004014 NM_004015 NM_004016 NM_004017 NM_004018 NM_004019 NM_004020 NM_004021 NM_004022 NM_004023 NM_004024 NM_004037 NM_004040 NM_004046 NM_004054 NM_004060 NM_004064 NM_004066 NM_004067 NM_004075 NM_004077 NM_004079 NM_004080 NM_004101 NM_004105 NM_004112 NM_004114 NM_004124 NM_004133 NM_004137 NM_004142 NM_004155 NM_004161 NM_004162 NM_004169 NM_004170 NM_004171 NM_004175 NM_004177 NM_004197 NM_004204 NM_004220 NM_004229 NM_004231 NM_004232 NM_004253 NM_004261 NM_004272 NM_004274 NM_004277 NM_004290 NM_004293 NM_004294 NM_004296 NM_004302 NM_004306 NM_004311 NM_004315 NM_004319 NM_004324 NM_004330 NM_004337 NM_004338 NM_004342 NM_004348 NM_004350 NM_004352 NM_004360 NM_004362 NM_004379 NM_004380 NM_004385 NM_004386 NM_004391 NM_004394 NM_004397 NM_004398 NM_004404 NM_004405 NM_004407 NM_004411 NM_004417 NM_004423 NM_004430 NM_004434 NM_004437 NM_004441 NM_004442 NM_004444 NM_004454 NM_004457 NM_004458 NM_004464 NM_004469 NM_004480 NM_004481 NM_004482 NM_004488 NM_004492 NM_004496 NM_004501 NM_004504 NM_004505 NM_004507 NM_004520 NM_004539 NM_004549 NM_004560 NM_004566 NM_004570 NM_004571 NM_004575 NM_004582 NM_004584 NM_004586 NM_004598 NM_004599 NM_004600 NM_004602 NM_004610 NM_004612 NM_004618 NM_004619 NM_004621 NM_004622 NM_004627 NM_004629 NM_004650 NM_004653 NM_004655 NM_004657 NM_004660 NM_004666 NM_004670 NM_004678 NM_004681 NM_004686 NM_004687 NM_004694 NM_004696 NM_004697 NM_004701 NM_004707 NM_004710 NM_004713 NM_004717 NM_004718 NM_004724 NM_004725 NM_004727 NM_004735 NM_004736 NM_004741 NM_004742 NM_004744 NM_004745 NM_004755 NM_004757 NM_004758 NM_004768 NM_004772 NM_004775 NM_004781 NM_004786 NM_004792 NM_004795 NM_004797 NM_004801 NM_004811 NM_004815 NM_004818 NM_004827 NM_004830 NM_004834 NM_004838 NM_004840 NM_004842 NM_004845 NM_004846 NM_004849 NM_004862 NM_004863 NM_004865 NM_004866 NM_004871 NM_004872 NM_004873 NM_004879 NM_004887 NM_004891 NM_004894 NM_004896 NM_004898 NM_004906 NM_004914 NM_004921 NM_004922 NM_004930 NM_004931 NM_004932 NM_004936 NM_004938 NM_004949 NM_004951 NM_004956 NM_004962 NM_004975 NM_004982 NM_004985 NM_004992 NM_004999 NM_005006 NM_005008 NM_005010 NM_005014 NM_005025 NM_005026 NM_005036 NM_005041 NM_005042 NM_005044 NM_005045 NM_005047 NM_005053 NM_005057 NM_005060 NM_005065 NM_005076 NM_005080 NM_005082 NM_005094 NM_005100 NM_005103 NM_005105 NM_005109 NM_005110 NM_005111 NM_005112 NM_005114 NM_005116 NM_005121 NM_005133 NM_005134 NM_005137 NM_005139 NM_005147 NM_005149 NM_005151 NM_005153 NM_005155 NM_005156 NM_005159 NM_005160 NM_005165 NM_005168 NM_005180 NM_005188 NM_005190 NM_005191 NM_005197 NM_005201 NM_005206 NM_005207 NM_005219 NM_005228 NM_005233 NM_005239 NM_005243 NM_005252 NM_005254 NM_005256 NM_005259 NM_005296 NM_005316 NM_005324 NM_005329 NM_005333 NM_005334 NM_005335 NM_005338 NM_005342 NM_005370 NM_005373 NM_005385 NM_005387 NM_005388 NM_005398 NM_005399 NM_005400 NM_005407 NM_005409 NM_005431 NM_005433 NM_005434 NM_005436 NM_005437 NM_005446 NM_005455 NM_005463 NM_005467 NM_005471 NM_005477 NM_005487 NM_005491 NM_005494 NM_005495 NM_005500 NM_005502 NM_005509 NM_005513 NM_005517 NM_005520 NM_005523 NM_005530 NM_005531 NM_005536 NM_005537 NM_005539 NM_005544 NM_005545 NM_005551 NM_005554 NM_005558 NM_005559 NM_005561 NM_005578 NM_005588 NM_005593 NM_005595 NM_005600 NM_005614 NM_005623 NM_005627 NM_005638 NM_005642 NM_005647 NM_005648 NM_005651 NM_005658 NM_005663 NM_005665 NM_005668 NM_005678 NM_005682 NM_005687 NM_005711 NM_005715 NM_005717 NM_005721 NM_005724 NM_005737 NM_005741 NM_005748 NM_005752 NM_005754 NM_005766 NM_005772 NM_005776 NM_005780 NM_005788 NM_005789 NM_005791 NM_005792 NM_005798 NM_005802 NM_005808 NM_005813 NM_005817 NM_005822 NM_005828 NM_005835 NM_005839 NM_005840 NM_005841 NM_005843 NM_005845 NM_005857 NM_005863 NM_005865 NM_005871 NM_005898 NM_005899 NM_005901 NM_005902 NM_005903 NM_005904 NM_005906 NM_005914 NM_005920 NM_005926 NM_005927 NM_005931 NM_005932 NM_005933 NM_005935 NM_005964 NM_006007 NM_006011 NM_006013 NM_006016 NM_006020 NM_006022 NM_006025 NM_006029 NM_006030 NM_006033 NM_006037 NM_006043 NM_006045 NM_006047 NM_006055 NM_006056 NM_006057 NM_006062 NM_006063 NM_006070 NM_006085 NM_006089 NM_006090 NM_006092 NM_006094 NM_006107 NM_006113 NM_006117 NM_006122 NM_006129 NM_006134 NM_006135 NM_006136 NM_006141 NM_006145 NM_006153 NM_006154 NM_006155 NM_006162 NM_006165 NM_006166 NM_006178 NM_006180 NM_006188 NM_006201 NM_006203 NM_006206 NM_006208 NM_006211 NM_006212 NM_006224 NM_006237 NM_006238 NM_006239 NM_006242 NM_006243 NM_006246 NM_006251 NM_006256 NM_006267 NM_006275 NM_006276 NM_006277 NM_006282 NM_006283 NM_006288 NM_006291 NM_006298 NM_006306 NM_006307 NM_006315 NM_006317 NM_006322 NM_006323 NM_006325 NM_006329 NM_006330 NM_006336 NM_006352 NM_006358 NM_006359 NM_006364 NM_006366 NM_006373 NM_006379 NM_006380 NM_006384 NM_006387 NM_006390 NM_006393 NM_006403 NM_006407 NM_006418 NM_006420 NM_006432 NM_006435 NM_006446 NM_006452 NM_006454 NM_006457 NM_006459 NM_006464 NM_006465 NM_006466 NM_006474 NM_006477 NM_006479 NM_006486 NM_006488 NM_006489 NM_006491 NM_006493 NM_006501 NM_006505 NM_006508 NM_006510 NM_006513 NM_006517 NM_006520 NM_006528 NM_006534 NM_006541 NM_006544 NM_006546 NM_006549 NM_006561 NM_006566 NM_006571 NM_006572 NM_006581 NM_006582 NM_006583 NM_006587 NM_006588 NM_006591 NM_006595 NM_006599 NM_006604 NM_006605 NM_006606 NM_006611 NM_006614 NM_006620 NM_006624 NM_006625 NM_006626 NM_006628 NM_006636 NM_006650 NM_006667 NM_006674 NM_006676 NM_006698 NM_006699 NM_006710 NM_006711 NM_006720 NM_006722 NM_006729 NM_006731 NM_006738 NM_006746 NM_006748 NM_006749 NM_006751 NM_006765 NM_006766 NM_006770 NM_006774 NM_006775 NM_006777 NM_006783 NM_006784 NM_006785 NM_006786 NM_006788 NM_006793 NM_006796 NM_006805 NM_006807 NM_006814 NM_006815 NM_006818 NM_006823 NM_006826 NM_006832 NM_006834 NM_006843 NM_006844 NM_006847 NM_006852 NM_006856 NM_006867 NM_006868 NM_006870 NM_006873 NM_006874 NM_006877 NM_006887 NM_006888 NM_006899 NM_006902 NM_006905 NM_006915 NM_006918 NM_006924 NM_006925 NM_006930 NM_006931 NM_006937 NM_006938 NM_006940 NM_006941 NM_006947 NM_006955 NM_006961 NM_006965 NM_006969 NM_006973 NM_006974 NM_006994 NM_006999 NM_007005 NM_007006 NM_007008 NM_007010 NM_007013 NM_007017 NM_007023 NM_007038 NM_007042 NM_007048 NM_007050 NM_007057 NM_007066 NM_007069 NM_007070 NM_007073 NM_007078 NM_007085 NM_007096 NM_007106 NM_007107 NM_007115 NM_007118 NM_007120 NM_007123 NM_007130 NM_007137 NM_007146 NM_007157 NM_007159 NM_007166 NM_007171 NM_007173 NM_007174 NM_007175 NM_007177 NM_007178 NM_007200 NM_007212 NM_007214 NM_007216 NM_007231 NM_007236 NM_007249 NM_007257 NM_007266 NM_007282 NM_007287 NM_007288 NM_007289 NM_007306 NM_007308 NM_007321 NM_007325 NM_007328 NM_007331 NM_007332 NM_007334 NM_007335 NM_007336 NM_007338 NM_007345 NM_007350 NM_007351 NM_007363 NM_007372 NM_007375 NM_012062 NM_012072 NM_012073 NM_012074 NM_012080 NM_012089 NM_012090 NM_012093 NM_012095 NM_012104 NM_012112 NM_012120 NM_012129 NM_012141 NM_012142 NM_012145 NM_012153 NM_012154 NM_012171 NM_012174 NM_012177 NM_012180 NM_012197 NM_012199 NM_012206 NM_012218 NM_012223 NM_012224 NM_012228 NM_012229 NM_012231 NM_012232 NM_012243 NM_012247 NM_012252 NM_012262 NM_012278 NM_012279 NM_012281 NM_012287 NM_012288 NM_012289 NM_012290 NM_012300 NM_012304 NM_012309 NM_012318 NM_012325 NM_012326 NM_012327 NM_012329 NM_012334 NM_012341 NM_012345 NM_012347 NM_012382 NM_012388 NM_012393 NM_012395 NM_012397 NM_012399 NM_012405 NM_012406 NM_012408 NM_012409 NM_012411 NM_012412 NM_012415 NM_012416 NM_012431 NM_012443 NM_012458 NM_012463 NM_012464 NM_012465 NM_012471 NM_012479 NM_012486 NM_013229 NM_013230 NM_013232 NM_013233 NM_013235 NM_013236 NM_013237 NM_013238 NM_013250 NM_013252 NM_013253 NM_013255 NM_013260 NM_013261 NM_013268 NM_013277 NM_013283 NM_013290 NM_013301 NM_013308 NM_013322 NM_013332 NM_013338 NM_013339 NM_013341 NM_013352 NM_013354 NM_013361 NM_013365 NM_013372 NM_013374 NM_013375 NM_013380 NM_013381 NM_013385 NM_013386 NM_013436 NM_013449 NM_013943 NM_013989 NM_013996 NM_013997 NM_013998 NM_014005 NM_014007 NM_014016 NM_014021 NM_014023 NM_014028 NM_014035 NM_014037 NM_014048 NM_014049 NM_014061 NM_014066 NM_014071 NM_014080 NM_014089 NM_014098 NM_014106 NM_014109 NM_014112 NM_014117 NM_014141 NM_014145 NM_014157 NM_014189 NM_014190 NM_014211 NM_014216 NM_014220 NM_014223 NM_014225 NM_014228 NM_014231 NM_014232 NM_014235 NM_014236 NM_014240 NM_014243 NM_014245 NM_014249 NM_014250 NM_014251 NM_014258 NM_014268 NM_014284 NM_014286 NM_014296 NM_014299 NM_014300 NM_014301 NM_014305 NM_014310 NM_014325 NM_014336 NM_014338 NM_014342 NM_014345 NM_014350 NM_014356 NM_014359 NM_014363 NM_014366 NM_014372 NM_014382 NM_014388 NM_014393 NM_014394 NM_014395 NM_014396 NM_014399 NM_014403 NM_014405 NM_014409 NM_014411 NM_014421 NM_014431 NM_014442 NM_014451 NM_014458 NM_014459 NM_014480 NM_014487 NM_014488 NM_014498 NM_014500 NM_014504 NM_014506 NM_014517 NM_014521 NM_014548 NM_014552 NM_014553 NM_014554 NM_014570 NM_014571 NM_014575 NM_014586 NM_014607 NM_014608 NM_014612 NM_014614 NM_014616 NM_014625 NM_014628 NM_014631 NM_014634 NM_014637 NM_014642 NM_014656 NM_014659 NM_014663 NM_014670 NM_014671 NM_014674 NM_014682 NM_014701 NM_014702 NM_014707 NM_014721 NM_014726 NM_014729 NM_014730 NM_014732 NM_014733 NM_014736 NM_014739 NM_014741 NM_014743 NM_014744 NM_014746 NM_014751 NM_014755 NM_014756 NM_014760 NM_014761 NM_014762 NM_014763 NM_014765 NM_014772 NM_014774 NM_014776 NM_014781 NM_014786 NM_014787 NM_014789 NM_014791 NM_014797 NM_014798 NM_014799 NM_014800 NM_014801 NM_014802 NM_014803 NM_014805 NM_014809 NM_014810 NM_014813 NM_014819 NM_014822 NM_014830 NM_014836 NM_014837 NM_014839 NM_014848 NM_014850 NM_014851 NM_014860 NM_014862 NM_014868 NM_014869 NM_014873 NM_014874 NM_014889 NM_014893 NM_014903 NM_014904 NM_014905 NM_014906 NM_014910 NM_014912 NM_014916 NM_014918 NM_014919 NM_014920 NM_014926 NM_014932 NM_014934 NM_014937 NM_014940 NM_014946 NM_014948 NM_014949 NM_014952 NM_014953 NM_014956 NM_014959 NM_014965 NM_014974 NM_014991 NM_014992 NM_014997 NM_014999 NM_015001 NM_015003 NM_015008 NM_015009 NM_015011 NM_015012 NM_015017 NM_015020 NM_015022 NM_015023 NM_015025 NM_015027 NM_015032 NM_015033 NM_015035 NM_015044 NM_015045 NM_015049 NM_015051 NM_015052 NM_015053 NM_015055 NM_015056 NM_015057 NM_015059 NM_015064 NM_015066 NM_015071 NM_015074 NM_015076 NM_015077 NM_015079 NM_015082 NM_015085 NM_015087 NM_015088 NM_015090 NM_015091 NM_015092 NM_015094 NM_015100 NM_015115 NM_015124 NM_015129 NM_015132 NM_015137 NM_015138 NM_015141 NM_015143 NM_015144 NM_015149 NM_015153 NM_015155 NM_015157 NM_015158 NM_015161 NM_015163 NM_015167 NM_015169 NM_015170 NM_015173 NM_015176 NM_015184 NM_015185 NM_015191 NM_015192 NM_015198 NM_015205 NM_015208 NM_015214 NM_015215 NM_015216 NM_015219 NM_015225 NM_015227 NM_015230 NM_015231 NM_015233 NM_015236 NM_015239 NM_015247 NM_015250 NM_015251 NM_015252 NM_015256 NM_015257 NM_015260 NM_015264 NM_015271 NM_015275 NM_015278 NM_015285 NM_015286 NM_015288 NM_015296 NM_015299 NM_015303 NM_015305 NM_015310 NM_015313 NM_015315 NM_015326 NM_015332 NM_015336 NM_015338 NM_015346 NM_015347 NM_015349 NM_015352 NM_015353 NM_015355 NM_015358 NM_015361 NM_015375 NM_015383 NM_015385 NM_015387 NM_015391 NM_015393 NM_015394 NM_015396 NM_015397 NM_015404 NM_015409 NM_015423 NM_015426 NM_015429 NM_015430 NM_015433 NM_015434 NM_015436 NM_015443 NM_015446 NM_015455 NM_015456 NM_015457 NM_015458 NM_015461 NM_015464 NM_015470 NM_015471 NM_015472 NM_015474 NM_015476 NM_015478 NM_015483 NM_015484 NM_015488 NM_015493 NM_015509 NM_015511 NM_015518 NM_015525 NM_015526 NM_015529 NM_015532 NM_015534 NM_015537 NM_015541 NM_015542 NM_015548 NM_015550 NM_015553 NM_015554 NM_015560 NM_015564 NM_015568 NM_015569 NM_015575 NM_015576 NM_015578 NM_015601 NM_015602 NM_015605 NM_015621 NM_015630 NM_015631 NM_015635 NM_015638 NM_015640 NM_015652 NM_015669 NM_015684 NM_015691 NM_015696 NM_015698 NM_015701 NM_015702 NM_015713 NM_015723 NM_015836 NM_015852 NM_015853 NM_015866 NM_015878 NM_015881 NM_015884 NM_015886 NM_015891 NM_015898 NM_015907 NM_015913 NM_015938 NM_015952 NM_015957 NM_015959 NM_015974 NM_015981 NM_015986 NM_015987 NM_015995 NM_015999 NM_016002 NM_016023 NM_016024 NM_016028 NM_016038 NM_016042 NM_016048 NM_016063 NM_016072 NM_016073 NM_016076 NM_016079 NM_016080 NM_016096 NM_016097 NM_016099 NM_016100 NM_016101 NM_016104 NM_016107 NM_016108 NM_016114 NM_016120 NM_016121 NM_016128 NM_016131 NM_016132 NM_016133 NM_016141 NM_016144 NM_016151 NM_016156 NM_016169 NM_016173 NM_016184 NM_016195 NM_016200 NM_016204 NM_016205 NM_016217 NM_016220 NM_016221 NM_016224 NM_016226 NM_016230 NM_016233 NM_016248 NM_016255 NM_016271 NM_016275 NM_016280 NM_016290 NM_016297 NM_016302 NM_016303 NM_016308 NM_016311 NM_016315 NM_016319 NM_016322 NM_016329 NM_016331 NM_016339 NM_016340 NM_016343 NM_016351 NM_016353 NM_016359 NM_016376 NM_016377 NM_016410 NM_016413 NM_016418 NM_016424 NM_016436 NM_016442 NM_016452 NM_016458 NM_016467 NM_016472 NM_016481 NM_016485 NM_016488 NM_016505 NM_016507 NM_016510 NM_016513 NM_016521 NM_016525 NM_016530 NM_016540 NM_016544 NM_016545 NM_016546 NM_016548 NM_016556 NM_016561 NM_016575 NM_016576 NM_016577 NM_016603 NM_016604 NM_016605 NM_016606 NM_016607 NM_016608 NM_016614 NM_016617 NM_016618 NM_016622 NM_016627 NM_016641 NM_016647 NM_016651 NM_016654 NM_016819 NM_016821 NM_016823 NM_016826 NM_016827 NM_016828 NM_016829 NM_016831 NM_016931 NM_016946 NM_017411 NM_017412 NM_017413 NM_017419 NM_017429 NM_017435 NM_017437 NM_017438 NM_017439 NM_017443 NM_017444 NM_017448 NM_017449 NM_017452 NM_017453 NM_017454 NM_017460 NM_017489 NM_017491 NM_017506 NM_017540 NM_017542 NM_017545 NM_017548 NM_017551 NM_017553 NM_017554 NM_017556 NM_017563 NM_017582 NM_017588 NM_017590 NM_017599 NM_017602 NM_017626 NM_017628 NM_017629 NM_017634 NM_017635 NM_017645 NM_017649 NM_017651 NM_017652 NM_017654 NM_017656 NM_017657 NM_017662 NM_017671 NM_017672 NM_017673 NM_017678 NM_017684 NM_017686 NM_017694 NM_017703 NM_017707 NM_017709 NM_017712 NM_017714 NM_017719 NM_017728 NM_017738 NM_017739 NM_017748 NM_017752 NM_017760 NM_017762 NM_017769 NM_017774 NM_017776 NM_017779 NM_017785 NM_017787 NM_017789 NM_017801 NM_017802 NM_017811 NM_017813 NM_017824 NM_017827 NM_017828 NM_017830 NM_017831 NM_017841 NM_017845 NM_017849 NM_017850 NM_017852 NM_017853 NM_017855 NM_017866 NM_017868 NM_017873 NM_017875 NM_017888 NM_017891 NM_017896 NM_017902 NM_017907 NM_017910 NM_017915 NM_017924 NM_017928 NM_017931 NM_017938 NM_017939 NM_017952 NM_017954 NM_017955 NM_017968 NM_017974 NM_017980 NM_017982 NM_017984 NM_017988 NM_017990 NM_017998 NM_018011 NM_018015 NM_018017 NM_018018 NM_018030 NM_018036 NM_018037 NM_018043 NM_018046 NM_018047 NM_018055 NM_018069 NM_018073 NM_018082 NM_018086 NM_018092 NM_018101 NM_018102 NM_018105 NM_018106 NM_018109 NM_018112 NM_018115 NM_018117 NM_018120 NM_018121 NM_018126 NM_018130 NM_018133 NM_018137 NM_018141 NM_018142 NM_018153 NM_018157 NM_018168 NM_018169 NM_018170 NM_018172 NM_018185 NM_018189 NM_018194 NM_018195 NM_018200 NM_018206 NM_018212 NM_018215 NM_018221 NM_018224 NM_018229 NM_018230 NM_018233 NM_018235 NM_018240 NM_018243 NM_018247 NM_018252 NM_018254 NM_018257 NM_018260 NM_018267 NM_018273 NM_018277 NM_018283 NM_018287 NM_018290 NM_018295 NM_018298 NM_018299 NM_018302 NM_018315 NM_018320 NM_018322 NM_018323 NM_018325 NM_018326 NM_018339 NM_018340 NM_018342 NM_018348 NM_018352 NM_018353 NM_018355 NM_018356 NM_018362 NM_018364 NM_018371 NM_018374 NM_018375 NM_018376 NM_018383 NM_018384 NM_018404 NM_018407 NM_018416 NM_018424 NM_018431 NM_018439 NM_018440 NM_018445 NM_018450 NM_018452 NM_018454 NM_018461 NM_018462 NM_018466 NM_018471 NM_018475 NM_018518 NM_018534 NM_018538 NM_018555 NM_018566 NM_018569 NM_018590 NM_018602 NM_018638 NM_018639 NM_018640 NM_018651 NM_018652 NM_018657 NM_018659 NM_018660 NM_018667 NM_018668 NM_018672 NM_018684 NM_018695 NM_018696 NM_018700 NM_018708 NM_018710 NM_018711 NM_018712 NM_018719 NM_018725 NM_018837 NM_018841 NM_018844 NM_018846 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018931 NM_018932 NM_018945 NM_018963 NM_018967 NM_018975 NM_018976 NM_018981 NM_018982 NM_018988 NM_018999 NM_019001 NM_019006 NM_019007 NM_019008 NM_019012 NM_019022 NM_019029 NM_019044 NM_019053 NM_019054 NM_019058 NM_019061 NM_019069 NM_019075 NM_019076 NM_019077 NM_019078 NM_019080 NM_019084 NM_019085 NM_019086 NM_019089 NM_019091 NM_019093 NM_019106 NM_019114 NM_019119 NM_019555 NM_019594 NM_019595 NM_019600 NM_019604 NM_019616 NM_019618 NM_019842 NM_019845 NM_019857 NM_019891 NM_019894 NM_020037 NM_020038 NM_020066 NM_020119 NM_020128 NM_020129 NM_020131 NM_020132 NM_020133 NM_020139 NM_020141 NM_020149 NM_020150 NM_020151 NM_020159 NM_020162 NM_020164 NM_020165 NM_020170 NM_020177 NM_020180 NM_020182 NM_020186 NM_020193 NM_020198 NM_020207 NM_020215 NM_020228 NM_020231 NM_020235 NM_020238 NM_020239 NM_020244 NM_020245 NM_020313 NM_020328 NM_020335 NM_020337 NM_020341 NM_020342 NM_020345 NM_020346 NM_020347 NM_020348 NM_020353 NM_020354 NM_020358 NM_020362 NM_020367 NM_020368 NM_020377 NM_020381 NM_020384 NM_020390 NM_020398 NM_020399 NM_020402 NM_020403 NM_020416 NM_020424 NM_020425 NM_020432 NM_020442 NM_020443 NM_020451 NM_020453 NM_020455 NM_020456 NM_020467 NM_020470 NM_020472 NM_020473 NM_020474 NM_020525 NM_020529 NM_020532 NM_020536 NM_020546 NM_020552 NM_020553 NM_020639 NM_020645 NM_020648 NM_020651 NM_020654 NM_020657 NM_020665 NM_020666 NM_020673 NM_020674 NM_020675 NM_020678 NM_020686 NM_020698 NM_020699 NM_020704 NM_020711 NM_020724 NM_020727 NM_020728 NM_020738 NM_020742 NM_020745 NM_020749 NM_020751 NM_020762 NM_020766 NM_020768 NM_020771 NM_020774 NM_020775 NM_020776 NM_020779 NM_020781 NM_020782 NM_020783 NM_020784 NM_020791 NM_020792 NM_020795 NM_020796 NM_020803 NM_020806 NM_020809 NM_020810 NM_020813 NM_020820 NM_020821 NM_020825 NM_020826 NM_020828 NM_020830 NM_020834 NM_020841 NM_020843 NM_020853 NM_020854 NM_020860 NM_020861 NM_020865 NM_020868 NM_020870 NM_020877 NM_020888 NM_020898 NM_020909 NM_020914 NM_020918 NM_020921 NM_020927 NM_020935 NM_020940 NM_020948 NM_020954 NM_020962 NM_020967 NM_020970 NM_020975 NM_020977 NM_020980 NM_020987 NM_020994 NM_020997 NM_021009 NM_021026 NM_021027 NM_021033 NM_021035 NM_021038 NM_021045 NM_021057 NM_021079 NM_021083 NM_021101 NM_021105 NM_021116 NM_021117 NM_021131 NM_021133 NM_021135 NM_021137 NM_021141 NM_021144 NM_021151 NM_021153 NM_021163 NM_021167 NM_021177 NM_021183 NM_021201 NM_021202 NM_021203 NM_021204 NM_021215 NM_021222 NM_021224 NM_021233 NM_021238 NM_021249 NM_021252 NM_021255 NM_021258 NM_021260 NM_021612 NM_021620 NM_021622 NM_021625 NM_021626 NM_021629 NM_021635 NM_021638 NM_021639 NM_021645 NM_021649 NM_021705 NM_021722 NM_021723 NM_021728 NM_021735 NM_021736 NM_021737 NM_021785 NM_021795 NM_021800 NM_021804 NM_021809 NM_021812 NM_021813 NM_021814 NM_021815 NM_021827 NM_021871 NM_021905 NM_021913 NM_021914 NM_021916 NM_021927 NM_021934 NM_021942 NM_021946 NM_021947 NM_021949 NM_021950 NM_021951 NM_021960 NM_021961 NM_021963 NM_021980 NM_021988 NM_021995 NM_021998 NM_022002 NM_022041 NM_022048 NM_022060 NM_022062 NM_022064 NM_022071 NM_022074 NM_022077 NM_022079 NM_022080 NM_022085 NM_022090 NM_022097 NM_022102 NM_022103 NM_022117 NM_022118 NM_022130 NM_022131 NM_022135 NM_022138 NM_022142 NM_022150 NM_022151 NM_022153 NM_022337 NM_022361 NM_022366 NM_022373 NM_022374 NM_022442 NM_022445 NM_022451 NM_022459 NM_022460 NM_022468 NM_022470 NM_022471 NM_022473 NM_022474 NM_022477 NM_022480 NM_022484 NM_022486 NM_022487 NM_022490 NM_022491 NM_022553 NM_022567 NM_022568 NM_022570 NM_022572 NM_022716 NM_022718 NM_022733 NM_022735 NM_022737 NM_022753 NM_022754 NM_022763 NM_022764 NM_022776 NM_022780 NM_022783 NM_022802 NM_022820 NM_022821 NM_022824 NM_022840 NM_022842 NM_022843 NM_022844 NM_022845 NM_022874 NM_022875 NM_022876 NM_022877 NM_022893 NM_022894 NM_022900 NM_022912 NM_022918 NM_022973 NM_022974 NM_022977 NM_023002 NM_023005 NM_023010 NM_023016 NM_023018 NM_023073 NM_023074 NM_023077 NM_023080 NM_023107 NM_023108 NM_023914 NM_023920 NM_023927 NM_023931 NM_023934 NM_023938 NM_024019 NM_024034 NM_024048 NM_024065 NM_024068 NM_024072 NM_024074 NM_024080 NM_024085 NM_024092 NM_024097 NM_024101 NM_024104 NM_024119 NM_024295 NM_024312 NM_024334 NM_024408 NM_024411 NM_024422 NM_024482 NM_024511 NM_024529 NM_024539 NM_024546 NM_024551 NM_024554 NM_024561 NM_024563 NM_024573 NM_024574 NM_024577 NM_024583 NM_024590 NM_024593 NM_024594 NM_024607 NM_024611 NM_024612 NM_024616 NM_024619 NM_024620 NM_024621 NM_024624 NM_024625 NM_024626 NM_024628 NM_024629 NM_024639 NM_024641 NM_024646 NM_024656 NM_024665 NM_024667 NM_024670 NM_024677 NM_024685 NM_024689 NM_024704 NM_024705 NM_024709 NM_024711 NM_024713 NM_024722 NM_024749 NM_024755 NM_024758 NM_024763 NM_024769 NM_024792 NM_024805 NM_024810 NM_024812 NM_024814 NM_024824 NM_024828 NM_024834 NM_024841 NM_024845 NM_024847 NM_024860 NM_024864 NM_024866 NM_024874 NM_024878 NM_024882 NM_024896 NM_024900 NM_024910 NM_024911 NM_024913 NM_024921 NM_024938 NM_024940 NM_024941 NM_024942 NM_024944 NM_024945 NM_024946 NM_024948 NM_024949 NM_024953 NM_024955 NM_024960 NM_024966 NM_024969 NM_024989 NM_024993 NM_024996 NM_024997 NM_025000 NM_025010 NM_025026 NM_025030 NM_025048 NM_025054 NM_025059 NM_025079 NM_025090 NM_025126 NM_025128 NM_025130 NM_025147 NM_025151 NM_025155 NM_025158 NM_025160 NM_025164 NM_025188 NM_025191 NM_025194 NM_025196 NM_025208 NM_025218 NM_025219 NM_025235 NM_025237 NM_025263 NM_030571 NM_030582 NM_030583 NM_030588 NM_030594 NM_030625 NM_030626 NM_030631 NM_030633 NM_030634 NM_030650 NM_030655 NM_030664 NM_030665 NM_030756 NM_030762 NM_030764 NM_030777 NM_030780 NM_030781 NM_030791 NM_030796 NM_030799 NM_030802 NM_030803 NM_030805 NM_030806 NM_030809 NM_030810 NM_030812 NM_030816 NM_030817 NM_030820 NM_030899 NM_030911 NM_030915 NM_030918 NM_030920 NM_030922 NM_030924 NM_030925 NM_030926 NM_030939 NM_030940 NM_030944 NM_030949 NM_030950 NM_030958 NM_030962 NM_030965 NM_030972 NM_030978 NM_031216 NM_031217 NM_031226 NM_031244 NM_031265 NM_031268 NM_031281 NM_031283 NM_031284 NM_031287 NM_031290 NM_031292 NM_031295 NM_031296 NM_031311 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031369 NM_031370 NM_031411 NM_031417 NM_031418 NM_031419 NM_031426 NM_031435 NM_031437 NM_031445 NM_031459 NM_031461 NM_031462 NM_031463 NM_031468 NM_031476 NM_031479 NM_031483 NM_031484 NM_031844 NM_031849 NM_031854 NM_031857 NM_031858 NM_031860 NM_031862 NM_031866 NM_031886 NM_031887 NM_031888 NM_031890 NM_031896 NM_031900 NM_031905 NM_031908 NM_031911 NM_031936 NM_031939 NM_031954 NM_031988 NM_032012 NM_032013 NM_032021 NM_032041 NM_032042 NM_032045 NM_032047 NM_032088 NM_032092 NM_032105 NM_032116 NM_032124 NM_032132 NM_032138 NM_032144 NM_032145 NM_032151 NM_032154 NM_032160 NM_032169 NM_032174 NM_032175 NM_032182 NM_032189 NM_032195 NM_032196 NM_032207 NM_032208 NM_032217 NM_032221 NM_032226 NM_032227 NM_032228 NM_032242 NM_032256 NM_032262 NM_032264 NM_032266 NM_032268 NM_032279 NM_032280 NM_032285 NM_032286 NM_032287 NM_032288 NM_032291 NM_032293 NM_032295 NM_032296 NM_032300 NM_032303 NM_032310 NM_032311 NM_032316 NM_032317 NM_032320 NM_032322 NM_032326 NM_032342 NM_032350 NM_032352 NM_032368 NM_032373 NM_032375 NM_032383 NM_032390 NM_032403 NM_032408 NM_032410 NM_032420 NM_032424 NM_032434 NM_032438 NM_032440 NM_032444 NM_032448 NM_032449 NM_032454 NM_032458 NM_032467 NM_032476 NM_032484 NM_032486 NM_032490 NM_032491 NM_032493 NM_032498 NM_032505 NM_032514 NM_032521 NM_032529 NM_032547 NM_032550 NM_032551 NM_032554 NM_032564 NM_032576 NM_032578 NM_032579 NM_032581 NM_032582 NM_032588 NM_032592 NM_032606 NM_032622 NM_032664 NM_032680 NM_032682 NM_032711 NM_032725 NM_032737 NM_032740 NM_032756 NM_032770 NM_032781 NM_032782 NM_032788 NM_032795 NM_032801 NM_032802 NM_032804 NM_032810 NM_032813 NM_032818 NM_032824 NM_032825 NM_032826 NM_032827 NM_032828 NM_032831 NM_032833 NM_032837 NM_032842 NM_032846 NM_032850 NM_032859 NM_032861 NM_032863 NM_032867 NM_032869 NM_032873 NM_032875 NM_032886 NM_032900 NM_032905 NM_032906 NM_032916 NM_032920 NM_032927 NM_032932 NM_032933 NM_032947 NM_032968 NM_032969 NM_032973 NM_032975 NM_032976 NM_032977 NM_032978 NM_032979 NM_032980 NM_032981 NM_032982 NM_032983 NM_032984 NM_032997 NM_033013 NM_033018 NM_033030 NM_033034 NM_033044 NM_033048 NM_033051 NM_033056 NM_033058 NM_033069 NM_033083 NM_033088 NM_033089 NM_033090 NM_033093 NM_033102 NM_033112 NM_033121 NM_033128 NM_033133 NM_033135 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033143 NM_033157 NM_033170 NM_033171 NM_033172 NM_033173 NM_033201 NM_033206 NM_033207 NM_033209 NM_033211 NM_033213 NM_033253 NM_033262 NM_033274 NM_033277 NM_033285 NM_033288 NM_033316 NM_033318 NM_033331 NM_033338 NM_033339 NM_033340 NM_033360 NM_033380 NM_033381 NM_033389 NM_033393 NM_033397 NM_033407 NM_033410 NM_033411 NM_033415 NM_033421 NM_033426 NM_033428 NM_033429 NM_033430 NM_033437 NM_033439 NM_033480 NM_033481 NM_033484 NM_033505 NM_033551 NM_033554 NM_033631 NM_033632 NM_033642 NM_033644 NM_033645 NM_033656 NM_033658 NM_037370 NM_052811 NM_052818 NM_052821 NM_052822 NM_052832 NM_052834 NM_052845 NM_052851 NM_052857 NM_052862 NM_052865 NM_052879 NM_052884 NM_052885 NM_052886 NM_052887 NM_052897 NM_052900 NM_052910 NM_052913 NM_052917 NM_052918 NM_052931 NM_052932 NM_052936 NM_052937 NM_052941 NM_052953 NM_052954 NM_052964 NM_052965 NM_052966 NM_053002 NM_053023 NM_053024 NM_053029 NM_053042 NM_053051 NM_053053 NM_053056 NM_053064 NM_053277 NM_053286 NM_054031 NM_054110 NM_057095 NM_057096 NM_057159 NM_057169 NM_057170 NM_057175 NM_057178 NM_057180 NM_058163 NM_058170 NM_058174 NM_058175 NM_058217 NM_058240 NM_058241 NM_058242 NM_058243 NM_058248 NM_078467 NM_078483 NM_078487 NM_078628 NM_080387 NM_080473 NM_080546 NM_080564 NM_080594 NM_080597 NM_080599 NM_080617 NM_080618 NM_080626 NM_080627 NM_080632 NM_080654 NM_080656 NM_080657 NM_080668 NM_080676 NM_080678 NM_080679 NM_080680 NM_080681 NM_080717 NM_080737 NM_080738 NM_080747 NM_080764 NM_080820 NM_080821 NM_080832 NM_080867 NM_080872 NM_080874 NM_080876 NM_080912 NM_080913 NM_080914 NM_080921 NM_080922 NM_080927 NM_080928 NM_130386 NM_130440 NM_130442 NM_130444 NM_130445 NM_130446 NM_130463 NM_130465 NM_130468 NM_130768 NM_130782 NM_130809 NM_130831 NM_130832 NM_130833 NM_130834 NM_130835 NM_130836 NM_130837 NM_130838 NM_130839 NM_130842 NM_130843 NM_130846 NM_130847 NM_130848 NM_133170 NM_133259 NM_133266 NM_133268 NM_133269 NM_133271 NM_133272 NM_133273 NM_133274 NM_133277 NM_133278 NM_133279 NM_133280 NM_133329 NM_133332 NM_133333 NM_133334 NM_133370 NM_133371 NM_133372 NM_133373 NM_133443 NM_133444 NM_133445 NM_133452 NM_133460 NM_133468 NM_133473 NM_133477 NM_133487 NM_133496 NM_133503 NM_133504 NM_133505 NM_133506 NM_133507 NM_133631 NM_133646 NM_134324 NM_134422 NM_134423 NM_134424 NM_134434 NM_134442 NM_134444 NM_138281 NM_138282 NM_138287 NM_138290 NM_138298 NM_138299 NM_138300 NM_138316 NM_138319 NM_138333 NM_138335 NM_138347 NM_138357 NM_138368 NM_138371 NM_138372 NM_138375 NM_138384 NM_138390 NM_138395 NM_138400 NM_138422 NM_138444 NM_138447 NM_138456 NM_138457 NM_138458 NM_138459 NM_138473 NM_138479 NM_138494 NM_138573 NM_138633 NM_138638 NM_138640 NM_138693 NM_138694 NM_138713 NM_138714 NM_138717 NM_138724 NM_138731 NM_138735 NM_138737 NM_138738 NM_138766 NM_138773 NM_138782 NM_138793 NM_138797 NM_138811 NM_138813 NM_138821 NM_138822 NM_138958 NM_138959 NM_138961 NM_138971 NM_138972 NM_138973 NM_138995 NM_138999 NM_139002 NM_139015 NM_139016 NM_139025 NM_139026 NM_139027 NM_139046 NM_139047 NM_139049 NM_139071 NM_139131 NM_139156 NM_139161 NM_139164 NM_139168 NM_139170 NM_139177 NM_139179 NM_139182 NM_139207 NM_139244 NM_139246 NM_139250 NM_139264 NM_139267 NM_139275 NM_139280 NM_139290 NM_139316 NM_139319 NM_139321 NM_139323 NM_144494 NM_144497 NM_144502 NM_144503 NM_144504 NM_144567 NM_144570 NM_144578 NM_144591 NM_144595 NM_144596 NM_144599 NM_144600 NM_144607 NM_144609 NM_144618 NM_144626 NM_144629 NM_144632 NM_144643 NM_144646 NM_144667 NM_144671 NM_144677 NM_144684 NM_144693 NM_144701 NM_144718 NM_144721 NM_144724 NM_144767 NM_144778 NM_144969 NM_144975 NM_144982 NM_144991 NM_145010 NM_145013 NM_145014 NM_145025 NM_145034 NM_145041 NM_145046 NM_145049 NM_145053 NM_145055 NM_145061 NM_145062 NM_145115 NM_145117 NM_145165 NM_145187 NM_145188 NM_145189 NM_145190 NM_145231 NM_145239 NM_145257 NM_145259 NM_145261 NM_145263 NM_145276 NM_145280 NM_145284 NM_145286 NM_145299 NM_145307 NM_145310 NM_145312 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145330 NM_145331 NM_145332 NM_145333 NM_145343 NM_145344 NM_145646 NM_145686 NM_145687 NM_145690 NM_145693 NM_145701 NM_145715 NM_145728 NM_145731 NM_145733 NM_145734 NM_145735 NM_145738 NM_145756 NM_145759 NM_145799 NM_145800 NM_145802 NM_145808 NM_145809 NM_145818 NM_145858 NM_145861 NM_145868 NM_145869 NM_145891 NM_145892 NM_145893 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145909 NM_145914 NM_145918 NM_146421 NM_147131 NM_147132 NM_147147 NM_147148 NM_147166 NM_147174 NM_147175 NM_147187 NM_147188 NM_147189 NM_147190 NM_147195 NM_147202 NM_147204 NM_147223 NM_147233 NM_148170 NM_148174 NM_148915 NM_148918 NM_148957 NM_148960 NM_148977 NM_148978 NM_152233 NM_152240 NM_152253 NM_152261 NM_152263 NM_152269 NM_152278 NM_152281 NM_152291 NM_152292 NM_152300 NM_152305 NM_152306 NM_152308 NM_152309 NM_152311 NM_152333 NM_152344 NM_152347 NM_152350 NM_152354 NM_152363 NM_152367 NM_152371 NM_152380 NM_152382 NM_152384 NM_152387 NM_152389 NM_152390 NM_152407 NM_152422 NM_152429 NM_152431 NM_152433 NM_152436 NM_152437 NM_152450 NM_152462 NM_152463 NM_152470 NM_152472 NM_152475 NM_152484 NM_152488 NM_152495 NM_152523 NM_152527 NM_152529 NM_152545 NM_152547 NM_152551 NM_152552 NM_152563 NM_152574 NM_152583 NM_152588 NM_152594 NM_152599 NM_152603 NM_152606 NM_152608 NM_152613 NM_152619 NM_152621 NM_152622 NM_152624 NM_152630 NM_152641 NM_152660 NM_152667 NM_152678 NM_152680 NM_152686 NM_152688 NM_152695 NM_152703 NM_152716 NM_152717 NM_152722 NM_152725 NM_152726 NM_152729 NM_152731 NM_152735 NM_152740 NM_152745 NM_152749 NM_152754 NM_152760 NM_152765 NM_152774 NM_152778 NM_152793 NM_152835 NM_152838 NM_152851 NM_152852 NM_152857 NM_152858 NM_152866 NM_152879 NM_152890 NM_152896 NM_152897 NM_152903 NM_152904 NM_152906 NM_152933 NM_152934 NM_152989 NM_152995 NM_152996 NM_153007 NM_153010 NM_153013 NM_153015 NM_153020 NM_153028 NM_153029 NM_153042 NM_153045 NM_153186 NM_153206 NM_153207 NM_153208 NM_153217 NM_153225 NM_153226 NM_153229 NM_153231 NM_153236 NM_153244 NM_153255 NM_153261 NM_153262 NM_153263 NM_153268 NM_153273 NM_153328 NM_153332 NM_153333 NM_153334 NM_153344 NM_153348 NM_153355 NM_153371 NM_153380 NM_153381 NM_153425 NM_153442 NM_153451 NM_153456 NM_153499 NM_153500 NM_153607 NM_153619 NM_153637 NM_153638 NM_153639 NM_153640 NM_153641 NM_153646 NM_153647 NM_153648 NM_153649 NM_153683 NM_153686 NM_153687 NM_153688 NM_153691 NM_153694 NM_153705 NM_153708 NM_153712 NM_153714 NM_153742 NM_153747 NM_153756 NM_153812 NM_153826 NM_153828 NM_153836 NM_156036 NM_170601 NM_170609 NM_170674 NM_170675 NM_170676 NM_170677 NM_170679 NM_170686 NM_170705 NM_170716 NM_170717 NM_170721 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170736 NM_170737 NM_170740 NM_170745 NM_170771 NM_170776 NM_171825 NM_171982 NM_172020 NM_172024 NM_172058 NM_172059 NM_172060 NM_172070 NM_172097 NM_172099 NM_172127 NM_172128 NM_172159 NM_172160 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172174 NM_172175 NM_172193 NM_172216 NM_172226 NM_172232 NM_172234 NM_172236 NM_172238 NM_172239 NM_172242 NM_172315 NM_172316 NM_172337 NM_172344 NM_172350 NM_172351 NM_172352 NM_172353 NM_172354 NM_172355 NM_172356 NM_172357 NM_172358 NM_172359 NM_172360 NM_172361 NM_172377 NM_172387 NM_172388 NM_172389 NM_173054 NM_173075 NM_173079 NM_173156 NM_173214 NM_173216 NM_173217 NM_173342 NM_173358 NM_173359 NM_173459 NM_173462 NM_173463 NM_173464 NM_173468 NM_173470 NM_173471 NM_173473 NM_173477 NM_173485 NM_173488 NM_173494 NM_173499 NM_173510 NM_173513 NM_173515 NM_173533 NM_173536 NM_173538 NM_173545 NM_173546 NM_173551 NM_173552 NM_173557 NM_173560 NM_173562 NM_173570 NM_173576 NM_173579 NM_173580 NM_173582 NM_173586 NM_173589 NM_173602 NM_173607 NM_173609 NM_173610 NM_173611 NM_173616 NM_173622 NM_173631 NM_173632 NM_173635 NM_173638 NM_173641 NM_173644 NM_173647 NM_173652 NM_173654 NM_173657 NM_173664 NM_173666 NM_173669 NM_173675 NM_173678 NM_173683 NM_173688 NM_173698 NM_173700 NM_173728 NM_173794 NM_173795 NM_173798 NM_173802 NM_173804 NM_173808 NM_173812 NM_173822 NM_173823 NM_173825 NM_173828 NM_173829 NM_173830 NM_173844 NM_173851 NM_173854 NM_173872 NM_174856 NM_174858 NM_174871 NM_174881 NM_174882 NM_174900 NM_174901 NM_174911 NM_174924 NM_174931 NM_174951 NM_174959 NM_174962 NM_174972 NM_174976 NM_174977 NM_174978 NM_175039 NM_175040 NM_175058 NM_175061 NM_175066 NM_175078 NM_175085 NM_175567 NM_175568 NM_175569 NM_175624 NM_175625 NM_175626 NM_175627 NM_175698 NM_175733 NM_175736 NM_175745 NM_175767 NM_175852 NM_175854 NM_175856 NM_175859 NM_175870 NM_175871 NM_175876 NM_175883 NM_175892 NM_175921 NM_175922 NM_176084 NM_176085 NM_176086 NM_176787 NM_176799 NM_176801 NM_176806 NM_176812 NM_176815 NM_176816 NM_176824 NM_176863 NM_176871 NM_176894 NM_177436 NM_177442 NM_177524 NM_177525 NM_177538 NM_177553 NM_177924 NM_177926 NM_177937 NM_177947 NM_177948 NM_177959 NM_177966 NM_177990 NM_177995 NM_177999 NM_178000 NM_178001 NM_178002 NM_178003 NM_178004 NM_178006 NM_178007 NM_178010 NM_178011 NM_178013 NM_178034 NM_178037 NM_178038 NM_178039 NM_178040 NM_178130 NM_178135 NM_178136 NM_178140 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178190 NM_178191 NM_178229 NM_178234 NM_178270 NM_178271 NM_178314 NM_178324 NM_178342 NM_178422 NM_178423 NM_178424 NM_178426 NM_178427 NM_178429 NM_178439 NM_178441 NM_178450 NM_178468 NM_178470 NM_178477 NM_178494 NM_178496 NM_178509 NM_178516 NM_178540 NM_178544 NM_178558 NM_178565 NM_178578 NM_178579 NM_178582 NM_178583 NM_178585 NM_178586 NM_178815 NM_178823 NM_178832 NM_178836 NM_178857 NM_178860 NM_178863 NM_180989 NM_180991 NM_181041 NM_181076 NM_181077 NM_181332 NM_181358 NM_181359 NM_181430 NM_181431 NM_181467 NM_181469 NM_181481 NM_181482 NM_181483 NM_181484 NM_181486 NM_181489 NM_181502 NM_181504 NM_181507 NM_181508 NM_181509 NM_181512 NM_181523 NM_181524 NM_181527 NM_181528 NM_181558 NM_181597 NM_181609 NM_181644 NM_181655 NM_181656 NM_181659 NM_181670 NM_181672 NM_181673 NM_181701 NM_181704 NM_181705 NM_181714 NM_181720 NM_181723 NM_181780 NM_181783 NM_181784 NM_181785 NM_181788 NM_181789 NM_181804 NM_181805 NM_181825 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181836 NM_181839 NM_181846 NM_181847 NM_181861 NM_181868 NM_181869 NM_181876 NM_181877 NM_181886 NM_181887 NM_181888 NM_181889 NM_181890 NM_181891 NM_181892 NM_181893 NM_181897 NM_182481 NM_182482 NM_182484 NM_182485 NM_182488 NM_182490 NM_182495 NM_182500 NM_182501 NM_182502 NM_182503 NM_182507 NM_182508 NM_182522 NM_182535 NM_182540 NM_182546 NM_182551 NM_182552 NM_182556 NM_182558 NM_182564 NM_182568 NM_182579 NM_182580 NM_182584 NM_182585 NM_182597 NM_182598 NM_182603 NM_182612 NM_182616 NM_182621 NM_182631 NM_182637 NM_182638 NM_182643 NM_182644 NM_182646 NM_182665 NM_182682 NM_182686 NM_182691 NM_182692 NM_182700 NM_182734 NM_182740 NM_182746 NM_182751 NM_182752 NM_182757 NM_182758 NM_182763 NM_182765 NM_182796 NM_182831 NM_182895 NM_182907 NM_182909 NM_182932 NM_182933 NM_182934 NM_182935 NM_182936 NM_182943 NM_182948 NM_182964 NM_182978 NM_183002 NM_183004 NM_183009 NM_183047 NM_183048 NM_183059 NM_183063 NM_183078 NM_183237 NM_183238 NM_183243 NM_183247 NM_183337 NM_183353 NM_183372 NM_183373 NM_183376 NM_183380 NM_183381 NM_183382 NM_183383 NM_183384 NM_183385 NM_183387 NM_183398 NM_183399 NM_183400 NM_183401 NM_183422 NM_184085 NM_184086 NM_184087 NM_194250 NM_194259 NM_194260 NM_194261 NM_194271 NM_194272 NM_194277 NM_194283 NM_194284 NM_194286 NM_194291 NM_194292 NM_194303 NM_194314 NM_194317 NM_194318 NM_194319 NM_194324 NM_194327 NM_194434 NM_194439 NM_194442 NM_194447 NM_194448 NM_194450 NM_194452 NM_194453 NM_194463 NM_197939 NM_197941 NM_197947 NM_197948 NM_197949 NM_197950 NM_197951 NM_197952 NM_197953 NM_197970 NM_197974 NM_197976 NM_197977 NM_198066 NM_198076 NM_198081 NM_198087 NM_198088 NM_198123 NM_198124 NM_198128 NM_198148 NM_198156 NM_198158 NM_198159 NM_198175 NM_198177 NM_198178 NM_198182 NM_198189 NM_198212 NM_198215 NM_198217 NM_198218 NM_198219 NM_198220 NM_198225 NM_198243 NM_198256 NM_198257 NM_198258 NM_198267 NM_198268 NM_198269 NM_198270 NM_198274 NM_198309 NM_198310 NM_198320 NM_198321 NM_198324 NM_198325 NM_198330 NM_198381 NM_198389 NM_198392 NM_198395 NM_198400 NM_198428 NM_198439 NM_198440 NM_198445 NM_198447 NM_198449 NM_198457 NM_198458 NM_198459 NM_198461 NM_198462 NM_198465 NM_198474 NM_198480 NM_198485 NM_198489 NM_198502 NM_198503 NM_198504 NM_198508 NM_198511 NM_198513 NM_198527 NM_198530 NM_198532 NM_198539 NM_198540 NM_198545 NM_198549 NM_198568 NM_198581 NM_198582 NM_198584 NM_198586 NM_198595 NM_198596 NM_198597 NM_198682 NM_198686 NM_198715 NM_198793 NM_198830 NM_198835 NM_198841 NM_198843 NM_198844 NM_198847 NM_198859 NM_198887 NM_198889 NM_198890 NM_198893 NM_198896 NM_198900 NM_198901 NM_198902 NM_198904 NM_198945 NM_198955 NM_198956 NM_198964 NM_198965 NM_198966 NM_198968 NM_198992 NM_199000 NM_199003 NM_199005 NM_199045 NM_199050 NM_199053 NM_199072 NM_199076 NM_199123 NM_199132 NM_199144 NM_199169 NM_199170 NM_199171 NM_199175 NM_199188 NM_199190 NM_199203 NM_199245 NM_199246 NM_199262 NM_199280 NM_199324 NM_199327 NM_199335 NM_199348 NM_199368 NM_199415 NM_199421 NM_199423 NM_199436 NM_199437 NM_199438 NM_199439 NM_199440 NM_199441 NM_199451 NM_199452 NM_199462 NM_199482 NM_201252 NM_201259 NM_201260 NM_201261 NM_201263 NM_201266 NM_201267 NM_201278 NM_201279 NM_201281 NM_201400 NM_201413 NM_201414 NM_201432 NM_201433 NM_201436 NM_201516 NM_201517 NM_201524 NM_201525 NM_201526 NM_201559 NM_201565 NM_201567 NM_201568 NM_201569 NM_201598 NM_201613 NM_201624 NM_201628 NM_201994 NM_201997 NM_201999 NM_203281 NM_203282 NM_203287 NM_203303 NM_203316 NM_203327 NM_203329 NM_203330 NM_203331 NM_203341 NM_203342 NM_203343 NM_203349 NM_203350 NM_203371 NM_203372 NM_203373 NM_203381 NM_203382 NM_203390 NM_203391 NM_203395 NM_203404 NM_203406 NM_203436 NM_203437 NM_203445 NM_203446 NM_203453 NM_203458 NM_203459 NM_203463 NM_203471 NM_203481 NM_203487 NM_203497 NM_203499 NM_203500 NM_205543 NM_205768 NM_205842 NM_205855 NM_205857 NM_205860 NM_205862 NM_206594 NM_206595 NM_206825 NM_206826 NM_206835 NM_206836 NM_206841 NM_206853 NM_206854 NM_206855 NM_206866 NM_206876 NM_206877 NM_206889 NM_206892 NM_206907 NM_206909 NM_206910 NM_206911 NM_206914 NM_206926 NM_206933 NM_206937 NM_206938 NM_206939 NM_206940 NM_207002 NM_207012 NM_207032 NM_207033 NM_207034 NM_207043 NM_207044 NM_207047 NM_207113 NM_207122 NM_207123 NM_207126 NM_207129 NM_207170 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207303 NM_207304 NM_207321 NM_207323 NM_207325 NM_207328 NM_207333 NM_207334 NM_207335 NM_207337 NM_207357 NM_207362 NM_207366 NM_207367 NM_207372 NM_207376 NM_207380 NM_207383 NM_207389 NM_207390 NM_207396 NM_207404 NM_207405 NM_207412 NM_207428 NM_207430 NM_207432 NM_207434 NM_207439 NM_207440 NM_207443 NM_207445 NM_207460 NM_207467 NM_207468 NM_207470 NM_207475 NM_207478 NM_207481 NM_207482 NM_207483 NM_207489 NM_207499 NM_207504 NM_207506 NM_207507 NM_207513 NM_207517 NM_207520 NM_207521 NM_207644 NM_207646 NM_207660 NM_207661 NM_207662 NM_207672 NM_212471 NM_212472 NM_212474 NM_212475 NM_212476 NM_212478 NM_212482 NM_212540 NM_212543 NM_212555 NM_212557 NM_213566 NM_213568 NM_213589 NM_213590 NM_213594 NM_213595 NM_213596 NM_213603 NM_213606 NM_213651 NM_213657 NM_213658 NM_213723 NM_213726 NM_214677 NM_214678 NM_214679 XM_016532 XM_017374 XM_027236 XM_027307 XM_028810 XM_031553 XM_031689 XM_032901 XM_032945 XM_033371 XM_033853 XM_034274 XM_036708 XM_036988 XM_037523 XM_037557 XM_039393 XM_039570 XM_039676 XM_039908 XM_042066 XM_042301 XM_042698 XM_042936 XM_043493 XM_044178 XM_045290 XM_045911 XM_046581 XM_048128 XM_048592 XM_049078 XM_049237 XM_051081 XM_051200 XM_056455 XM_058513 XM_059482 XM_059578 XM_059689 XM_059832 XM_059929 XM_061890 XM_067585 XM_084529 XM_084990 XM_085151 XM_085833 XM_086001 XM_086360 XM_086937 XM_087137 XM_087353 XM_087386 XM_087490 XM_087672 XM_088459 XM_093839 XM_096733 XM_097265 XM_097977 XM_113743 XM_113763 XM_113947 XM_114303 XM_114735 XM_117117 XM_117294 XM_166103 XM_166132 XM_166164 XM_166227 XM_166320 XM_167044 XM_167147 XM_168530 XM_171054 XM_208043 XM_208058 XM_208097 XM_208333 XM_208361 XM_208438 XM_208658 XM_208990 XM_209196 XM_209363 XM_209569 XM_209604 XM_209656 XM_209700 XM_209741 XM_209824 XM_210048 XM_211028 XM_212061 XM_212170 XM_212319 XM_290401 XM_290527 XM_290547 XM_290597 XM_290615 XM_291019 XM_291095 XM_291128 XM_291154 XM_291262 XM_291344 XM_291671 XM_291729 XM_291947 XM_292357 XM_292717 XM_293828 XM_294521 XM_295091 XM_295155 XM_298045 XM_350880 XM_351948 XM_370564 XM_370603 XM_370607 XM_370654 XM_370664 XM_370665 XM_370837 XM_370838 XM_370843 XM_370876 XM_370878 XM_370917 XM_370928 XM_371015 XM_371074 XM_371132 XM_371176 XM_371204 XM_371214 XM_371254 XM_371302 XM_371304 XM_371369 XM_371474 XM_371588 XM_371590 XM_371592 XM_371632 XM_371655 XM_371664 XM_371741 XM_371754 XM_371760 XM_371761 XM_371777 XM_371783 XM_371837 XM_371838 XM_371845 XM_371891 XM_371933 XM_371936 XM_372013 XM_372019 XM_372028 XM_372030 XM_372038 XM_372090 XM_372097 XM_372205 XM_372233 XM_372239 XM_372267 XM_372556 XM_372584 XM_372723 XM_373468 XM_373472 XM_373509 XM_373513 XM_373561 XM_373562 XM_373587 XM_373682 XM_373748 XM_373765 XM_373779 XM_373780 XM_373827 XM_373854 XM_373883 XM_373974 XM_374013 XM_374067 XM_374124 XM_374236 XM_374295 XM_374317 XM_374343 XM_374399 XM_374422 XM_374435 XM_374484 XM_374491 XM_374768 XM_374803 XM_374912 XM_374915 XM_374945 XM_374973 XM_375029 XM_375033 XM_375041 XM_375065 XM_375081 XM_375152 XM_375185 XM_375373 XM_375378 XM_375424 XM_375456 XM_375608 XM_375619 XM_375646 XM_375697 XM_375698 XM_375816 XM_375821 XM_376018 XM_376062 XM_376247 XM_376254 XM_376269 XM_376284 XM_376320 XM_376334 XM_376350 XM_376372 XM_376412 XM_376436 XM_376560 XM_376586 XM_376588 XM_376607 XM_376679 XM_376727 XM_376784 XM_376795 XM_376843 XM_376869 XM_376902 XM_376905 XM_376986 XM_377002 XM_377041 XM_377053 XM_377742 XM_378203 XM_378208 XM_378236 XM_378238 XM_378239 XM_378240 XM_378259 XM_378316 XM_378321 XM_378327 XM_378356 XM_378360 XM_378362 XM_378367 XM_378374 XM_378389 XM_378399 XM_378411 XM_378430 XM_378453 XM_378456 XM_378460 XM_378473 XM_378507 XM_378512 XM_378516 XM_378542 XM_378544 XM_378545 XM_378553 XM_378567 XM_378589 XM_378606 XM_378620 XM_378653 XM_378661 XM_378667 XM_378678 XM_378685 XM_378686 XM_378700 XM_378701 XM_378705 XM_378708 XM_378746 XM_378787 XM_378799 XM_378832 XM_378843 XM_378855 XM_378883 XM_378886 XM_378908 XM_378914 XM_378925 XM_378946 XM_378949 XM_378964 XM_378982 XM_379041 XM_379044 XM_379060 XM_379075 XM_379094 XM_379096 XM_379114 XM_379135 XM_379136 XM_379141 XM_379146 XM_379154 XM_379184 XM_379194 XM_379203 XM_379205 XM_379215 XM_379260 XM_379267 XM_379276 XM_379280 XM_379299 XM_379363 XM_379371 XM_379378 XM_379380 XM_379386 XM_379391 XM_379402 XM_379403 XM_379406 XM_379409 XM_379417 XM_379452 XM_379454 XM_379458 XM_379474 XM_379484 XM_379485 XM_379506 XM_379507 XM_379510 XM_379515 XM_379535 XM_379543 XM_379584 XM_379594 XM_379595 XM_379597 XM_379619 XM_379622 XM_379637 XM_379648 XM_379650 XM_379651 XM_379664 XM_379665 XM_379694 XM_379704 XM_379722 XM_379736 XM_379798 XM_379800 XM_379827 XM_379851 XM_379877 XM_379927 XM_379933 XM_379979 XM_380089 XM_380100 XM_380103 XM_380104 XM_380127 XM_380128 XM_380131 XM_380139 XM_380160 XM_495814 XM_495844 XM_495881 XM_495886 XM_495888 XM_495890 XM_495891 XM_495907 XM_495909 XM_495918 XM_495926 XM_495940 XM_495950 XM_495982 XM_495996 XM_496036 XM_496050 XM_496056 XM_496076 XM_496134 XM_496239 XM_496241 XM_496268 XM_496391 XM_496394 XM_496399 XM_496401 XM_496431 XM_496436 XM_496467 XM_496547 XM_496576 XM_496597 XM_496620 XM_496635 XM_496661 XM_496688 XM_496690 XM_496692 XM_496701 XM_496720 XM_496726 XM_496740 XM_496777 XM_496780 XM_496781 XM_496804 XM_496826 XM_496844 XM_496895 XM_496907 XM_496943 XM_496945 XM_496946 XM_496947 XM_496948 XM_496949 XM_496951 XM_496952 XM_496953 XM_496954 XM_496955 XM_496956 XM_496957 XM_496959 XM_496960 XM_496961 XM_496966 XM_496981 XM_496983 XM_496984 XM_496985 XM_497014 XM_497036 XM_497089 XM_498422 XM_498427 XM_498435 XM_498436 XM_498437 XM_498440 XM_498441 XM_498442 XM_498443 XM_498445 XM_498446 XM_498448 XM_498449 XM_498451 XM_498456 XM_498464 XM_498465 XM_498467 XM_498469 XM_498473 XM_498487 XM_498489 XM_498490 XM_498497 XM_498508 XM_498515 XM_498525 XM_498532 XM_498534 XM_498540 XM_498546 XM_498552 XM_498553 XM_498555 XM_498557 XM_498578 XM_498614 XM_498624 XM_498646 XM_498649 XM_498659 XM_498660 XM_498675 XM_498677 XM_498679 XM_498739 XM_498751 XM_498816 XM_498826 XM_498828 XM_498829 XM_498841 XM_498883 XM_498884 XM_498894 XM_498899 XM_498902 XM_498910 XM_498917 XM_498919 XM_498946 XM_498948 XM_498958 XM_498981 XM_498995 XM_498998 XM_499008 XM_499025 XM_499031 XM_499048 XM_499057 XM_499072 XM_499076 XM_499093 XM_499105 XM_499117 XM_499120 XM_499121 XM_499122 XM_499130 XM_499142 XM_499147 XM_499152 XM_499158 XM_499176 XM_499181 XM_499182 XM_499272 XM_499309 XM_499323 XM_499343 XM_499362 XM_499392 XM_499502 XM_499505 XM_499525 XM_499550 XM_499564 XM_499566 XM_499570 XM_499571 XM_499572 XM_499573 XM_499575 XM_499576 XM_499579 XM_499581 XM_499582 XM_499594 XM_499595 XM_499597 XR_000182 XR_000195 XR_000216 XR_000227 XR_000263 XR_000275 XR_000292
Genes with multiple seed matches:
NM_000028 NM_000053 NM_000090 NM_000091 NM_000103 NM_000104 NM_000112 NM_000133 NM_000136 NM_000153 NM_000165 NM_000222 NM_000232 NM_000240 NM_000248 NM_000264 NM_000321 NM_000330 NM_000369 NM_000382 NM_000391 NM_000411 NM_000452 NM_000484 NM_000486 NM_000538 NM_000555 NM_000584 NM_000585 NM_000605 NM_000610 NM_000611 NM_000629 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000661 NM_000663 NM_000664 NM_000686 NM_000702 NM_000706 NM_000791 NM_000806 NM_000809 NM_000817 NM_000838 NM_000861 NM_000896 NM_000899 NM_000902 NM_000935 NM_000945 NM_000950 NM_000953 NM_000959 NM_000963 NM_001001188 NM_001001323 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001419 NM_001001420 NM_001001433 NM_001001434 NM_001001481 NM_001001482 NM_001001523 NM_001001664 NM_001001677 NM_001001684 NM_001001685 NM_001001707 NM_001001711 NM_001001890 NM_001001924 NM_001001925 NM_001001927 NM_001001928 NM_001001929 NM_001001930 NM_001001931 NM_001001936 NM_001002257 NM_001002260 NM_001002762 NM_001002811 NM_001002812 NM_001002814 NM_001002860 NM_001002926 NM_001003652 NM_001003681 NM_001003689 NM_001003715 NM_001003716 NM_001003800 NM_001004301 NM_001004308 NM_001004332 NM_001004339 NM_001004360 NM_001005158 NM_001005159 NM_001005266 NM_001005267 NM_001005268 NM_001005269 NM_001005387 NM_001005388 NM_001005473 NM_001005609 NM_001005743 NM_001005744 NM_001005745 NM_001005845 NM_001005918 NM_001006932 NM_001006947 NM_001007024 NM_001007025 NM_001007072 NM_001007097 NM_001007098 NM_001007237 NM_001007254 NM_001007278 NM_001007538 NM_001008211 NM_001008212 NM_001008213 NM_001008215 NM_001008220 NM_001008239 NM_001008392 NM_001008393 NM_001008408 NM_001008493 NM_001008529 NM_001008564 NM_001008566 NM_001008738 NM_001008801 NM_001008925 NM_001009554 NM_001009909 NM_001009922 NM_001010000 NM_001010846 NM_001010852 NM_001010867 NM_001010888 NM_001010898 NM_001010910 NM_001010915 NM_001010925 NM_001010935 NM_001011537 NM_001011546 NM_001011552 NM_001011664 NM_001011709 NM_001011720 NM_001012279 NM_001012339 NM_001012424 NM_001012651 NM_001012709 NM_001012733 NM_001012734 NM_001012755 NM_001012968 NM_001012993 NM_001013000 NM_001013005 NM_001013031 NM_001013681 NM_001013719 NM_001013839 NM_001014380 NM_001014797 NM_001014839 NM_001014841 NM_001015048 NM_001015049 NM_001015051 NM_001015877 NM_001015880 NM_001015886 NM_001017440 NM_001017924 NM_001017970 NM_001017972 NM_001017979 NM_001017989 NM_001018058 NM_001018065 NM_001018066 NM_001018092 NM_001018093 NM_001018094 NM_001018097 NM_001018098 NM_001023563 NM_001023566 NM_001024463 NM_001024630 NM_001024649 NM_001024657 NM_001024688 NM_001024843 NM_001024921 NM_001025076 NM_001025077 NM_001025079 NM_001025080 NM_001025100 NM_001025247 NM_001080 NM_001126 NM_001128 NM_001131 NM_001148 NM_001160 NM_001167 NM_001178 NM_001187 NM_001222 NM_001227 NM_001259 NM_001303 NM_001304 NM_001333 NM_001380 NM_001382 NM_001387 NM_001390 NM_001399 NM_001412 NM_001419 NM_001460 NM_001465 NM_001490 NM_001542 NM_001560 NM_001609 NM_001682 NM_001695 NM_001701 NM_001746 NM_001754 NM_001755 NM_001777 NM_001830 NM_001833 NM_001845 NM_001858 NM_001872 NM_001920 NM_001933 NM_001952 NM_001966 NM_001969 NM_001991 NM_002000 NM_002006 NM_002015 NM_002025 NM_002033 NM_002039 NM_002040 NM_002061 NM_002063 NM_002071 NM_002131 NM_002182 NM_002267 NM_002271 NM_002357 NM_002373 NM_002397 NM_002398 NM_002423 NM_002460 NM_002481 NM_002485 NM_002501 NM_002514 NM_002540 NM_002547 NM_002556 NM_002576 NM_002577 NM_002579 NM_002595 NM_002610 NM_002613 NM_002662 NM_002677 NM_002709 NM_002711 NM_002715 NM_002716 NM_002731 NM_002736 NM_002760 NM_002816 NM_002834 NM_002838 NM_002847 NM_002849 NM_002869 NM_002874 NM_002875 NM_002884 NM_002886 NM_002906 NM_002938 NM_002941 NM_002942 NM_002959 NM_002971 NM_003001 NM_003027 NM_003042 NM_003051 NM_003060 NM_003104 NM_003108 NM_003115 NM_003137 NM_003161 NM_003182 NM_003188 NM_003189 NM_003216 NM_003217 NM_003218 NM_003262 NM_003326 NM_003382 NM_003392 NM_003404 NM_003406 NM_003417 NM_003419 NM_003435 NM_003439 NM_003446 NM_003457 NM_003463 NM_003471 NM_003483 NM_003528 NM_003558 NM_003574 NM_003590 NM_003594 NM_003595 NM_003605 NM_003622 NM_003629 NM_003643 NM_003644 NM_003681 NM_003722 NM_003724 NM_003743 NM_003744 NM_003749 NM_003759 NM_003763 NM_003784 NM_003799 NM_003816 NM_003848 NM_003870 NM_003872 NM_003895 NM_003898 NM_003901 NM_003930 NM_003932 NM_003958 NM_003994 NM_003998 NM_004060 NM_004064 NM_004133 NM_004155 NM_004171 NM_004229 NM_004274 NM_004293 NM_004296 NM_004319 NM_004342 NM_004348 NM_004350 NM_004385 NM_004394 NM_004397 NM_004398 NM_004405 NM_004457 NM_004480 NM_004496 NM_004505 NM_004507 NM_004520 NM_004566 NM_004571 NM_004586 NM_004598 NM_004600 NM_004602 NM_004612 NM_004670 NM_004681 NM_004687 NM_004735 NM_004744 NM_004745 NM_004786 NM_004792 NM_004801 NM_004834 NM_004849 NM_004863 NM_004866 NM_004871 NM_004872 NM_004873 NM_004921 NM_004992 NM_005010 NM_005036 NM_005045 NM_005057 NM_005060 NM_005065 NM_005076 NM_005082 NM_005100 NM_005109 NM_005112 NM_005114 NM_005160 NM_005168 NM_005188 NM_005254 NM_005296 NM_005316 NM_005388 NM_005399 NM_005400 NM_005433 NM_005436 NM_005437 NM_005455 NM_005487 NM_005502 NM_005517 NM_005523 NM_005536 NM_005544 NM_005588 NM_005647 NM_005658 NM_005665 NM_005682 NM_005748 NM_005752 NM_005798 NM_005808 NM_005828 NM_005839 NM_005843 NM_005857 NM_005871 NM_005901 NM_005903 NM_005906 NM_005935 NM_006016 NM_006022 NM_006033 NM_006043 NM_006045 NM_006047 NM_006055 NM_006113 NM_006141 NM_006162 NM_006166 NM_006212 NM_006238 NM_006243 NM_006246 NM_006275 NM_006277 NM_006282 NM_006283 NM_006298 NM_006315 NM_006317 NM_006322 NM_006329 NM_006379 NM_006403 NM_006452 NM_006454 NM_006459 NM_006464 NM_006465 NM_006466 NM_006520 NM_006534 NM_006546 NM_006561 NM_006572 NM_006599 NM_006614 NM_006624 NM_006625 NM_006626 NM_006628 NM_006650 NM_006698 NM_006699 NM_006722 NM_006729 NM_006731 NM_006749 NM_006775 NM_006783 NM_006785 NM_006805 NM_006868 NM_006870 NM_006902 NM_006905 NM_006930 NM_006940 NM_006947 NM_006955 NM_006961 NM_006965 NM_006969 NM_006974 NM_006999 NM_007008 NM_007010 NM_007038 NM_007073 NM_007096 NM_007106 NM_007123 NM_007146 NM_007171 NM_007212 NM_007257 NM_007287 NM_007288 NM_007289 NM_007306 NM_007331 NM_007345 NM_007375 NM_012073 NM_012074 NM_012080 NM_012104 NM_012129 NM_012199 NM_012224 NM_012231 NM_012232 NM_012247 NM_012252 NM_012262 NM_012279 NM_012287 NM_012288 NM_012304 NM_012325 NM_012329 NM_012345 NM_012347 NM_012388 NM_012393 NM_012397 NM_012399 NM_012405 NM_012464 NM_012465 NM_012471 NM_013229 NM_013232 NM_013233 NM_013252 NM_013255 NM_013260 NM_013374 NM_013380 NM_013385 NM_013996 NM_013997 NM_013998 NM_014016 NM_014048 NM_014061 NM_014089 NM_014106 NM_014112 NM_014141 NM_014211 NM_014220 NM_014228 NM_014240 NM_014245 NM_014250 NM_014251 NM_014284 NM_014345 NM_014350 NM_014363 NM_014382 NM_014388 NM_014395 NM_014411 NM_014458 NM_014480 NM_014498 NM_014506 NM_014571 NM_014586 NM_014616 NM_014631 NM_014637 NM_014656 NM_014659 NM_014674 NM_014682 NM_014702 NM_014721 NM_014730 NM_014743 NM_014746 NM_014760 NM_014762 NM_014765 NM_014797 NM_014801 NM_014805 NM_014809 NM_014830 NM_014851 NM_014873 NM_014889 NM_014906 NM_014912 NM_014918 NM_014926 NM_014946 NM_014953 NM_014959 NM_014991 NM_014997 NM_014999 NM_015020 NM_015022 NM_015025 NM_015032 NM_015033 NM_015045 NM_015051 NM_015056 NM_015057 NM_015064 NM_015074 NM_015076 NM_015077 NM_015085 NM_015088 NM_015090 NM_015100 NM_015149 NM_015173 NM_015176 NM_015192 NM_015205 NM_015208 NM_015215 NM_015219 NM_015225 NM_015230 NM_015250 NM_015251 NM_015271 NM_015278 NM_015286 NM_015288 NM_015296 NM_015299 NM_015305 NM_015310 NM_015338 NM_015346 NM_015347 NM_015349 NM_015361 NM_015375 NM_015385 NM_015387 NM_015393 NM_015423 NM_015429 NM_015436 NM_015455 NM_015470 NM_015472 NM_015478 NM_015493 NM_015509 NM_015526 NM_015534 NM_015553 NM_015569 NM_015575 NM_015576 NM_015578 NM_015602 NM_015635 NM_015713 NM_015878 NM_015886 NM_015981 NM_016023 NM_016063 NM_016072 NM_016096 NM_016097 NM_016100 NM_016114 NM_016120 NM_016131 NM_016200 NM_016217 NM_016275 NM_016280 NM_016315 NM_016322 NM_016329 NM_016353 NM_016376 NM_016413 NM_016436 NM_016442 NM_016472 NM_016530 NM_016540 NM_016575 NM_016603 NM_016607 NM_016622 NM_016651 NM_016654 NM_016831 NM_017452 NM_017453 NM_017454 NM_017460 NM_017489 NM_017491 NM_017540 NM_017542 NM_017545 NM_017548 NM_017554 NM_017582 NM_017599 NM_017626 NM_017634 NM_017656 NM_017662 NM_017719 NM_017762 NM_017769 NM_017776 NM_017787 NM_017801 NM_017813 NM_017824 NM_017841 NM_017855 NM_017873 NM_017952 NM_017968 NM_017988 NM_017990 NM_018011 NM_018017 NM_018018 NM_018037 NM_018046 NM_018047 NM_018130 NM_018133 NM_018137 NM_018169 NM_018170 NM_018172 NM_018194 NM_018200 NM_018206 NM_018212 NM_018221 NM_018240 NM_018243 NM_018247 NM_018252 NM_018254 NM_018283 NM_018298 NM_018299 NM_018323 NM_018348 NM_018362 NM_018364 NM_018371 NM_018376 NM_018416 NM_018424 NM_018439 NM_018440 NM_018445 NM_018475 NM_018518 NM_018566 NM_018639 NM_018684 NM_018710 NM_018712 NM_018837 NM_018841 NM_018945 NM_018976 NM_019001 NM_019006 NM_019008 NM_019012 NM_019022 NM_019080 NM_019084 NM_019089 NM_019595 NM_019857 NM_020038 NM_020133 NM_020151 NM_020164 NM_020177 NM_020182 NM_020198 NM_020228 NM_020335 NM_020341 NM_020342 NM_020367 NM_020368 NM_020384 NM_020390 NM_020398 NM_020416 NM_020425 NM_020443 NM_020467 NM_020472 NM_020473 NM_020532 NM_020546 NM_020552 NM_020553 NM_020654 NM_020657 NM_020673 NM_020674 NM_020675 NM_020686 NM_020698 NM_020738 NM_020742 NM_020749 NM_020766 NM_020774 NM_020776 NM_020782 NM_020783 NM_020784 NM_020796 NM_020803 NM_020810 NM_020826 NM_020861 NM_020868 NM_020870 NM_020914 NM_020918 NM_020921 NM_020935 NM_020940 NM_020948 NM_020967 NM_020977 NM_020980 NM_021033 NM_021038 NM_021083 NM_021105 NM_021116 NM_021133 NM_021135 NM_021163 NM_021167 NM_021183 NM_021204 NM_021255 NM_021645 NM_021728 NM_021804 NM_021809 NM_021813 NM_021814 NM_021815 NM_021946 NM_021949 NM_021950 NM_021980 NM_021998 NM_022041 NM_022048 NM_022102 NM_022103 NM_022151 NM_022445 NM_022459 NM_022474 NM_022477 NM_022480 NM_022491 NM_022568 NM_022716 NM_022733 NM_022737 NM_022754 NM_022780 NM_022820 NM_022842 NM_022843 NM_022845 NM_022893 NM_022894 NM_022900 NM_022918 NM_023002 NM_023073 NM_023107 NM_023108 NM_024080 NM_024295 NM_024312 NM_024554 NM_024590 NM_024607 NM_024624 NM_024626 NM_024641 NM_024646 NM_024665 NM_024758 NM_024763 NM_024810 NM_024834 NM_024874 NM_024938 NM_024944 NM_024989 NM_024996 NM_025000 NM_025010 NM_025054 NM_025164 NM_025191 NM_025219 NM_030625 NM_030764 NM_030777 NM_030780 NM_030781 NM_030805 NM_030806 NM_030812 NM_030820 NM_030899 NM_030911 NM_030918 NM_030924 NM_030962 NM_031226 NM_031244 NM_031268 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031417 NM_031418 NM_031426 NM_031435 NM_031445 NM_031462 NM_031468 NM_031476 NM_031483 NM_031854 NM_031890 NM_031911 NM_032013 NM_032041 NM_032042 NM_032105 NM_032116 NM_032124 NM_032138 NM_032189 NM_032208 NM_032226 NM_032228 NM_032264 NM_032268 NM_032288 NM_032291 NM_032317 NM_032322 NM_032352 NM_032368 NM_032373 NM_032383 NM_032440 NM_032458 NM_032467 NM_032486 NM_032490 NM_032550 NM_032554 NM_032576 NM_032579 NM_032664 NM_032737 NM_032740 NM_032826 NM_032828 NM_032846 NM_032861 NM_032873 NM_032905 NM_032916 NM_032933 NM_032975 NM_032980 NM_033102 NM_033112 NM_033121 NM_033138 NM_033139 NM_033140 NM_033157 NM_033206 NM_033211 NM_033274 NM_033288 NM_033338 NM_033339 NM_033340 NM_033397 NM_033480 NM_033481 NM_033505 NM_033631 NM_033656 NM_052811 NM_052818 NM_052822 NM_052879 NM_052887 NM_052900 NM_052918 NM_052937 NM_052941 NM_053002 NM_053023 NM_053277 NM_053286 NM_057095 NM_057096 NM_057175 NM_058170 NM_058175 NM_058217 NM_078483 NM_080618 NM_080657 NM_080678 NM_080737 NM_080764 NM_080832 NM_080867 NM_080872 NM_080876 NM_080921 NM_080922 NM_080927 NM_080928 NM_130386 NM_130842 NM_130843 NM_130846 NM_133269 NM_133271 NM_133272 NM_133273 NM_133274 NM_133277 NM_133278 NM_133329 NM_133334 NM_133371 NM_133372 NM_133468 NM_133477 NM_133487 NM_133503 NM_133504 NM_133505 NM_133506 NM_133507 NM_133631 NM_133646 NM_134434 NM_138287 NM_138335 NM_138347 NM_138357 NM_138640 NM_138694 NM_138713 NM_138714 NM_138735 NM_138782 NM_138813 NM_138971 NM_138972 NM_138973 NM_139016 NM_139182 NM_139244 NM_139267 NM_139275 NM_139323 NM_144497 NM_144578 NM_144591 NM_144599 NM_144607 NM_144626 NM_144629 NM_144632 NM_144721 NM_145013 NM_145034 NM_145053 NM_145055 NM_145115 NM_145117 NM_145165 NM_145257 NM_145276 NM_145307 NM_145331 NM_145332 NM_145333 NM_145646 NM_145686 NM_145687 NM_145690 NM_145693 NM_145728 NM_145735 NM_145756 NM_145800 NM_145802 NM_145808 NM_145809 NM_145891 NM_145892 NM_145893 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145909 NM_147131 NM_147132 NM_147147 NM_147188 NM_147189 NM_147195 NM_147202 NM_147223 NM_147233 NM_148170 NM_148174 NM_148957 NM_152261 NM_152300 NM_152382 NM_152387 NM_152433 NM_152436 NM_152437 NM_152484 NM_152527 NM_152551 NM_152563 NM_152588 NM_152619 NM_152624 NM_152695 NM_152703 NM_152717 NM_152722 NM_152731 NM_152745 NM_152774 NM_152838 NM_152866 NM_152903 NM_152989 NM_152995 NM_152996 NM_153010 NM_153028 NM_153029 NM_153042 NM_153226 NM_153231 NM_153261 NM_153262 NM_153332 NM_153334 NM_153371 NM_153451 NM_153456 NM_153607 NM_153686 NM_153688 NM_153756 NM_153828 NM_153836 NM_170609 NM_170679 NM_170705 NM_170721 NM_170740 NM_170771 NM_171825 NM_172127 NM_172128 NM_172159 NM_172160 NM_172169 NM_172170 NM_172171 NM_172172 NM_172173 NM_172174 NM_172175 NM_172337 NM_172344 NM_172387 NM_172388 NM_172389 NM_173054 NM_173214 NM_173470 NM_173536 NM_173545 NM_173551 NM_173570 NM_173582 NM_173589 NM_173609 NM_173611 NM_173632 NM_173644 NM_173654 NM_173664 NM_173675 NM_173678 NM_173828 NM_173844 NM_173851 NM_174871 NM_174900 NM_175058 NM_175061 NM_175569 NM_175733 NM_175745 NM_175767 NM_175852 NM_175859 NM_176815 NM_176816 NM_176871 NM_177436 NM_177538 NM_177947 NM_177948 NM_177990 NM_177999 NM_178010 NM_178011 NM_178037 NM_178038 NM_178039 NM_178040 NM_178140 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178439 NM_178468 NM_178470 NM_178509 NM_178565 NM_178585 NM_178860 NM_180991 NM_181332 NM_181358 NM_181484 NM_181502 NM_181504 NM_181523 NM_181524 NM_181527 NM_181528 NM_181644 NM_181659 NM_181723 NM_181789 NM_181826 NM_181827 NM_181834 NM_181847 NM_181861 NM_181868 NM_181869 NM_181876 NM_182485 NM_182503 NM_182540 NM_182551 NM_182564 NM_182568 NM_182579 NM_182585 NM_182621 NM_182646 NM_182700 NM_182734 NM_182740 NM_182751 NM_182757 NM_182765 NM_182895 NM_182933 NM_182934 NM_182935 NM_182943 NM_182948 NM_182964 NM_182978 NM_183004 NM_183063 NM_183078 NM_183237 NM_183238 NM_183353 NM_183382 NM_183422 NM_194283 NM_194286 NM_194314 NM_194317 NM_194318 NM_194324 NM_194434 NM_197939 NM_198123 NM_198124 NM_198148 NM_198158 NM_198159 NM_198177 NM_198178 NM_198256 NM_198257 NM_198258 NM_198268 NM_198269 NM_198270 NM_198321 NM_198325 NM_198392 NM_198439 NM_198457 NM_198485 NM_198511 NM_198530 NM_198584 NM_198596 NM_198682 NM_198715 NM_198793 NM_198835 NM_198844 NM_198859 NM_198893 NM_198896 NM_198956 NM_198992 NM_199000 NM_199005 NM_199045 NM_199050 NM_199132 NM_199169 NM_199170 NM_199171 NM_199188 NM_199190 NM_199246 NM_199335 NM_199421 NM_199436 NM_199437 NM_199438 NM_199439 NM_199462 NM_199482 NM_201252 NM_201266 NM_201279 NM_201413 NM_201414 NM_201432 NM_201433 NM_201524 NM_201525 NM_201994 NM_203316 NM_203329 NM_203330 NM_203331 NM_203350 NM_203372 NM_203381 NM_203395 NM_203446 NM_203459 NM_203463 NM_205857 NM_206853 NM_206854 NM_206855 NM_206876 NM_206877 NM_206909 NM_207123 NM_207171 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207333 NM_207366 NM_207367 NM_207372 NM_207404 NM_207412 NM_207430 NM_207434 NM_207440 NM_207470 NM_207483 NM_207520 NM_207521 NM_207644 NM_207672 NM_212540 NM_213566 NM_213590 NM_213723 XM_017374 XM_027236 XM_027307 XM_028810 XM_031553 XM_032945 XM_039570 XM_042066 XM_049078 XM_051081 XM_051200 XM_059832 XM_067585 XM_087137 XM_096733 XM_113743 XM_113947 XM_114735 XM_117117 XM_166164 XM_166320 XM_167044 XM_168530 XM_208097 XM_208990 XM_209700 XM_210048 XM_290597 XM_290615 XM_291128 XM_291154 XM_291344 XM_291671 XM_291729 XM_370603 XM_370654 XM_370838 XM_370878 XM_370928 XM_371132 XM_371254 XM_371369 XM_371592 XM_371741 XM_371760 XM_372090 XM_372205 XM_372267 XM_372723 XM_373682 XM_373827 XM_374013 XM_374295 XM_374435 XM_374484 XM_374912 XM_374915 XM_374945 XM_375373 XM_375378 XM_375608 XM_375646 XM_375821 XM_376018 XM_376269 XM_376284 XM_376350 XM_376412 XM_376436 XM_376679 XM_376795 XM_376869 XM_376902 XM_377053 XM_378203 XM_378236 XM_378238 XM_378362 XM_378389 XM_378453 XM_378456 XM_378667 XM_378678 XM_378700 XM_378701 XM_378708 XM_378746 XM_378843 XM_379094 XM_379096 XM_379114 XM_379141 XM_379154 XM_379260 XM_379267 XM_379280 XM_379386 XM_379409 XM_379452 XM_379535 XM_379595 XM_379619 XM_379622 XM_379637 XM_379664 XM_379665 XM_379704 XM_379933 XM_380160 XM_495844 XM_495886 XM_495909 XM_495918 XM_495982 XM_496050 XM_496268 XM_496436 XM_496467 XM_496547 XM_496688 XM_497014 XM_498456 XM_498490 XM_498532 XM_498660 XM_498828 XM_498829 XM_498841 XM_498894 XM_498998 XM_499008 XM_499105 XM_499130 XM_499309 XR_000195 XR_000275
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)