VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"aacggggagcuaaacacucca"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
6156
.
Total Genes with multiple seed matches:
1667
.
Genes with at least one seed match:
NM_000022 NM_000024 NM_000025 NM_000033 NM_000034 NM_000046 NM_000051 NM_000052 NM_000053 NM_000068 NM_000069 NM_000074 NM_000088 NM_000091 NM_000092 NM_000098 NM_000112 NM_000113 NM_000114 NM_000120 NM_000125 NM_000132 NM_000136 NM_000139 NM_000142 NM_000150 NM_000151 NM_000153 NM_000172 NM_000176 NM_000178 NM_000199 NM_000209 NM_000212 NM_000219 NM_000230 NM_000240 NM_000245 NM_000248 NM_000252 NM_000254 NM_000264 NM_000268 NM_000272 NM_000274 NM_000276 NM_000278 NM_000281 NM_000285 NM_000291 NM_000299 NM_000303 NM_000304 NM_000310 NM_000322 NM_000330 NM_000332 NM_000333 NM_000334 NM_000337 NM_000347 NM_000348 NM_000355 NM_000356 NM_000362 NM_000364 NM_000376 NM_000378 NM_000382 NM_000383 NM_000385 NM_000388 NM_000391 NM_000394 NM_000398 NM_000399 NM_000402 NM_000406 NM_000409 NM_000415 NM_000417 NM_000423 NM_000425 NM_000428 NM_000435 NM_000437 NM_000439 NM_000441 NM_000442 NM_000445 NM_000457 NM_000458 NM_000476 NM_000478 NM_000480 NM_000497 NM_000498 NM_000500 NM_000507 NM_000511 NM_000515 NM_000520 NM_000527 NM_000533 NM_000538 NM_000545 NM_000551 NM_000555 NM_000557 NM_000561 NM_000565 NM_000573 NM_000577 NM_000579 NM_000593 NM_000598 NM_000599 NM_000609 NM_000610 NM_000611 NM_000620 NM_000626 NM_000628 NM_000629 NM_000635 NM_000651 NM_000657 NM_000660 NM_000663 NM_000664 NM_000677 NM_000683 NM_000691 NM_000695 NM_000702 NM_000704 NM_000719 NM_000721 NM_000725 NM_000726 NM_000733 NM_000734 NM_000745 NM_000747 NM_000751 NM_000755 NM_000757 NM_000767 NM_000781 NM_000791 NM_000799 NM_000800 NM_000801 NM_000805 NM_000807 NM_000810 NM_000816 NM_000817 NM_000821 NM_000832 NM_000834 NM_000845 NM_000848 NM_000849 NM_000859 NM_000861 NM_000869 NM_000870 NM_000875 NM_000876 NM_000877 NM_000890 NM_000891 NM_000893 NM_000896 NM_000898 NM_000899 NM_000901 NM_000902 NM_000916 NM_000917 NM_000922 NM_000923 NM_000930 NM_000931 NM_000942 NM_000949 NM_000950 NM_000951 NM_000960 NM_000961 NM_000962 NM_000984 NM_000991 NM_000997 NM_001001132 NM_001001188 NM_001001331 NM_001001349 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001395 NM_001001396 NM_001001412 NM_001001414 NM_001001419 NM_001001420 NM_001001430 NM_001001431 NM_001001432 NM_001001433 NM_001001434 NM_001001484 NM_001001549 NM_001001550 NM_001001555 NM_001001557 NM_001001561 NM_001001661 NM_001001662 NM_001001663 NM_001001664 NM_001001670 NM_001001671 NM_001001679 NM_001001680 NM_001001681 NM_001001683 NM_001001684 NM_001001685 NM_001001690 NM_001001694 NM_001001697 NM_001001698 NM_001001699 NM_001001701 NM_001001702 NM_001001704 NM_001001707 NM_001001709 NM_001001715 NM_001001788 NM_001001789 NM_001001794 NM_001001851 NM_001001873 NM_001001875 NM_001001890 NM_001001891 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001001991 NM_001001994 NM_001001995 NM_001001996 NM_001002000 NM_001002001 NM_001002002 NM_001002009 NM_001002010 NM_001002026 NM_001002231 NM_001002232 NM_001002233 NM_001002261 NM_001002262 NM_001002760 NM_001002761 NM_001002762 NM_001002799 NM_001002814 NM_001002840 NM_001002844 NM_001002861 NM_001002862 NM_001002876 NM_001002912 NM_001002924 NM_001003398 NM_001003399 NM_001003407 NM_001003408 NM_001003652 NM_001003665 NM_001003674 NM_001003675 NM_001003684 NM_001003694 NM_001003716 NM_001003722 NM_001003790 NM_001003791 NM_001003794 NM_001003800 NM_001003801 NM_001003802 NM_001003807 NM_001003812 NM_001003931 NM_001003935 NM_001003941 NM_001003962 NM_001004126 NM_001004285 NM_001004286 NM_001004300 NM_001004301 NM_001004302 NM_001004304 NM_001004305 NM_001004307 NM_001004320 NM_001004322 NM_001004325 NM_001004328 NM_001004332 NM_001004335 NM_001004336 NM_001004339 NM_001004343 NM_001004347 NM_001004348 NM_001004349 NM_001004355 NM_001004356 NM_001004358 NM_001004426 NM_001004434 NM_001004439 NM_001005209 NM_001005210 NM_001005217 NM_001005271 NM_001005273 NM_001005336 NM_001005337 NM_001005353 NM_001005360 NM_001005361 NM_001005362 NM_001005372 NM_001005387 NM_001005388 NM_001005405 NM_001005408 NM_001005417 NM_001005474 NM_001005502 NM_001005505 NM_001005609 NM_001005610 NM_001005612 NM_001005614 NM_001005737 NM_001005746 NM_001005747 NM_001005753 NM_001005782 NM_001005918 NM_001006115 NM_001006116 NM_001006603 NM_001006615 NM_001006616 NM_001006617 NM_001006619 NM_001006620 NM_001006621 NM_001006623 NM_001006638 NM_001006656 NM_001006932 NM_001006944 NM_001006946 NM_001007024 NM_001007025 NM_001007071 NM_001007094 NM_001007169 NM_001007214 NM_001007224 NM_001007225 NM_001007240 NM_001007241 NM_001007242 NM_001007269 NM_001007270 NM_001007277 NM_001007278 NM_001007466 NM_001007525 NM_001007529 NM_001007534 NM_001007538 NM_001007540 NM_001007543 NM_001007545 NM_001007560 NM_001008211 NM_001008212 NM_001008213 NM_001008220 NM_001008224 NM_001008234 NM_001008239 NM_001008392 NM_001008395 NM_001008401 NM_001008404 NM_001008406 NM_001008408 NM_001008491 NM_001008492 NM_001008493 NM_001008494 NM_001008529 NM_001008535 NM_001008536 NM_001008537 NM_001008564 NM_001008566 NM_001008567 NM_001008572 NM_001008656 NM_001008736 NM_001008742 NM_001008745 NM_001008756 NM_001008781 NM_001008801 NM_001008860 NM_001008892 NM_001008894 NM_001008938 NM_001009553 NM_001009566 NM_001009567 NM_001009598 NM_001009880 NM_001009883 NM_001009913 NM_001009932 NM_001009933 NM_001009934 NM_001009954 NM_001009956 NM_001009960 NM_001009996 NM_001010846 NM_001010851 NM_001010864 NM_001010866 NM_001010867 NM_001010871 NM_001010874 NM_001010879 NM_001010882 NM_001010883 NM_001010898 NM_001010913 NM_001010915 NM_001010917 NM_001010969 NM_001010971 NM_001010980 NM_001011513 NM_001011514 NM_001011540 NM_001011547 NM_001011554 NM_001011664 NM_001011708 NM_001011885 NM_001012239 NM_001012264 NM_001012267 NM_001012270 NM_001012271 NM_001012278 NM_001012300 NM_001012329 NM_001012333 NM_001012334 NM_001012339 NM_001012361 NM_001012393 NM_001012426 NM_001012427 NM_001012478 NM_001012508 NM_001012511 NM_001012642 NM_001012643 NM_001012651 NM_001012659 NM_001012710 NM_001012711 NM_001012720 NM_001012722 NM_001012729 NM_001012733 NM_001012734 NM_001012754 NM_001012755 NM_001012763 NM_001012960 NM_001012982 NM_001012987 NM_001012988 NM_001012993 NM_001013000 NM_001013002 NM_001013005 NM_001013031 NM_001013398 NM_001013615 NM_001013617 NM_001013619 NM_001013624 NM_001013634 NM_001013635 NM_001013637 NM_001013648 NM_001013649 NM_001013650 NM_001013651 NM_001013655 NM_001013656 NM_001013667 NM_001013669 NM_001013671 NM_001013673 NM_001013675 NM_001013677 NM_001013678 NM_001013679 NM_001013682 NM_001013687 NM_001013688 NM_001013690 NM_001013693 NM_001013695 NM_001013701 NM_001013703 NM_001013705 NM_001013706 NM_001013710 NM_001013718 NM_001013719 NM_001013720 NM_001013721 NM_001013724 NM_001013725 NM_001013746 NM_001013748 NM_001013839 NM_001014283 NM_001014342 NM_001014373 NM_001014374 NM_001014436 NM_001014450 NM_001014796 NM_001014797 NM_001014809 NM_001014831 NM_001014832 NM_001014833 NM_001014834 NM_001014835 NM_001014839 NM_001014841 NM_001015051 NM_001015053 NM_001015881 NM_001015886 NM_001017370 NM_001017388 NM_001017392 NM_001017396 NM_001017418 NM_001017440 NM_001017535 NM_001017916 NM_001017917 NM_001017918 NM_001017925 NM_001017929 NM_001017962 NM_001017967 NM_001017980 NM_001017989 NM_001017995 NM_001018003 NM_001018016 NM_001018017 NM_001018021 NM_001018050 NM_001018051 NM_001018052 NM_001018055 NM_001018057 NM_001018064 NM_001018065 NM_001018066 NM_001018067 NM_001018068 NM_001018069 NM_001018071 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018089 NM_001018090 NM_001018091 NM_001018092 NM_001018093 NM_001018094 NM_001018096 NM_001018097 NM_001018098 NM_001018099 NM_001018102 NM_001018108 NM_001018111 NM_001020825 NM_001023560 NM_001023565 NM_001024094 NM_001024215 NM_001024216 NM_001024226 NM_001024227 NM_001024228 NM_001024380 NM_001024381 NM_001024401 NM_001024460 NM_001024463 NM_001024596 NM_001024610 NM_001024630 NM_001024649 NM_001024660 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024676 NM_001024733 NM_001024808 NM_001024843 NM_001024844 NM_001024847 NM_001024858 NM_001024937 NM_001024947 NM_001024957 NM_001024959 NM_001024960 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025108 NM_001025158 NM_001025159 NM_001025193 NM_001025202 NM_001025231 NM_001025242 NM_001025243 NM_001025266 NM_001025295 NM_001036 NM_001037 NM_001038 NM_001049 NM_001065 NM_001066 NM_001080 NM_001081 NM_001089 NM_001092 NM_001093 NM_001094 NM_001095 NM_001097 NM_001100 NM_001103 NM_001105 NM_001110 NM_001116 NM_001120 NM_001125 NM_001126 NM_001127 NM_001129 NM_001148 NM_001152 NM_001155 NM_001157 NM_001163 NM_001167 NM_001168 NM_001176 NM_001177 NM_001188 NM_001190 NM_001191 NM_001197 NM_001198 NM_001204 NM_001219 NM_001224 NM_001226 NM_001230 NM_001232 NM_001233 NM_001235 NM_001247 NM_001251 NM_001254 NM_001259 NM_001267 NM_001277 NM_001278 NM_001282 NM_001284 NM_001286 NM_001287 NM_001288 NM_001291 NM_001294 NM_001295 NM_001296 NM_001299 NM_001303 NM_001307 NM_001313 NM_001315 NM_001317 NM_001318 NM_001319 NM_001330 NM_001331 NM_001332 NM_001334 NM_001337 NM_001344 NM_001361 NM_001365 NM_001384 NM_001388 NM_001390 NM_001394 NM_001399 NM_001406 NM_001407 NM_001410 NM_001414 NM_001419 NM_001420 NM_001440 NM_001447 NM_001451 NM_001454 NM_001457 NM_001458 NM_001478 NM_001481 NM_001491 NM_001497 NM_001498 NM_001502 NM_001503 NM_001520 NM_001521 NM_001532 NM_001535 NM_001541 NM_001543 NM_001544 NM_001549 NM_001552 NM_001554 NM_001557 NM_001562 NM_001569 NM_001587 NM_001617 NM_001619 NM_001621 NM_001627 NM_001631 NM_001636 NM_001647 NM_001655 NM_001658 NM_001659 NM_001664 NM_001667 NM_001670 NM_001672 NM_001678 NM_001683 NM_001684 NM_001696 NM_001701 NM_001703 NM_001709 NM_001711 NM_001714 NM_001716 NM_001722 NM_001728 NM_001734 NM_001742 NM_001746 NM_001749 NM_001754 NM_001759 NM_001761 NM_001785 NM_001789 NM_001795 NM_001796 NM_001800 NM_001810 NM_001821 NM_001824 NM_001832 NM_001834 NM_001835 NM_001841 NM_001848 NM_001858 NM_001859 NM_001874 NM_001878 NM_001897 NM_001898 NM_001899 NM_001905 NM_001908 NM_001910 NM_001915 NM_001918 NM_001928 NM_001934 NM_001937 NM_001938 NM_001941 NM_001942 NM_001944 NM_001945 NM_001949 NM_001951 NM_001957 NM_001975 NM_001978 NM_001982 NM_001987 NM_001990 NM_001991 NM_001992 NM_002003 NM_002012 NM_002014 NM_002016 NM_002023 NM_002025 NM_002028 NM_002048 NM_002052 NM_002060 NM_002061 NM_002062 NM_002065 NM_002069 NM_002073 NM_002074 NM_002076 NM_002077 NM_002080 NM_002081 NM_002084 NM_002096 NM_002098 NM_002099 NM_002101 NM_002103 NM_002111 NM_002118 NM_002119 NM_002126 NM_002128 NM_002131 NM_002143 NM_002147 NM_002154 NM_002158 NM_002180 NM_002190 NM_002191 NM_002200 NM_002203 NM_002204 NM_002209 NM_002221 NM_002224 NM_002230 NM_002231 NM_002234 NM_002237 NM_002239 NM_002241 NM_002246 NM_002249 NM_002250 NM_002254 NM_002255 NM_002264 NM_002271 NM_002275 NM_002281 NM_002285 NM_002289 NM_002293 NM_002298 NM_002304 NM_002309 NM_002313 NM_002340 NM_002347 NM_002357 NM_002359 NM_002360 NM_002367 NM_002373 NM_002375 NM_002382 NM_002386 NM_002389 NM_002391 NM_002393 NM_002396 NM_002399 NM_002401 NM_002404 NM_002405 NM_002417 NM_002419 NM_002423 NM_002429 NM_002437 NM_002438 NM_002439 NM_002441 NM_002442 NM_002444 NM_002447 NM_002451 NM_002454 NM_002456 NM_002463 NM_002473 NM_002474 NM_002478 NM_002481 NM_002482 NM_002483 NM_002496 NM_002501 NM_002505 NM_002513 NM_002522 NM_002531 NM_002538 NM_002540 NM_002543 NM_002544 NM_002545 NM_002547 NM_002552 NM_002556 NM_002560 NM_002561 NM_002562 NM_002570 NM_002576 NM_002578 NM_002579 NM_002581 NM_002588 NM_002590 NM_002594 NM_002596 NM_002602 NM_002604 NM_002608 NM_002609 NM_002612 NM_002613 NM_002629 NM_002632 NM_002637 NM_002641 NM_002644 NM_002646 NM_002649 NM_002653 NM_002654 NM_002655 NM_002657 NM_002658 NM_002663 NM_002664 NM_002666 NM_002668 NM_002675 NM_002702 NM_002705 NM_002707 NM_002710 NM_002713 NM_002714 NM_002717 NM_002718 NM_002725 NM_002737 NM_002747 NM_002751 NM_002754 NM_002756 NM_002760 NM_002768 NM_002773 NM_002776 NM_002791 NM_002820 NM_002827 NM_002832 NM_002833 NM_002840 NM_002846 NM_002847 NM_002853 NM_002859 NM_002866 NM_002871 NM_002872 NM_002895 NM_002900 NM_002904 NM_002908 NM_002913 NM_002914 NM_002921 NM_002928 NM_002934 NM_002938 NM_002945 NM_002948 NM_002959 NM_002971 NM_002974 NM_002975 NM_002982 NM_002985 NM_002990 NM_002996 NM_002997 NM_003003 NM_003004 NM_003013 NM_003015 NM_003021 NM_003023 NM_003025 NM_003029 NM_003033 NM_003038 NM_003043 NM_003044 NM_003045 NM_003047 NM_003055 NM_003060 NM_003068 NM_003072 NM_003074 NM_003076 NM_003077 NM_003078 NM_003082 NM_003087 NM_003101 NM_003108 NM_003110 NM_003113 NM_003118 NM_003120 NM_003127 NM_003131 NM_003139 NM_003149 NM_003150 NM_003151 NM_003152 NM_003153 NM_003155 NM_003156 NM_003161 NM_003167 NM_003179 NM_003180 NM_003183 NM_003185 NM_003192 NM_003200 NM_003202 NM_003204 NM_003214 NM_003216 NM_003217 NM_003219 NM_003240 NM_003242 NM_003247 NM_003254 NM_003255 NM_003258 NM_003264 NM_003272 NM_003277 NM_003281 NM_003288 NM_003307 NM_003313 NM_003317 NM_003320 NM_003324 NM_003326 NM_003337 NM_003342 NM_003343 NM_003347 NM_003349 NM_003352 NM_003370 NM_003371 NM_003373 NM_003379 NM_003380 NM_003387 NM_003394 NM_003404 NM_003405 NM_003407 NM_003417 NM_003421 NM_003423 NM_003426 NM_003427 NM_003436 NM_003439 NM_003450 NM_003458 NM_003462 NM_003466 NM_003472 NM_003480 NM_003483 NM_003486 NM_003489 NM_003494 NM_003502 NM_003505 NM_003528 NM_003557 NM_003560 NM_003575 NM_003576 NM_003586 NM_003593 NM_003595 NM_003597 NM_003598 NM_003605 NM_003617 NM_003621 NM_003629 NM_003633 NM_003634 NM_003636 NM_003637 NM_003641 NM_003644 NM_003648 NM_003654 NM_003656 NM_003657 NM_003661 NM_003666 NM_003672 NM_003676 NM_003677 NM_003680 NM_003681 NM_003682 NM_003683 NM_003687 NM_003690 NM_003695 NM_003706 NM_003708 NM_003722 NM_003726 NM_003727 NM_003731 NM_003735 NM_003736 NM_003740 NM_003741 NM_003748 NM_003757 NM_003763 NM_003768 NM_003774 NM_003777 NM_003780 NM_003781 NM_003799 NM_003807 NM_003808 NM_003810 NM_003811 NM_003831 NM_003834 NM_003839 NM_003850 NM_003855 NM_003856 NM_003862 NM_003867 NM_003869 NM_003870 NM_003872 NM_003874 NM_003881 NM_003882 NM_003889 NM_003895 NM_003896 NM_003897 NM_003916 NM_003921 NM_003924 NM_003925 NM_003930 NM_003936 NM_003938 NM_003939 NM_003942 NM_003944 NM_003947 NM_003950 NM_003953 NM_003959 NM_003961 NM_003963 NM_003966 NM_003983 NM_003984 NM_003987 NM_003988 NM_003989 NM_003990 NM_003993 NM_003994 NM_003996 NM_003999 NM_004003 NM_004019 NM_004033 NM_004035 NM_004041 NM_004047 NM_004049 NM_004050 NM_004058 NM_004060 NM_004064 NM_004077 NM_004078 NM_004079 NM_004080 NM_004082 NM_004086 NM_004089 NM_004090 NM_004091 NM_004093 NM_004094 NM_004096 NM_004097 NM_004104 NM_004112 NM_004117 NM_004120 NM_004123 NM_004130 NM_004132 NM_004135 NM_004142 NM_004145 NM_004160 NM_004171 NM_004172 NM_004177 NM_004184 NM_004185 NM_004193 NM_004194 NM_004200 NM_004204 NM_004213 NM_004216 NM_004220 NM_004223 NM_004226 NM_004231 NM_004233 NM_004259 NM_004262 NM_004272 NM_004273 NM_004283 NM_004286 NM_004293 NM_004296 NM_004297 NM_004302 NM_004308 NM_004311 NM_004315 NM_004316 NM_004319 NM_004321 NM_004329 NM_004332 NM_004338 NM_004348 NM_004350 NM_004352 NM_004355 NM_004360 NM_004363 NM_004367 NM_004375 NM_004379 NM_004382 NM_004386 NM_004387 NM_004391 NM_004393 NM_004395 NM_004399 NM_004401 NM_004402 NM_004404 NM_004405 NM_004408 NM_004411 NM_004423 NM_004426 NM_004427 NM_004428 NM_004429 NM_004430 NM_004433 NM_004442 NM_004454 NM_004464 NM_004468 NM_004473 NM_004474 NM_004480 NM_004481 NM_004482 NM_004484 NM_004486 NM_004487 NM_004488 NM_004494 NM_004495 NM_004501 NM_004503 NM_004504 NM_004505 NM_004507 NM_004513 NM_004514 NM_004515 NM_004518 NM_004520 NM_004523 NM_004530 NM_004535 NM_004549 NM_004554 NM_004558 NM_004560 NM_004568 NM_004571 NM_004573 NM_004579 NM_004586 NM_004597 NM_004598 NM_004603 NM_004608 NM_004613 NM_004615 NM_004624 NM_004626 NM_004634 NM_004635 NM_004640 NM_004644 NM_004646 NM_004657 NM_004658 NM_004678 NM_004686 NM_004687 NM_004697 NM_004700 NM_004710 NM_004711 NM_004716 NM_004729 NM_004730 NM_004731 NM_004735 NM_004736 NM_004737 NM_004738 NM_004744 NM_004745 NM_004756 NM_004759 NM_004762 NM_004772 NM_004781 NM_004787 NM_004804 NM_004807 NM_004808 NM_004816 NM_004817 NM_004821 NM_004823 NM_004824 NM_004827 NM_004839 NM_004840 NM_004843 NM_004845 NM_004850 NM_004863 NM_004869 NM_004871 NM_004872 NM_004874 NM_004878 NM_004879 NM_004892 NM_004893 NM_004905 NM_004907 NM_004918 NM_004921 NM_004922 NM_004925 NM_004927 NM_004932 NM_004933 NM_004935 NM_004936 NM_004938 NM_004943 NM_004945 NM_004947 NM_004948 NM_004949 NM_004952 NM_004959 NM_004962 NM_004980 NM_004983 NM_004992 NM_004995 NM_004996 NM_004998 NM_005018 NM_005027 NM_005030 NM_005036 NM_005042 NM_005044 NM_005054 NM_005055 NM_005057 NM_005063 NM_005065 NM_005069 NM_005070 NM_005073 NM_005076 NM_005081 NM_005093 NM_005094 NM_005096 NM_005098 NM_005108 NM_005116 NM_005117 NM_005118 NM_005128 NM_005133 NM_005135 NM_005137 NM_005144 NM_005149 NM_005151 NM_005156 NM_005157 NM_005165 NM_005169 NM_005173 NM_005177 NM_005178 NM_005184 NM_005185 NM_005187 NM_005188 NM_005189 NM_005191 NM_005198 NM_005199 NM_005202 NM_005207 NM_005211 NM_005216 NM_005219 NM_005224 NM_005226 NM_005229 NM_005231 NM_005232 NM_005242 NM_005248 NM_005253 NM_005256 NM_005257 NM_005258 NM_005262 NM_005263 NM_005274 NM_005276 NM_005278 NM_005279 NM_005281 NM_005310 NM_005311 NM_005312 NM_005314 NM_005318 NM_005324 NM_005329 NM_005334 NM_005338 NM_005342 NM_005347 NM_005370 NM_005371 NM_005373 NM_005374 NM_005376 NM_005388 NM_005392 NM_005397 NM_005400 NM_005407 NM_005413 NM_005417 NM_005419 NM_005424 NM_005425 NM_005430 NM_005431 NM_005434 NM_005436 NM_005439 NM_005443 NM_005449 NM_005451 NM_005458 NM_005465 NM_005466 NM_005471 NM_005472 NM_005474 NM_005476 NM_005479 NM_005480 NM_005485 NM_005493 NM_005501 NM_005512 NM_005516 NM_005519 NM_005523 NM_005527 NM_005529 NM_005538 NM_005539 NM_005543 NM_005551 NM_005552 NM_005553 NM_005556 NM_005575 NM_005581 NM_005584 NM_005608 NM_005619 NM_005628 NM_005629 NM_005630 NM_005632 NM_005634 NM_005656 NM_005658 NM_005665 NM_005668 NM_005672 NM_005676 NM_005678 NM_005682 NM_005683 NM_005686 NM_005688 NM_005699 NM_005704 NM_005707 NM_005709 NM_005714 NM_005715 NM_005718 NM_005725 NM_005727 NM_005729 NM_005730 NM_005732 NM_005736 NM_005737 NM_005759 NM_005762 NM_005767 NM_005768 NM_005775 NM_005779 NM_005780 NM_005785 NM_005793 NM_005796 NM_005798 NM_005803 NM_005808 NM_005814 NM_005816 NM_005817 NM_005819 NM_005822 NM_005823 NM_005828 NM_005835 NM_005837 NM_005840 NM_005842 NM_005844 NM_005850 NM_005852 NM_005858 NM_005860 NM_005865 NM_005879 NM_005884 NM_005886 NM_005897 NM_005901 NM_005902 NM_005903 NM_005907 NM_005914 NM_005920 NM_005931 NM_005933 NM_005935 NM_005957 NM_005963 NM_005967 NM_005975 NM_005985 NM_005988 NM_005989 NM_005992 NM_005993 NM_005999 NM_006001 NM_006011 NM_006020 NM_006029 NM_006030 NM_006031 NM_006032 NM_006034 NM_006035 NM_006037 NM_006038 NM_006042 NM_006043 NM_006045 NM_006051 NM_006054 NM_006056 NM_006057 NM_006059 NM_006060 NM_006062 NM_006065 NM_006077 NM_006085 NM_006087 NM_006088 NM_006089 NM_006091 NM_006094 NM_006113 NM_006116 NM_006122 NM_006125 NM_006131 NM_006133 NM_006134 NM_006139 NM_006145 NM_006148 NM_006154 NM_006155 NM_006162 NM_006165 NM_006166 NM_006176 NM_006180 NM_006182 NM_006184 NM_006187 NM_006190 NM_006191 NM_006201 NM_006202 NM_006205 NM_006206 NM_006212 NM_006221 NM_006235 NM_006244 NM_006262 NM_006265 NM_006276 NM_006282 NM_006283 NM_006288 NM_006289 NM_006291 NM_006298 NM_006301 NM_006306 NM_006310 NM_006315 NM_006317 NM_006321 NM_006329 NM_006334 NM_006336 NM_006337 NM_006338 NM_006344 NM_006345 NM_006348 NM_006349 NM_006351 NM_006354 NM_006359 NM_006361 NM_006371 NM_006373 NM_006377 NM_006378 NM_006387 NM_006389 NM_006390 NM_006403 NM_006408 NM_006411 NM_006413 NM_006415 NM_006421 NM_006426 NM_006449 NM_006452 NM_006455 NM_006457 NM_006465 NM_006481 NM_006492 NM_006494 NM_006500 NM_006502 NM_006504 NM_006516 NM_006517 NM_006521 NM_006534 NM_006538 NM_006546 NM_006547 NM_006548 NM_006555 NM_006557 NM_006559 NM_006561 NM_006565 NM_006593 NM_006599 NM_006605 NM_006606 NM_006613 NM_006615 NM_006617 NM_006621 NM_006626 NM_006627 NM_006629 NM_006631 NM_006636 NM_006640 NM_006646 NM_006650 NM_006653 NM_006661 NM_006668 NM_006669 NM_006672 NM_006673 NM_006675 NM_006678 NM_006683 NM_006685 NM_006687 NM_006690 NM_006697 NM_006699 NM_006702 NM_006720 NM_006722 NM_006725 NM_006730 NM_006731 NM_006732 NM_006734 NM_006736 NM_006737 NM_006748 NM_006752 NM_006760 NM_006761 NM_006762 NM_006766 NM_006772 NM_006780 NM_006795 NM_006803 NM_006813 NM_006818 NM_006845 NM_006847 NM_006852 NM_006873 NM_006889 NM_006890 NM_006899 NM_006901 NM_006907 NM_006913 NM_006919 NM_006926 NM_006931 NM_006936 NM_006940 NM_006941 NM_006944 NM_006945 NM_006946 NM_006952 NM_006955 NM_006959 NM_006961 NM_006969 NM_006984 NM_006990 NM_006991 NM_006994 NM_006995 NM_007014 NM_007021 NM_007030 NM_007033 NM_007047 NM_007048 NM_007050 NM_007055 NM_007058 NM_007061 NM_007064 NM_007066 NM_007068 NM_007073 NM_007077 NM_007078 NM_007079 NM_007097 NM_007098 NM_007108 NM_007118 NM_007144 NM_007148 NM_007151 NM_007157 NM_007159 NM_007163 NM_007174 NM_007175 NM_007177 NM_007185 NM_007189 NM_007193 NM_007202 NM_007210 NM_007211 NM_007213 NM_007224 NM_007229 NM_007238 NM_007243 NM_007245 NM_007249 NM_007259 NM_007261 NM_007271 NM_007279 NM_007283 NM_007287 NM_007288 NM_007289 NM_007292 NM_007294 NM_007295 NM_007296 NM_007297 NM_007298 NM_007299 NM_007300 NM_007301 NM_007302 NM_007303 NM_007304 NM_007305 NM_007306 NM_007312 NM_007313 NM_007317 NM_007326 NM_007327 NM_007331 NM_007335 NM_007336 NM_007338 NM_007357 NM_007362 NM_007363 NM_007367 NM_009586 NM_009588 NM_012072 NM_012074 NM_012080 NM_012091 NM_012098 NM_012101 NM_012102 NM_012104 NM_012106 NM_012118 NM_012126 NM_012137 NM_012144 NM_012146 NM_012156 NM_012171 NM_012172 NM_012174 NM_012179 NM_012184 NM_012186 NM_012188 NM_012193 NM_012197 NM_012199 NM_012201 NM_012206 NM_012211 NM_012219 NM_012227 NM_012229 NM_012231 NM_012232 NM_012233 NM_012236 NM_012237 NM_012238 NM_012244 NM_012262 NM_012263 NM_012264 NM_012266 NM_012279 NM_012285 NM_012288 NM_012290 NM_012295 NM_012297 NM_012300 NM_012304 NM_012306 NM_012308 NM_012309 NM_012312 NM_012313 NM_012314 NM_012320 NM_012323 NM_012324 NM_012325 NM_012326 NM_012329 NM_012332 NM_012346 NM_012347 NM_012388 NM_012395 NM_012396 NM_012398 NM_012400 NM_012402 NM_012405 NM_012409 NM_012414 NM_012424 NM_012425 NM_012426 NM_012427 NM_012434 NM_012436 NM_012447 NM_012448 NM_012458 NM_012468 NM_012470 NM_012479 NM_013230 NM_013233 NM_013243 NM_013245 NM_013250 NM_013253 NM_013255 NM_013257 NM_013258 NM_013260 NM_013262 NM_013268 NM_013276 NM_013279 NM_013284 NM_013286 NM_013289 NM_013309 NM_013313 NM_013315 NM_013323 NM_013334 NM_013335 NM_013336 NM_013337 NM_013341 NM_013345 NM_013356 NM_013361 NM_013368 NM_013372 NM_013375 NM_013381 NM_013382 NM_013387 NM_013388 NM_013389 NM_013399 NM_013402 NM_013403 NM_013404 NM_013410 NM_013422 NM_013432 NM_013433 NM_013443 NM_013444 NM_013447 NM_013943 NM_013951 NM_013952 NM_013953 NM_013992 NM_013995 NM_014000 NM_014002 NM_014005 NM_014007 NM_014020 NM_014023 NM_014028 NM_014030 NM_014045 NM_014046 NM_014048 NM_014058 NM_014063 NM_014066 NM_014080 NM_014089 NM_014110 NM_014112 NM_014139 NM_014147 NM_014149 NM_014155 NM_014157 NM_014171 NM_014172 NM_014173 NM_014186 NM_014207 NM_014212 NM_014213 NM_014216 NM_014218 NM_014219 NM_014225 NM_014231 NM_014235 NM_014252 NM_014263 NM_014268 NM_014276 NM_014284 NM_014285 NM_014293 NM_014298 NM_014313 NM_014321 NM_014323 NM_014326 NM_014328 NM_014336 NM_014359 NM_014365 NM_014376 NM_014382 NM_014385 NM_014393 NM_014396 NM_014403 NM_014405 NM_014412 NM_014417 NM_014418 NM_014424 NM_014427 NM_014431 NM_014434 NM_014445 NM_014446 NM_014453 NM_014456 NM_014458 NM_014460 NM_014463 NM_014469 NM_014472 NM_014474 NM_014479 NM_014480 NM_014488 NM_014491 NM_014494 NM_014504 NM_014506 NM_014511 NM_014513 NM_014521 NM_014547 NM_014550 NM_014553 NM_014554 NM_014556 NM_014564 NM_014573 NM_014577 NM_014586 NM_014587 NM_014591 NM_014600 NM_014603 NM_014604 NM_014608 NM_014610 NM_014613 NM_014615 NM_014616 NM_014631 NM_014634 NM_014635 NM_014636 NM_014656 NM_014659 NM_014661 NM_014662 NM_014665 NM_014667 NM_014671 NM_014674 NM_014680 NM_014681 NM_014682 NM_014686 NM_014690 NM_014694 NM_014700 NM_014703 NM_014707 NM_014711 NM_014712 NM_014714 NM_014717 NM_014719 NM_014720 NM_014723 NM_014725 NM_014726 NM_014730 NM_014732 NM_014734 NM_014736 NM_014741 NM_014742 NM_014745 NM_014747 NM_014756 NM_014757 NM_014759 NM_014761 NM_014762 NM_014766 NM_014767 NM_014772 NM_014781 NM_014784 NM_014787 NM_014788 NM_014789 NM_014793 NM_014799 NM_014802 NM_014805 NM_014810 NM_014812 NM_014820 NM_014829 NM_014830 NM_014837 NM_014840 NM_014844 NM_014848 NM_014849 NM_014850 NM_014851 NM_014854 NM_014860 NM_014861 NM_014862 NM_014864 NM_014867 NM_014870 NM_014873 NM_014876 NM_014880 NM_014891 NM_014898 NM_014899 NM_014902 NM_014903 NM_014904 NM_014906 NM_014910 NM_014911 NM_014919 NM_014924 NM_014926 NM_014930 NM_014935 NM_014940 NM_014944 NM_014947 NM_014948 NM_014953 NM_014959 NM_014961 NM_014965 NM_014969 NM_014974 NM_014988 NM_014994 NM_015000 NM_015002 NM_015015 NM_015020 NM_015022 NM_015023 NM_015033 NM_015035 NM_015039 NM_015044 NM_015050 NM_015052 NM_015063 NM_015064 NM_015065 NM_015070 NM_015071 NM_015072 NM_015074 NM_015076 NM_015077 NM_015082 NM_015085 NM_015086 NM_015088 NM_015090 NM_015092 NM_015094 NM_015100 NM_015101 NM_015103 NM_015107 NM_015111 NM_015113 NM_015115 NM_015132 NM_015133 NM_015134 NM_015138 NM_015140 NM_015141 NM_015150 NM_015151 NM_015155 NM_015158 NM_015162 NM_015163 NM_015171 NM_015176 NM_015178 NM_015185 NM_015187 NM_015192 NM_015194 NM_015200 NM_015202 NM_015205 NM_015206 NM_015215 NM_015219 NM_015226 NM_015236 NM_015245 NM_015253 NM_015254 NM_015257 NM_015259 NM_015260 NM_015264 NM_015285 NM_015288 NM_015289 NM_015299 NM_015305 NM_015310 NM_015315 NM_015318 NM_015326 NM_015327 NM_015328 NM_015329 NM_015330 NM_015332 NM_015340 NM_015343 NM_015344 NM_015347 NM_015349 NM_015352 NM_015353 NM_015358 NM_015375 NM_015378 NM_015380 NM_015381 NM_015386 NM_015395 NM_015399 NM_015407 NM_015416 NM_015417 NM_015428 NM_015430 NM_015443 NM_015448 NM_015453 NM_015458 NM_015460 NM_015463 NM_015470 NM_015481 NM_015488 NM_015493 NM_015497 NM_015508 NM_015509 NM_015518 NM_015527 NM_015532 NM_015537 NM_015553 NM_015556 NM_015557 NM_015564 NM_015569 NM_015575 NM_015585 NM_015603 NM_015609 NM_015621 NM_015626 NM_015640 NM_015645 NM_015651 NM_015657 NM_015658 NM_015659 NM_015660 NM_015666 NM_015680 NM_015686 NM_015691 NM_015692 NM_015705 NM_015716 NM_015717 NM_015719 NM_015720 NM_015725 NM_015836 NM_015865 NM_015868 NM_015873 NM_015881 NM_015891 NM_015892 NM_015911 NM_015922 NM_015941 NM_015945 NM_015947 NM_015949 NM_015974 NM_015981 NM_015985 NM_015989 NM_015994 NM_015995 NM_016022 NM_016025 NM_016048 NM_016055 NM_016063 NM_016065 NM_016079 NM_016085 NM_016087 NM_016089 NM_016094 NM_016100 NM_016101 NM_016109 NM_016112 NM_016114 NM_016118 NM_016119 NM_016123 NM_016146 NM_016147 NM_016162 NM_016169 NM_016173 NM_016188 NM_016201 NM_016202 NM_016206 NM_016210 NM_016220 NM_016233 NM_016234 NM_016239 NM_016240 NM_016243 NM_016255 NM_016257 NM_016261 NM_016263 NM_016272 NM_016275 NM_016280 NM_016297 NM_016332 NM_016339 NM_016353 NM_016363 NM_016369 NM_016371 NM_016376 NM_016391 NM_016396 NM_016418 NM_016422 NM_016426 NM_016431 NM_016433 NM_016436 NM_016452 NM_016453 NM_016458 NM_016474 NM_016488 NM_016489 NM_016505 NM_016506 NM_016518 NM_016526 NM_016530 NM_016540 NM_016541 NM_016543 NM_016544 NM_016545 NM_016546 NM_016551 NM_016553 NM_016563 NM_016573 NM_016575 NM_016576 NM_016577 NM_016579 NM_016588 NM_016590 NM_016591 NM_016605 NM_016613 NM_016621 NM_016622 NM_016632 NM_016643 NM_016647 NM_016732 NM_016735 NM_016815 NM_016831 NM_016929 NM_016948 NM_017410 NM_017415 NM_017417 NM_017423 NM_017424 NM_017444 NM_017449 NM_017451 NM_017456 NM_017460 NM_017483 NM_017485 NM_017486 NM_017488 NM_017495 NM_017514 NM_017519 NM_017521 NM_017523 NM_017540 NM_017549 NM_017555 NM_017556 NM_017563 NM_017565 NM_017567 NM_017569 NM_017575 NM_017582 NM_017583 NM_017585 NM_017588 NM_017590 NM_017592 NM_017594 NM_017595 NM_017600 NM_017617 NM_017621 NM_017637 NM_017638 NM_017644 NM_017645 NM_017649 NM_017651 NM_017655 NM_017656 NM_017659 NM_017662 NM_017668 NM_017669 NM_017679 NM_017681 NM_017686 NM_017693 NM_017699 NM_017705 NM_017707 NM_017713 NM_017723 NM_017728 NM_017731 NM_017736 NM_017740 NM_017741 NM_017751 NM_017754 NM_017759 NM_017760 NM_017770 NM_017772 NM_017774 NM_017778 NM_017781 NM_017784 NM_017793 NM_017797 NM_017811 NM_017821 NM_017823 NM_017825 NM_017828 NM_017831 NM_017833 NM_017842 NM_017848 NM_017849 NM_017850 NM_017853 NM_017861 NM_017866 NM_017868 NM_017872 NM_017873 NM_017882 NM_017887 NM_017893 NM_017902 NM_017907 NM_017908 NM_017909 NM_017910 NM_017912 NM_017919 NM_017920 NM_017924 NM_017927 NM_017928 NM_017946 NM_017951 NM_017952 NM_017955 NM_017966 NM_017979 NM_017986 NM_017990 NM_017999 NM_018003 NM_018011 NM_018017 NM_018022 NM_018023 NM_018026 NM_018028 NM_018029 NM_018032 NM_018035 NM_018037 NM_018048 NM_018061 NM_018066 NM_018068 NM_018071 NM_018075 NM_018076 NM_018077 NM_018095 NM_018097 NM_018098 NM_018108 NM_018114 NM_018119 NM_018128 NM_018131 NM_018134 NM_018141 NM_018145 NM_018152 NM_018153 NM_018154 NM_018155 NM_018156 NM_018159 NM_018166 NM_018168 NM_018171 NM_018176 NM_018178 NM_018181 NM_018182 NM_018185 NM_018194 NM_018198 NM_018199 NM_018201 NM_018205 NM_018209 NM_018212 NM_018214 NM_018215 NM_018224 NM_018226 NM_018229 NM_018233 NM_018235 NM_018237 NM_018238 NM_018239 NM_018244 NM_018260 NM_018264 NM_018265 NM_018267 NM_018271 NM_018273 NM_018275 NM_018277 NM_018292 NM_018294 NM_018295 NM_018304 NM_018306 NM_018312 NM_018316 NM_018320 NM_018324 NM_018332 NM_018340 NM_018344 NM_018347 NM_018355 NM_018358 NM_018370 NM_018379 NM_018382 NM_018384 NM_018385 NM_018390 NM_018393 NM_018400 NM_018401 NM_018409 NM_018425 NM_018426 NM_018438 NM_018439 NM_018440 NM_018449 NM_018463 NM_018484 NM_018488 NM_018518 NM_018534 NM_018556 NM_018566 NM_018569 NM_018607 NM_018639 NM_018640 NM_018641 NM_018644 NM_018650 NM_018652 NM_018653 NM_018655 NM_018656 NM_018658 NM_018664 NM_018684 NM_018689 NM_018697 NM_018704 NM_018706 NM_018712 NM_018715 NM_018717 NM_018719 NM_018727 NM_018728 NM_018841 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018931 NM_018941 NM_018943 NM_018945 NM_018947 NM_018962 NM_018976 NM_018977 NM_018981 NM_018990 NM_018991 NM_018992 NM_018993 NM_018994 NM_019001 NM_019008 NM_019011 NM_019012 NM_019014 NM_019022 NM_019027 NM_019032 NM_019034 NM_019039 NM_019040 NM_019041 NM_019046 NM_019055 NM_019061 NM_019067 NM_019069 NM_019071 NM_019072 NM_019085 NM_019089 NM_019094 NM_019096 NM_019099 NM_019106 NM_019117 NM_019118 NM_019556 NM_019601 NM_019604 NM_019624 NM_019625 NM_019848 NM_019850 NM_019857 NM_019862 NM_019863 NM_019885 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020039 NM_020064 NM_020119 NM_020122 NM_020125 NM_020126 NM_020132 NM_020133 NM_020134 NM_020139 NM_020141 NM_020142 NM_020148 NM_020149 NM_020151 NM_020167 NM_020168 NM_020170 NM_020178 NM_020181 NM_020182 NM_020184 NM_020190 NM_020197 NM_020200 NM_020201 NM_020208 NM_020211 NM_020215 NM_020230 NM_020239 NM_020245 NM_020248 NM_020251 NM_020309 NM_020314 NM_020315 NM_020336 NM_020337 NM_020338 NM_020340 NM_020341 NM_020348 NM_020350 NM_020374 NM_020377 NM_020384 NM_020390 NM_020397 NM_020402 NM_020405 NM_020414 NM_020416 NM_020418 NM_020421 NM_020422 NM_020429 NM_020431 NM_020433 NM_020439 NM_020444 NM_020447 NM_020448 NM_020451 NM_020456 NM_020462 NM_020465 NM_020472 NM_020473 NM_020474 NM_020526 NM_020535 NM_020546 NM_020550 NM_020552 NM_020553 NM_020631 NM_020638 NM_020647 NM_020648 NM_020655 NM_020657 NM_020661 NM_020686 NM_020695 NM_020698 NM_020699 NM_020701 NM_020704 NM_020708 NM_020713 NM_020717 NM_020724 NM_020728 NM_020732 NM_020742 NM_020745 NM_020746 NM_020750 NM_020754 NM_020760 NM_020762 NM_020768 NM_020769 NM_020772 NM_020773 NM_020777 NM_020778 NM_020782 NM_020786 NM_020792 NM_020795 NM_020802 NM_020803 NM_020804 NM_020813 NM_020815 NM_020816 NM_020825 NM_020826 NM_020828 NM_020830 NM_020834 NM_020839 NM_020844 NM_020845 NM_020850 NM_020858 NM_020860 NM_020867 NM_020870 NM_020877 NM_020894 NM_020896 NM_020898 NM_020899 NM_020909 NM_020914 NM_020917 NM_020918 NM_020925 NM_020946 NM_020951 NM_020954 NM_020956 NM_020960 NM_020962 NM_020970 NM_020971 NM_020972 NM_020977 NM_020988 NM_020991 NM_020993 NM_021008 NM_021020 NM_021035 NM_021036 NM_021038 NM_021044 NM_021045 NM_021067 NM_021076 NM_021078 NM_021079 NM_021088 NM_021090 NM_021093 NM_021100 NM_021103 NM_021116 NM_021117 NM_021131 NM_021133 NM_021135 NM_021137 NM_021155 NM_021167 NM_021168 NM_021178 NM_021181 NM_021189 NM_021200 NM_021201 NM_021202 NM_021215 NM_021216 NM_021218 NM_021222 NM_021226 NM_021235 NM_021238 NM_021242 NM_021245 NM_021249 NM_021255 NM_021257 NM_021269 NM_021569 NM_021602 NM_021619 NM_021627 NM_021628 NM_021629 NM_021635 NM_021638 NM_021648 NM_021652 NM_021705 NM_021721 NM_021734 NM_021735 NM_021736 NM_021737 NM_021783 NM_021813 NM_021815 NM_021818 NM_021822 NM_021827 NM_021828 NM_021832 NM_021907 NM_021908 NM_021915 NM_021916 NM_021922 NM_021923 NM_021935 NM_021937 NM_021939 NM_021945 NM_021950 NM_021953 NM_021961 NM_021962 NM_021965 NM_021966 NM_021967 NM_021971 NM_021973 NM_021977 NM_021980 NM_021988 NM_021991 NM_022002 NM_022003 NM_022036 NM_022048 NM_022050 NM_022060 NM_022066 NM_022071 NM_022073 NM_022080 NM_022081 NM_022082 NM_022086 NM_022089 NM_022098 NM_022103 NM_022105 NM_022106 NM_022111 NM_022112 NM_022114 NM_022131 NM_022138 NM_022139 NM_022153 NM_022154 NM_022157 NM_022162 NM_022164 NM_022169 NM_022170 NM_022336 NM_022360 NM_022367 NM_022369 NM_022371 NM_022372 NM_022373 NM_022377 NM_022405 NM_022437 NM_022442 NM_022449 NM_022459 NM_022465 NM_022467 NM_022468 NM_022469 NM_022470 NM_022473 NM_022475 NM_022477 NM_022480 NM_022487 NM_022490 NM_022491 NM_022492 NM_022497 NM_022553 NM_022559 NM_022560 NM_022561 NM_022562 NM_022566 NM_022572 NM_022579 NM_022580 NM_022581 NM_022640 NM_022641 NM_022644 NM_022645 NM_022658 NM_022663 NM_022718 NM_022730 NM_022739 NM_022749 NM_022754 NM_022755 NM_022758 NM_022761 NM_022764 NM_022766 NM_022767 NM_022772 NM_022774 NM_022777 NM_022779 NM_022787 NM_022789 NM_022791 NM_022792 NM_022803 NM_022818 NM_022819 NM_022821 NM_022822 NM_022823 NM_022828 NM_022829 NM_022832 NM_022844 NM_022893 NM_022894 NM_022898 NM_022901 NM_022910 NM_022912 NM_022917 NM_022965 NM_022978 NM_023002 NM_023008 NM_023016 NM_023019 NM_023032 NM_023033 NM_023067 NM_023071 NM_023075 NM_023076 NM_023078 NM_023107 NM_023108 NM_023927 NM_023928 NM_023930 NM_023934 NM_023939 NM_023942 NM_023947 NM_023948 NM_024003 NM_024010 NM_024015 NM_024017 NM_024025 NM_024026 NM_024033 NM_024034 NM_024035 NM_024043 NM_024046 NM_024053 NM_024068 NM_024072 NM_024074 NM_024076 NM_024080 NM_024081 NM_024083 NM_024095 NM_024098 NM_024102 NM_024103 NM_024106 NM_024111 NM_024116 NM_024117 NM_024294 NM_024297 NM_024298 NM_024299 NM_024306 NM_024311 NM_024325 NM_024328 NM_024332 NM_024334 NM_024342 NM_024345 NM_024415 NM_024419 NM_024421 NM_024422 NM_024423 NM_024424 NM_024425 NM_024426 NM_024493 NM_024494 NM_024501 NM_024503 NM_024506 NM_024512 NM_024513 NM_024517 NM_024522 NM_024531 NM_024533 NM_024535 NM_024546 NM_024551 NM_024556 NM_024557 NM_024561 NM_024563 NM_024569 NM_024575 NM_024590 NM_024592 NM_024594 NM_024595 NM_024598 NM_024602 NM_024611 NM_024613 NM_024616 NM_024620 NM_024627 NM_024633 NM_024638 NM_024639 NM_024643 NM_024646 NM_024647 NM_024649 NM_024653 NM_024656 NM_024662 NM_024663 NM_024665 NM_024667 NM_024674 NM_024677 NM_024678 NM_024681 NM_024685 NM_024705 NM_024706 NM_024707 NM_024709 NM_024711 NM_024718 NM_024719 NM_024729 NM_024733 NM_024735 NM_024736 NM_024738 NM_024745 NM_024750 NM_024758 NM_024759 NM_024760 NM_024761 NM_024762 NM_024767 NM_024768 NM_024769 NM_024770 NM_024771 NM_024773 NM_024774 NM_024787 NM_024789 NM_024791 NM_024793 NM_024798 NM_024816 NM_024817 NM_024830 NM_024832 NM_024843 NM_024845 NM_024847 NM_024850 NM_024859 NM_024866 NM_024873 NM_024874 NM_024875 NM_024877 NM_024881 NM_024884 NM_024887 NM_024893 NM_024902 NM_024907 NM_024911 NM_024915 NM_024917 NM_024918 NM_024919 NM_024922 NM_024923 NM_024924 NM_024926 NM_024933 NM_024935 NM_024939 NM_024940 NM_024945 NM_024946 NM_024954 NM_024955 NM_024958 NM_024974 NM_024993 NM_025002 NM_025009 NM_025023 NM_025030 NM_025040 NM_025042 NM_025057 NM_025059 NM_025061 NM_025074 NM_025075 NM_025080 NM_025083 NM_025084 NM_025091 NM_025104 NM_025136 NM_025138 NM_025146 NM_025147 NM_025151 NM_025152 NM_025154 NM_025159 NM_025164 NM_025168 NM_025182 NM_025189 NM_025195 NM_025197 NM_025202 NM_025213 NM_025219 NM_025220 NM_025222 NM_025224 NM_025236 NM_025238 NM_025243 NM_025248 NM_025251 NM_025259 NM_030568 NM_030569 NM_030574 NM_030576 NM_030593 NM_030594 NM_030621 NM_030623 NM_030626 NM_030629 NM_030630 NM_030634 NM_030636 NM_030643 NM_030651 NM_030653 NM_030655 NM_030661 NM_030664 NM_030670 NM_030671 NM_030758 NM_030762 NM_030770 NM_030773 NM_030774 NM_030775 NM_030776 NM_030779 NM_030781 NM_030783 NM_030787 NM_030796 NM_030798 NM_030799 NM_030805 NM_030806 NM_030807 NM_030812 NM_030816 NM_030817 NM_030821 NM_030884 NM_030913 NM_030914 NM_030918 NM_030920 NM_030922 NM_030923 NM_030927 NM_030928 NM_030936 NM_030937 NM_030940 NM_030945 NM_030952 NM_030954 NM_030956 NM_030957 NM_030958 NM_030962 NM_030964 NM_030965 NM_030972 NM_030980 NM_030981 NM_031208 NM_031213 NM_031265 NM_031268 NM_031281 NM_031282 NM_031286 NM_031295 NM_031306 NM_031310 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031409 NM_031417 NM_031418 NM_031419 NM_031420 NM_031435 NM_031437 NM_031439 NM_031442 NM_031444 NM_031445 NM_031450 NM_031455 NM_031459 NM_031463 NM_031468 NM_031469 NM_031471 NM_031484 NM_031485 NM_031490 NM_031491 NM_031492 NM_031498 NM_031844 NM_031882 NM_031886 NM_031889 NM_031890 NM_031896 NM_031899 NM_031904 NM_031905 NM_031908 NM_031912 NM_031940 NM_031945 NM_031954 NM_031955 NM_031992 NM_032012 NM_032013 NM_032015 NM_032017 NM_032019 NM_032029 NM_032039 NM_032041 NM_032042 NM_032045 NM_032047 NM_032050 NM_032051 NM_032052 NM_032088 NM_032092 NM_032103 NM_032104 NM_032105 NM_032107 NM_032115 NM_032120 NM_032121 NM_032141 NM_032160 NM_032164 NM_032166 NM_032167 NM_032174 NM_032189 NM_032211 NM_032217 NM_032242 NM_032262 NM_032268 NM_032271 NM_032272 NM_032281 NM_032283 NM_032287 NM_032294 NM_032295 NM_032296 NM_032298 NM_032307 NM_032310 NM_032313 NM_032316 NM_032317 NM_032318 NM_032323 NM_032325 NM_032326 NM_032336 NM_032338 NM_032348 NM_032369 NM_032374 NM_032375 NM_032385 NM_032387 NM_032389 NM_032403 NM_032427 NM_032429 NM_032431 NM_032432 NM_032433 NM_032440 NM_032442 NM_032446 NM_032449 NM_032451 NM_032452 NM_032458 NM_032484 NM_032485 NM_032486 NM_032488 NM_032495 NM_032499 NM_032508 NM_032511 NM_032513 NM_032521 NM_032529 NM_032547 NM_032558 NM_032561 NM_032569 NM_032572 NM_032579 NM_032584 NM_032611 NM_032625 NM_032632 NM_032638 NM_032642 NM_032643 NM_032644 NM_032645 NM_032649 NM_032673 NM_032680 NM_032682 NM_032701 NM_032704 NM_032706 NM_032710 NM_032711 NM_032737 NM_032741 NM_032750 NM_032753 NM_032756 NM_032765 NM_032772 NM_032777 NM_032779 NM_032783 NM_032786 NM_032788 NM_032794 NM_032796 NM_032799 NM_032801 NM_032804 NM_032806 NM_032807 NM_032809 NM_032811 NM_032815 NM_032817 NM_032818 NM_032826 NM_032831 NM_032832 NM_032834 NM_032836 NM_032837 NM_032840 NM_032843 NM_032849 NM_032855 NM_032859 NM_032863 NM_032866 NM_032873 NM_032880 NM_032889 NM_032899 NM_032910 NM_032924 NM_032932 NM_032947 NM_032949 NM_032951 NM_032952 NM_032953 NM_032954 NM_032958 NM_032959 NM_032960 NM_032966 NM_032967 NM_032970 NM_032971 NM_032972 NM_032975 NM_032976 NM_032977 NM_032980 NM_032982 NM_032983 NM_032984 NM_032988 NM_032992 NM_032994 NM_032998 NM_033008 NM_033009 NM_033010 NM_033011 NM_033013 NM_033016 NM_033018 NM_033027 NM_033033 NM_033045 NM_033064 NM_033084 NM_033086 NM_033089 NM_033100 NM_033101 NM_033102 NM_033109 NM_033118 NM_033121 NM_033128 NM_033129 NM_033130 NM_033131 NM_033133 NM_033136 NM_033137 NM_033141 NM_033143 NM_033147 NM_033148 NM_033159 NM_033167 NM_033168 NM_033170 NM_033171 NM_033172 NM_033173 NM_033198 NM_033201 NM_033206 NM_033207 NM_033220 NM_033221 NM_033222 NM_033224 NM_033225 NM_033240 NM_033244 NM_033245 NM_033246 NM_033249 NM_033259 NM_033266 NM_033267 NM_033274 NM_033285 NM_033288 NM_033315 NM_033318 NM_033319 NM_033329 NM_033346 NM_033375 NM_033387 NM_033389 NM_033392 NM_033393 NM_033397 NM_033405 NM_033410 NM_033421 NM_033425 NM_033429 NM_033446 NM_033449 NM_033450 NM_033456 NM_033480 NM_033481 NM_033505 NM_033513 NM_033516 NM_033549 NM_033551 NM_033553 NM_033624 NM_033631 NM_033637 NM_033644 NM_033645 NM_033649 NM_033656 NM_052811 NM_052815 NM_052816 NM_052821 NM_052831 NM_052834 NM_052840 NM_052846 NM_052847 NM_052848 NM_052849 NM_052853 NM_052855 NM_052858 NM_052862 NM_052868 NM_052872 NM_052874 NM_052880 NM_052882 NM_052884 NM_052886 NM_052890 NM_052891 NM_052896 NM_052898 NM_052900 NM_052906 NM_052909 NM_052910 NM_052916 NM_052917 NM_052918 NM_052919 NM_052925 NM_052926 NM_052928 NM_052934 NM_052937 NM_052941 NM_052943 NM_052945 NM_052949 NM_052966 NM_052988 NM_052997 NM_053003 NM_053004 NM_053042 NM_053046 NM_053055 NM_053056 NM_053282 NM_053284 NM_054016 NM_054025 NM_054027 NM_054110 NM_057088 NM_057089 NM_057158 NM_057168 NM_057179 NM_058164 NM_058167 NM_058170 NM_058174 NM_058175 NM_058178 NM_058238 NM_058246 NM_078473 NM_078487 NM_078625 NM_078628 NM_079421 NM_079834 NM_079836 NM_080388 NM_080422 NM_080423 NM_080551 NM_080564 NM_080588 NM_080589 NM_080590 NM_080591 NM_080592 NM_080598 NM_080603 NM_080604 NM_080612 NM_080616 NM_080617 NM_080618 NM_080621 NM_080625 NM_080627 NM_080652 NM_080656 NM_080665 NM_080669 NM_080670 NM_080672 NM_080704 NM_080705 NM_080706 NM_080732 NM_080733 NM_080764 NM_080792 NM_080796 NM_080797 NM_080816 NM_080821 NM_080829 NM_080832 NM_080836 NM_080861 NM_080863 NM_080867 NM_080868 NM_080871 NM_080881 NM_101395 NM_130384 NM_130386 NM_130387 NM_130435 NM_130437 NM_130438 NM_130440 NM_130459 NM_130465 NM_130466 NM_130470 NM_130471 NM_130472 NM_130473 NM_130474 NM_130475 NM_130476 NM_130770 NM_130773 NM_130807 NM_130842 NM_130843 NM_130844 NM_130848 NM_133170 NM_133171 NM_133172 NM_133173 NM_133174 NM_133175 NM_133176 NM_133177 NM_133178 NM_133264 NM_133279 NM_133280 NM_133282 NM_133330 NM_133331 NM_133332 NM_133333 NM_133334 NM_133335 NM_133336 NM_133371 NM_133373 NM_133377 NM_133444 NM_133448 NM_133452 NM_133456 NM_133459 NM_133463 NM_133464 NM_133473 NM_133474 NM_133482 NM_133490 NM_133498 NM_133509 NM_133642 NM_133646 NM_134264 NM_134265 NM_134422 NM_134423 NM_134424 NM_134433 NM_134442 NM_138281 NM_138287 NM_138292 NM_138293 NM_138294 NM_138298 NM_138300 NM_138319 NM_138323 NM_138324 NM_138335 NM_138338 NM_138347 NM_138356 NM_138368 NM_138370 NM_138371 NM_138379 NM_138384 NM_138385 NM_138387 NM_138390 NM_138396 NM_138400 NM_138410 NM_138415 NM_138417 NM_138429 NM_138435 NM_138440 NM_138441 NM_138444 NM_138447 NM_138450 NM_138456 NM_138457 NM_138458 NM_138468 NM_138471 NM_138473 NM_138477 NM_138494 NM_138499 NM_138558 NM_138565 NM_138567 NM_138568 NM_138572 NM_138576 NM_138578 NM_138608 NM_138609 NM_138610 NM_138621 NM_138622 NM_138623 NM_138624 NM_138625 NM_138626 NM_138627 NM_138632 NM_138640 NM_138705 NM_138706 NM_138713 NM_138714 NM_138726 NM_138731 NM_138737 NM_138769 NM_138774 NM_138793 NM_138797 NM_138799 NM_138804 NM_138809 NM_138820 NM_138961 NM_138962 NM_138969 NM_138971 NM_138972 NM_138973 NM_138993 NM_138995 NM_139012 NM_139014 NM_139015 NM_139016 NM_139018 NM_139024 NM_139058 NM_139068 NM_139069 NM_139071 NM_139076 NM_139124 NM_139125 NM_139159 NM_139170 NM_139211 NM_139212 NM_139235 NM_139246 NM_139267 NM_139276 NM_139312 NM_139314 NM_139321 NM_139323 NM_144499 NM_144507 NM_144567 NM_144573 NM_144578 NM_144579 NM_144580 NM_144582 NM_144588 NM_144597 NM_144601 NM_144607 NM_144609 NM_144613 NM_144615 NM_144617 NM_144618 NM_144622 NM_144628 NM_144635 NM_144637 NM_144639 NM_144667 NM_144671 NM_144677 NM_144678 NM_144682 NM_144684 NM_144687 NM_144692 NM_144701 NM_144719 NM_144721 NM_144722 NM_144724 NM_144736 NM_144769 NM_144780 NM_144781 NM_144782 NM_144964 NM_144968 NM_144973 NM_144974 NM_144984 NM_144991 NM_145008 NM_145010 NM_145013 NM_145017 NM_145025 NM_145039 NM_145041 NM_145042 NM_145055 NM_145056 NM_145060 NM_145065 NM_145109 NM_145110 NM_145112 NM_145113 NM_145115 NM_145117 NM_145165 NM_145166 NM_145169 NM_145173 NM_145174 NM_145177 NM_145182 NM_145183 NM_145185 NM_145206 NM_145212 NM_145214 NM_145230 NM_145231 NM_145234 NM_145241 NM_145245 NM_145265 NM_145268 NM_145273 NM_145275 NM_145276 NM_145279 NM_145282 NM_145283 NM_145286 NM_145296 NM_145308 NM_145311 NM_145312 NM_145313 NM_145341 NM_145343 NM_145344 NM_145638 NM_145646 NM_145649 NM_145655 NM_145660 NM_145663 NM_145693 NM_145699 NM_145701 NM_145714 NM_145727 NM_145730 NM_145733 NM_145734 NM_145735 NM_145754 NM_145762 NM_145763 NM_145798 NM_145804 NM_145808 NM_145818 NM_145868 NM_145869 NM_145888 NM_145899 NM_145901 NM_145902 NM_145903 NM_145904 NM_145905 NM_145906 NM_145912 NM_145913 NM_146421 NM_147127 NM_147131 NM_147132 NM_147134 NM_147147 NM_147148 NM_147161 NM_147180 NM_147192 NM_147194 NM_147195 NM_147200 NM_147202 NM_147686 NM_147780 NM_147781 NM_147782 NM_147783 NM_148169 NM_148170 NM_148171 NM_148414 NM_148415 NM_148416 NM_148898 NM_148899 NM_148900 NM_148903 NM_148912 NM_148913 NM_148915 NM_148957 NM_148960 NM_148964 NM_148980 NM_149379 NM_152233 NM_152235 NM_152240 NM_152243 NM_152244 NM_152253 NM_152255 NM_152257 NM_152259 NM_152264 NM_152266 NM_152267 NM_152269 NM_152272 NM_152280 NM_152284 NM_152298 NM_152303 NM_152304 NM_152321 NM_152330 NM_152333 NM_152340 NM_152341 NM_152361 NM_152362 NM_152363 NM_152371 NM_152378 NM_152379 NM_152395 NM_152400 NM_152403 NM_152406 NM_152409 NM_152411 NM_152414 NM_152421 NM_152422 NM_152424 NM_152428 NM_152443 NM_152444 NM_152451 NM_152463 NM_152466 NM_152470 NM_152472 NM_152473 NM_152475 NM_152476 NM_152477 NM_152480 NM_152487 NM_152496 NM_152504 NM_152509 NM_152519 NM_152523 NM_152529 NM_152531 NM_152536 NM_152540 NM_152553 NM_152557 NM_152568 NM_152569 NM_152583 NM_152586 NM_152587 NM_152588 NM_152590 NM_152595 NM_152598 NM_152612 NM_152619 NM_152622 NM_152624 NM_152629 NM_152636 NM_152649 NM_152654 NM_152655 NM_152658 NM_152667 NM_152681 NM_152682 NM_152686 NM_152687 NM_152701 NM_152702 NM_152703 NM_152717 NM_152724 NM_152735 NM_152736 NM_152740 NM_152754 NM_152757 NM_152769 NM_152780 NM_152783 NM_152785 NM_152793 NM_152794 NM_152831 NM_152834 NM_152840 NM_152841 NM_152842 NM_152856 NM_152860 NM_152866 NM_152870 NM_152878 NM_152879 NM_152888 NM_152891 NM_152903 NM_152906 NM_152908 NM_152910 NM_152913 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152988 NM_152989 NM_152990 NM_153007 NM_153023 NM_153029 NM_153031 NM_153032 NM_153033 NM_153034 NM_153035 NM_153040 NM_153041 NM_153043 NM_153045 NM_153050 NM_153051 NM_153183 NM_153186 NM_153202 NM_153208 NM_153220 NM_153229 NM_153233 NM_153234 NM_153238 NM_153244 NM_153246 NM_153247 NM_153259 NM_153260 NM_153263 NM_153266 NM_153271 NM_153273 NM_153274 NM_153281 NM_153282 NM_153283 NM_153284 NM_153285 NM_153286 NM_153320 NM_153321 NM_153322 NM_153328 NM_153338 NM_153343 NM_153344 NM_153345 NM_153347 NM_153348 NM_153350 NM_153355 NM_153360 NM_153367 NM_153375 NM_153442 NM_153449 NM_153451 NM_153453 NM_153486 NM_153487 NM_153498 NM_153608 NM_153611 NM_153616 NM_153617 NM_153618 NM_153619 NM_153631 NM_153632 NM_153636 NM_153639 NM_153676 NM_153685 NM_153687 NM_153689 NM_153690 NM_153693 NM_153697 NM_153705 NM_153710 NM_153712 NM_153714 NM_153717 NM_153718 NM_153719 NM_153827 NM_170602 NM_170603 NM_170604 NM_170607 NM_170663 NM_170674 NM_170677 NM_170678 NM_170705 NM_170706 NM_170709 NM_170710 NM_170719 NM_170721 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170740 NM_170741 NM_170742 NM_170743 NM_170751 NM_170752 NM_170769 NM_170770 NM_170776 NM_170782 NM_171825 NM_171998 NM_172002 NM_172014 NM_172024 NM_172069 NM_172087 NM_172088 NM_172089 NM_172130 NM_172163 NM_172164 NM_172165 NM_172166 NM_172193 NM_172198 NM_172206 NM_172207 NM_172208 NM_172211 NM_172214 NM_172215 NM_172217 NM_172225 NM_172230 NM_172234 NM_172236 NM_172239 NM_172241 NM_172314 NM_172315 NM_172316 NM_172351 NM_172352 NM_172354 NM_172355 NM_172357 NM_172367 NM_172373 NM_172375 NM_172387 NM_172388 NM_172389 NM_173042 NM_173043 NM_173044 NM_173064 NM_173065 NM_173073 NM_173076 NM_173079 NM_173082 NM_173156 NM_173164 NM_173179 NM_173191 NM_173192 NM_173193 NM_173194 NM_173195 NM_173214 NM_173342 NM_173344 NM_173352 NM_173359 NM_173459 NM_173463 NM_173464 NM_173466 NM_173469 NM_173470 NM_173472 NM_173476 NM_173484 NM_173508 NM_173509 NM_173511 NM_173519 NM_173522 NM_173531 NM_173532 NM_173551 NM_173555 NM_173562 NM_173566 NM_173578 NM_173580 NM_173581 NM_173582 NM_173583 NM_173588 NM_173597 NM_173602 NM_173607 NM_173610 NM_173611 NM_173617 NM_173623 NM_173627 NM_173632 NM_173640 NM_173648 NM_173654 NM_173660 NM_173661 NM_173663 NM_173669 NM_173671 NM_173675 NM_173676 NM_173678 NM_173681 NM_173683 NM_173687 NM_173689 NM_173691 NM_173701 NM_173793 NM_173799 NM_173800 NM_173808 NM_173811 NM_173815 NM_173825 NM_173827 NM_173833 NM_173841 NM_173842 NM_173843 NM_173851 NM_173854 NM_173859 NM_174856 NM_174869 NM_174901 NM_174902 NM_174911 NM_174914 NM_174922 NM_174934 NM_174940 NM_174953 NM_174954 NM_174955 NM_174956 NM_174957 NM_174958 NM_174975 NM_174976 NM_174977 NM_175039 NM_175040 NM_175060 NM_175066 NM_175080 NM_175567 NM_175568 NM_175571 NM_175609 NM_175736 NM_175745 NM_175767 NM_175852 NM_175857 NM_175859 NM_175862 NM_175863 NM_175864 NM_175871 NM_175872 NM_175875 NM_175883 NM_175888 NM_175892 NM_175898 NM_175900 NM_175901 NM_175908 NM_175911 NM_175913 NM_175920 NM_175922 NM_175931 NM_176084 NM_176085 NM_176086 NM_176095 NM_176789 NM_176792 NM_176811 NM_176812 NM_176815 NM_176816 NM_176823 NM_176853 NM_176871 NM_177401 NM_177403 NM_177405 NM_177427 NM_177435 NM_177438 NM_177532 NM_177542 NM_177550 NM_177553 NM_177924 NM_177966 NM_177967 NM_177972 NM_177978 NM_177979 NM_177983 NM_177990 NM_177995 NM_177996 NM_177999 NM_178000 NM_178001 NM_178002 NM_178003 NM_178004 NM_178008 NM_178010 NM_178013 NM_178037 NM_178038 NM_178039 NM_178040 NM_178122 NM_178126 NM_178129 NM_178130 NM_178138 NM_178140 NM_178148 NM_178150 NM_178151 NM_178152 NM_178153 NM_178154 NM_178155 NM_178156 NM_178157 NM_178159 NM_178172 NM_178175 NM_178191 NM_178228 NM_178229 NM_178231 NM_178232 NM_178324 NM_178336 NM_178342 NM_178353 NM_178422 NM_178423 NM_178438 NM_178443 NM_178448 NM_178450 NM_178500 NM_178502 NM_178505 NM_178507 NM_178509 NM_178514 NM_178516 NM_178520 NM_178542 NM_178544 NM_178546 NM_178557 NM_178564 NM_178565 NM_178568 NM_178579 NM_178814 NM_178815 NM_178820 NM_178821 NM_178830 NM_178831 NM_178835 NM_178842 NM_178849 NM_178861 NM_178864 NM_180981 NM_180982 NM_180991 NM_181050 NM_181265 NM_181304 NM_181305 NM_181306 NM_181307 NM_181310 NM_181314 NM_181332 NM_181336 NM_181349 NM_181351 NM_181356 NM_181358 NM_181359 NM_181430 NM_181431 NM_181435 NM_181453 NM_181471 NM_181472 NM_181481 NM_181482 NM_181483 NM_181489 NM_181491 NM_181504 NM_181523 NM_181524 NM_181527 NM_181528 NM_181531 NM_181533 NM_181553 NM_181554 NM_181555 NM_181644 NM_181659 NM_181684 NM_181686 NM_181701 NM_181704 NM_181705 NM_181709 NM_181719 NM_181723 NM_181724 NM_181725 NM_181733 NM_181740 NM_181741 NM_181742 NM_181744 NM_181784 NM_181785 NM_181786 NM_181788 NM_181804 NM_181805 NM_181814 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181843 NM_181844 NM_181846 NM_181847 NM_181876 NM_181897 NM_182470 NM_182471 NM_182481 NM_182482 NM_182484 NM_182487 NM_182495 NM_182499 NM_182500 NM_182502 NM_182505 NM_182507 NM_182509 NM_182517 NM_182534 NM_182540 NM_182554 NM_182557 NM_182565 NM_182568 NM_182569 NM_182573 NM_182577 NM_182578 NM_182579 NM_182584 NM_182596 NM_182605 NM_182607 NM_182623 NM_182626 NM_182634 NM_182637 NM_182639 NM_182643 NM_182645 NM_182661 NM_182665 NM_182682 NM_182685 NM_182686 NM_182688 NM_182700 NM_182704 NM_182728 NM_182734 NM_182746 NM_182751 NM_182752 NM_182764 NM_182791 NM_182798 NM_182799 NM_182801 NM_182802 NM_182812 NM_182832 NM_182848 NM_182849 NM_182851 NM_182852 NM_182894 NM_182901 NM_182903 NM_182906 NM_182907 NM_182922 NM_182964 NM_183006 NM_183040 NM_183244 NM_183246 NM_183337 NM_183360 NM_183361 NM_183373 NM_183376 NM_183377 NM_183397 NM_183414 NM_183415 NM_183425 NM_184041 NM_184043 NM_184231 NM_194071 NM_194278 NM_194282 NM_194283 NM_194285 NM_194286 NM_194288 NM_194290 NM_194295 NM_194298 NM_194303 NM_194309 NM_194310 NM_194313 NM_194314 NM_194315 NM_194316 NM_194317 NM_194358 NM_194359 NM_194428 NM_194436 NM_194452 NM_194453 NM_194457 NM_194458 NM_197956 NM_197964 NM_197974 NM_197976 NM_198040 NM_198053 NM_198057 NM_198058 NM_198061 NM_198066 NM_198075 NM_198080 NM_198098 NM_198123 NM_198124 NM_198138 NM_198141 NM_198154 NM_198156 NM_198157 NM_198158 NM_198159 NM_198177 NM_198178 NM_198183 NM_198196 NM_198204 NM_198205 NM_198212 NM_198236 NM_198253 NM_198254 NM_198255 NM_198266 NM_198268 NM_198269 NM_198271 NM_198274 NM_198277 NM_198287 NM_198291 NM_198320 NM_198321 NM_198324 NM_198334 NM_198335 NM_198390 NM_198392 NM_198394 NM_198399 NM_198400 NM_198426 NM_198431 NM_198440 NM_198441 NM_198442 NM_198445 NM_198446 NM_198447 NM_198457 NM_198459 NM_198463 NM_198466 NM_198476 NM_198478 NM_198483 NM_198486 NM_198488 NM_198490 NM_198501 NM_198508 NM_198510 NM_198515 NM_198530 NM_198532 NM_198540 NM_198542 NM_198545 NM_198549 NM_198554 NM_198557 NM_198560 NM_198562 NM_198564 NM_198568 NM_198571 NM_198582 NM_198587 NM_198589 NM_198590 NM_198591 NM_198595 NM_198597 NM_198679 NM_198681 NM_198686 NM_198795 NM_198797 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198843 NM_198850 NM_198851 NM_198859 NM_198887 NM_198889 NM_198893 NM_198900 NM_198903 NM_198904 NM_198926 NM_198955 NM_198956 NM_198963 NM_198964 NM_198990 NM_198993 NM_199005 NM_199040 NM_199044 NM_199045 NM_199072 NM_199076 NM_199124 NM_199126 NM_199129 NM_199132 NM_199135 NM_199139 NM_199144 NM_199163 NM_199169 NM_199170 NM_199171 NM_199203 NM_199206 NM_199245 NM_199246 NM_199259 NM_199260 NM_199261 NM_199265 NM_199294 NM_199295 NM_199296 NM_199324 NM_199330 NM_199331 NM_199332 NM_199349 NM_199358 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199415 NM_199421 NM_199424 NM_199427 NM_199450 NM_199451 NM_199452 NM_199454 NM_199461 NM_199462 NM_199478 NM_199484 NM_199485 NM_199487 NM_199513 NM_201252 NM_201262 NM_201263 NM_201266 NM_201267 NM_201274 NM_201279 NM_201280 NM_201284 NM_201348 NM_201378 NM_201379 NM_201380 NM_201381 NM_201382 NM_201383 NM_201384 NM_201399 NM_201403 NM_201428 NM_201429 NM_201430 NM_201431 NM_201432 NM_201433 NM_201442 NM_201524 NM_201525 NM_201548 NM_201565 NM_201567 NM_201568 NM_201569 NM_201574 NM_201599 NM_201625 NM_201627 NM_201628 NM_201629 NM_201630 NM_201632 NM_201634 NM_201994 NM_202002 NM_202003 NM_203293 NM_203294 NM_203295 NM_203296 NM_203297 NM_203305 NM_203307 NM_203327 NM_203329 NM_203330 NM_203331 NM_203344 NM_203351 NM_203352 NM_203353 NM_203371 NM_203373 NM_203374 NM_203376 NM_203379 NM_203380 NM_203381 NM_203395 NM_203412 NM_203422 NM_203426 NM_203444 NM_203445 NM_203446 NM_203447 NM_203452 NM_203463 NM_203464 NM_203472 NM_203481 NM_203504 NM_203505 NM_205767 NM_205847 NM_205848 NM_205853 NM_205857 NM_205861 NM_205864 NM_206832 NM_206833 NM_206835 NM_206877 NM_206889 NM_206894 NM_206900 NM_206901 NM_206902 NM_206909 NM_206926 NM_206938 NM_206939 NM_206940 NM_206962 NM_207003 NM_207006 NM_207015 NM_207032 NM_207033 NM_207034 NM_207035 NM_207043 NM_207044 NM_207047 NM_207111 NM_207113 NM_207115 NM_207116 NM_207119 NM_207171 NM_207285 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207306 NM_207320 NM_207323 NM_207326 NM_207333 NM_207335 NM_207340 NM_207348 NM_207352 NM_207354 NM_207357 NM_207366 NM_207367 NM_207371 NM_207373 NM_207382 NM_207388 NM_207390 NM_207391 NM_207394 NM_207400 NM_207405 NM_207406 NM_207411 NM_207412 NM_207419 NM_207422 NM_207426 NM_207428 NM_207434 NM_207438 NM_207439 NM_207444 NM_207447 NM_207448 NM_207451 NM_207453 NM_207458 NM_207460 NM_207461 NM_207462 NM_207463 NM_207465 NM_207467 NM_207473 NM_207474 NM_207475 NM_207477 NM_207478 NM_207479 NM_207481 NM_207488 NM_207498 NM_207502 NM_207504 NM_207505 NM_207507 NM_207510 NM_207511 NM_207514 NM_207644 NM_207646 NM_207672 NM_212469 NM_212502 NM_212503 NM_212551 NM_212555 NM_213566 NM_213568 NM_213589 NM_213590 NM_213596 NM_213597 NM_213605 NM_213606 NM_213609 NM_213619 NM_213620 NM_213621 NM_213645 NM_213646 NM_213648 NM_213662 NM_213723 NM_214462 XM_016532 XM_017374 XM_027236 XM_029353 XM_031104 XM_031553 XM_032901 XM_034086 XM_034274 XM_034872 XM_036115 XM_036936 XM_036942 XM_037557 XM_038436 XM_039393 XM_039721 XM_041126 XM_042698 XM_042936 XM_043493 XM_046305 XM_046437 XM_046531 XM_047355 XM_047550 XM_047554 XM_047610 XM_048592 XM_053966 XM_055866 XM_057107 XM_058628 XM_059037 XM_059318 XM_059482 XM_059689 XM_059929 XM_065166 XM_067585 XM_071712 XM_084529 XM_084852 XM_085463 XM_085831 XM_085833 XM_086001 XM_086761 XM_086876 XM_087353 XM_087386 XM_096688 XM_097977 XM_098828 XM_113743 XM_113763 XM_113947 XM_114166 XM_166132 XM_166227 XM_167152 XM_170659 XM_171855 XM_172968 XM_173015 XM_208270 XM_208313 XM_208319 XM_208545 XM_208835 XM_208847 XM_208990 XM_209234 XM_209363 XM_209500 XM_209554 XM_209559 XM_209607 XM_209824 XM_209913 XM_211079 XM_211092 XM_211287 XM_211408 XM_211871 XM_211896 XM_290502 XM_290540 XM_290579 XM_290597 XM_290609 XM_290670 XM_290734 XM_290737 XM_290809 XM_290854 XM_291019 XM_291020 XM_291095 XM_291346 XM_291671 XM_291729 XM_292717 XM_293687 XM_293828 XM_294521 XM_296817 XM_297816 XM_350880 XM_370696 XM_370838 XM_370878 XM_370995 XM_371074 XM_371079 XM_371082 XM_371097 XM_371116 XM_371132 XM_371176 XM_371177 XM_371214 XM_371230 XM_371302 XM_371304 XM_371369 XM_371399 XM_371423 XM_371429 XM_371461 XM_371488 XM_371655 XM_371663 XM_371664 XM_371690 XM_371741 XM_371755 XM_371759 XM_371760 XM_371777 XM_371783 XM_371820 XM_371845 XM_371885 XM_371891 XM_371933 XM_372035 XM_372038 XM_372039 XM_372097 XM_372109 XM_372138 XM_372193 XM_372194 XM_372198 XM_372205 XM_372273 XM_372420 XM_372579 XM_372584 XM_372716 XM_372723 XM_373030 XM_373453 XM_373469 XM_373513 XM_373588 XM_373594 XM_373631 XM_373690 XM_373692 XM_373704 XM_373734 XM_373737 XM_373744 XM_373750 XM_373765 XM_373771 XM_373798 XM_373838 XM_373846 XM_373883 XM_373921 XM_374069 XM_374078 XM_374086 XM_374112 XM_374117 XM_374120 XM_374169 XM_374249 XM_374270 XM_374343 XM_374399 XM_374414 XM_374422 XM_374491 XM_374498 XM_374766 XM_374768 XM_374781 XM_374976 XM_374983 XM_375007 XM_375042 XM_375065 XM_375090 XM_375163 XM_375174 XM_375183 XM_375272 XM_375275 XM_375307 XM_375357 XM_375373 XM_375456 XM_375491 XM_375527 XM_375558 XM_375602 XM_375606 XM_375629 XM_375646 XM_375669 XM_375713 XM_375729 XM_375816 XM_375853 XM_375929 XM_376018 XM_376049 XM_376189 XM_376207 XM_376212 XM_376254 XM_376257 XM_376269 XM_376278 XM_376284 XM_376303 XM_376320 XM_376334 XM_376412 XM_376419 XM_376454 XM_376463 XM_376474 XM_376522 XM_376550 XM_376558 XM_376560 XM_376587 XM_376588 XM_376607 XM_376631 XM_376652 XM_376658 XM_376677 XM_376679 XM_376680 XM_376720 XM_376727 XM_376784 XM_376822 XM_376902 XM_376905 XM_376981 XM_377002 XM_377076 XM_377476 XM_377506 XM_377742 XM_378207 XM_378208 XM_378236 XM_378238 XM_378247 XM_378280 XM_378299 XM_378300 XM_378301 XM_378312 XM_378321 XM_378327 XM_378329 XM_378331 XM_378356 XM_378360 XM_378362 XM_378390 XM_378394 XM_378421 XM_378453 XM_378473 XM_378487 XM_378491 XM_378511 XM_378516 XM_378529 XM_378535 XM_378546 XM_378558 XM_378562 XM_378567 XM_378573 XM_378589 XM_378617 XM_378620 XM_378625 XM_378631 XM_378643 XM_378648 XM_378649 XM_378655 XM_378660 XM_378661 XM_378667 XM_378678 XM_378692 XM_378708 XM_378712 XM_378730 XM_378735 XM_378750 XM_378751 XM_378757 XM_378758 XM_378760 XM_378777 XM_378783 XM_378786 XM_378787 XM_378810 XM_378825 XM_378832 XM_378842 XM_378843 XM_378855 XM_378860 XM_378876 XM_378883 XM_378971 XM_378993 XM_379029 XM_379030 XM_379041 XM_379044 XM_379065 XM_379069 XM_379074 XM_379075 XM_379078 XM_379079 XM_379096 XM_379097 XM_379100 XM_379102 XM_379106 XM_379114 XM_379135 XM_379136 XM_379141 XM_379154 XM_379174 XM_379177 XM_379189 XM_379204 XM_379214 XM_379215 XM_379230 XM_379231 XM_379243 XM_379249 XM_379255 XM_379260 XM_379267 XM_379276 XM_379280 XM_379309 XM_379318 XM_379324 XM_379363 XM_379371 XM_379391 XM_379398 XM_379409 XM_379417 XM_379437 XM_379438 XM_379454 XM_379456 XM_379458 XM_379482 XM_379510 XM_379512 XM_379530 XM_379534 XM_379541 XM_379543 XM_379586 XM_379592 XM_379594 XM_379595 XM_379597 XM_379619 XM_379622 XM_379623 XM_379629 XM_379632 XM_379642 XM_379643 XM_379648 XM_379650 XM_379656 XM_379657 XM_379696 XM_379705 XM_379720 XM_379722 XM_379730 XM_379800 XM_379827 XM_379840 XM_379866 XM_379892 XM_379897 XM_379927 XM_379931 XM_379933 XM_379934 XM_379967 XM_379979 XM_380098 XM_380103 XM_380131 XM_380135 XM_380154 XM_380159 XM_495796 XM_495807 XM_495814 XM_495849 XM_495860 XM_495879 XM_495881 XM_495888 XM_495896 XM_495908 XM_495909 XM_495920 XM_495939 XM_495947 XM_495950 XM_496028 XM_496041 XM_496044 XM_496050 XM_496054 XM_496075 XM_496134 XM_496191 XM_496239 XM_496251 XM_496266 XM_496267 XM_496349 XM_496351 XM_496405 XM_496436 XM_496437 XM_496467 XM_496496 XM_496502 XM_496519 XM_496547 XM_496549 XM_496575 XM_496581 XM_496584 XM_496608 XM_496619 XM_496690 XM_496692 XM_496723 XM_496749 XM_496804 XM_496836 XM_496844 XM_496879 XM_496889 XM_496904 XM_496907 XM_496943 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_496990 XM_497002 XM_497014 XM_497062 XM_497080 XM_497089 XM_497185 XM_498422 XM_498431 XM_498436 XM_498440 XM_498449 XM_498456 XM_498460 XM_498464 XM_498467 XM_498479 XM_498484 XM_498490 XM_498491 XM_498497 XM_498500 XM_498506 XM_498508 XM_498510 XM_498511 XM_498525 XM_498532 XM_498534 XM_498540 XM_498543 XM_498545 XM_498552 XM_498553 XM_498555 XM_498563 XM_498567 XM_498570 XM_498572 XM_498578 XM_498614 XM_498621 XM_498628 XM_498631 XM_498632 XM_498640 XM_498649 XM_498655 XM_498671 XM_498681 XM_498683 XM_498684 XM_498687 XM_498693 XM_498706 XM_498751 XM_498763 XM_498790 XM_498825 XM_498826 XM_498828 XM_498844 XM_498852 XM_498859 XM_498878 XM_498889 XM_498894 XM_498899 XM_498902 XM_498904 XM_498907 XM_498910 XM_498912 XM_498932 XM_498933 XM_498957 XM_498970 XM_498972 XM_498981 XM_498992 XM_498998 XM_499003 XM_499005 XM_499008 XM_499022 XM_499033 XM_499036 XM_499046 XM_499047 XM_499051 XM_499056 XM_499072 XM_499092 XM_499103 XM_499105 XM_499106 XM_499109 XM_499111 XM_499117 XM_499123 XM_499130 XM_499147 XM_499152 XM_499161 XM_499164 XM_499170 XM_499185 XM_499265 XM_499269 XM_499298 XM_499309 XM_499312 XM_499336 XM_499343 XM_499362 XM_499501 XM_499503 XM_499514 XM_499525 XM_499550 XM_499560 XM_499570 XM_499577 XM_499579 XM_499585 XM_499590 XM_499594 XM_499597 XR_000167 XR_000182 XR_000192 XR_000217 XR_000227 XR_000259 XR_000263 XR_000268 XR_000272 XR_000273 XR_000293
Genes with multiple seed matches:
NM_000046 NM_000074 NM_000091 NM_000114 NM_000125 NM_000151 NM_000153 NM_000199 NM_000219 NM_000268 NM_000276 NM_000278 NM_000299 NM_000330 NM_000332 NM_000334 NM_000348 NM_000364 NM_000376 NM_000402 NM_000425 NM_000428 NM_000445 NM_000457 NM_000478 NM_000520 NM_000538 NM_000555 NM_000599 NM_000609 NM_000610 NM_000611 NM_000660 NM_000664 NM_000691 NM_000702 NM_000721 NM_000733 NM_000751 NM_000799 NM_000849 NM_000877 NM_000896 NM_000916 NM_000923 NM_000962 NM_000991 NM_000997 NM_001001188 NM_001001389 NM_001001390 NM_001001391 NM_001001392 NM_001001396 NM_001001430 NM_001001431 NM_001001432 NM_001001433 NM_001001434 NM_001001664 NM_001001679 NM_001001681 NM_001001684 NM_001001694 NM_001001699 NM_001001702 NM_001001707 NM_001001794 NM_001001938 NM_001001991 NM_001002233 NM_001002762 NM_001002814 NM_001002840 NM_001004285 NM_001004286 NM_001004322 NM_001004336 NM_001004349 NM_001004426 NM_001004439 NM_001005210 NM_001005337 NM_001005387 NM_001005388 NM_001005502 NM_001005505 NM_001005609 NM_001005753 NM_001006115 NM_001006116 NM_001006944 NM_001007169 NM_001007240 NM_001007241 NM_001007242 NM_001007278 NM_001007466 NM_001007525 NM_001007543 NM_001008220 NM_001008234 NM_001008392 NM_001008408 NM_001008491 NM_001008492 NM_001008756 NM_001009553 NM_001009566 NM_001009880 NM_001009883 NM_001010846 NM_001010864 NM_001010867 NM_001010871 NM_001010898 NM_001010913 NM_001010915 NM_001010980 NM_001011513 NM_001011514 NM_001011540 NM_001012264 NM_001012300 NM_001012393 NM_001012511 NM_001012642 NM_001012659 NM_001012729 NM_001012755 NM_001012960 NM_001012982 NM_001013000 NM_001013002 NM_001013005 NM_001013615 NM_001013624 NM_001013649 NM_001013675 NM_001013678 NM_001013682 NM_001013687 NM_001013693 NM_001013705 NM_001013710 NM_001014374 NM_001014796 NM_001014797 NM_001015051 NM_001015053 NM_001017392 NM_001017396 NM_001017440 NM_001017535 NM_001017916 NM_001017917 NM_001017918 NM_001017967 NM_001017980 NM_001018050 NM_001018051 NM_001018052 NM_001018064 NM_001018065 NM_001018066 NM_001018089 NM_001018097 NM_001023565 NM_001024216 NM_001024401 NM_001024630 NM_001024676 NM_001024733 NM_001024843 NM_001024947 NM_001025076 NM_001025077 NM_001025202 NM_001025266 NM_001037 NM_001049 NM_001066 NM_001092 NM_001094 NM_001095 NM_001155 NM_001167 NM_001177 NM_001204 NM_001259 NM_001286 NM_001303 NM_001315 NM_001390 NM_001399 NM_001406 NM_001419 NM_001420 NM_001440 NM_001497 NM_001502 NM_001535 NM_001543 NM_001552 NM_001557 NM_001587 NM_001655 NM_001659 NM_001667 NM_001678 NM_001711 NM_001716 NM_001728 NM_001795 NM_001859 NM_001874 NM_001897 NM_001908 NM_001910 NM_001915 NM_001918 NM_001934 NM_001957 NM_001982 NM_001991 NM_002061 NM_002084 NM_002098 NM_002103 NM_002111 NM_002119 NM_002147 NM_002190 NM_002200 NM_002209 NM_002241 NM_002246 NM_002289 NM_002293 NM_002309 NM_002359 NM_002375 NM_002386 NM_002393 NM_002401 NM_002405 NM_002423 NM_002437 NM_002444 NM_002451 NM_002473 NM_002474 NM_002481 NM_002505 NM_002522 NM_002545 NM_002579 NM_002581 NM_002644 NM_002653 NM_002658 NM_002705 NM_002725 NM_002737 NM_002747 NM_002751 NM_002760 NM_002827 NM_002832 NM_002833 NM_002859 NM_002985 NM_002990 NM_002996 NM_003004 NM_003025 NM_003045 NM_003047 NM_003055 NM_003076 NM_003101 NM_003108 NM_003110 NM_003131 NM_003139 NM_003151 NM_003153 NM_003156 NM_003179 NM_003200 NM_003258 NM_003281 NM_003288 NM_003320 NM_003343 NM_003347 NM_003349 NM_003371 NM_003373 NM_003394 NM_003417 NM_003423 NM_003436 NM_003439 NM_003458 NM_003466 NM_003486 NM_003560 NM_003586 NM_003598 NM_003605 NM_003633 NM_003637 NM_003644 NM_003741 NM_003748 NM_003763 NM_003768 NM_003781 NM_003799 NM_003855 NM_003870 NM_003874 NM_003942 NM_003950 NM_003953 NM_003987 NM_003988 NM_003989 NM_003990 NM_004033 NM_004050 NM_004078 NM_004082 NM_004093 NM_004096 NM_004112 NM_004117 NM_004142 NM_004145 NM_004171 NM_004200 NM_004204 NM_004220 NM_004273 NM_004296 NM_004302 NM_004308 NM_004311 NM_004332 NM_004348 NM_004382 NM_004404 NM_004423 NM_004428 NM_004430 NM_004433 NM_004442 NM_004454 NM_004474 NM_004481 NM_004505 NM_004513 NM_004514 NM_004518 NM_004523 NM_004530 NM_004554 NM_004571 NM_004573 NM_004603 NM_004613 NM_004646 NM_004729 NM_004745 NM_004756 NM_004759 NM_004823 NM_004863 NM_004925 NM_004936 NM_004947 NM_004948 NM_004992 NM_004995 NM_005018 NM_005042 NM_005044 NM_005054 NM_005063 NM_005070 NM_005076 NM_005081 NM_005108 NM_005144 NM_005149 NM_005157 NM_005173 NM_005188 NM_005189 NM_005216 NM_005224 NM_005229 NM_005253 NM_005257 NM_005262 NM_005310 NM_005312 NM_005329 NM_005334 NM_005338 NM_005374 NM_005376 NM_005407 NM_005413 NM_005424 NM_005430 NM_005458 NM_005474 NM_005538 NM_005556 NM_005584 NM_005628 NM_005629 NM_005632 NM_005634 NM_005665 NM_005682 NM_005686 NM_005699 NM_005730 NM_005762 NM_005779 NM_005785 NM_005798 NM_005808 NM_005814 NM_005816 NM_005817 NM_005819 NM_005865 NM_005902 NM_005920 NM_005933 NM_005957 NM_005975 NM_006030 NM_006034 NM_006037 NM_006038 NM_006045 NM_006059 NM_006060 NM_006062 NM_006065 NM_006094 NM_006116 NM_006125 NM_006131 NM_006134 NM_006155 NM_006162 NM_006176 NM_006180 NM_006182 NM_006187 NM_006190 NM_006202 NM_006212 NM_006221 NM_006282 NM_006283 NM_006289 NM_006298 NM_006306 NM_006315 NM_006336 NM_006337 NM_006345 NM_006377 NM_006378 NM_006411 NM_006455 NM_006457 NM_006481 NM_006492 NM_006494 NM_006546 NM_006561 NM_006650 NM_006678 NM_006731 NM_006732 NM_006760 NM_006772 NM_006780 NM_006913 NM_006926 NM_006936 NM_006941 NM_006984 NM_006991 NM_006994 NM_007030 NM_007050 NM_007073 NM_007108 NM_007185 NM_007189 NM_007224 NM_007229 NM_007238 NM_007243 NM_007306 NM_007313 NM_007357 NM_007363 NM_009586 NM_012098 NM_012102 NM_012146 NM_012199 NM_012211 NM_012232 NM_012236 NM_012244 NM_012262 NM_012279 NM_012288 NM_012320 NM_012325 NM_012326 NM_012396 NM_012398 NM_012400 NM_012402 NM_012434 NM_012448 NM_012468 NM_013233 NM_013245 NM_013255 NM_013276 NM_013279 NM_013313 NM_013372 NM_013382 NM_013389 NM_013399 NM_013402 NM_013422 NM_013433 NM_013444 NM_013447 NM_013943 NM_013951 NM_013952 NM_013953 NM_013992 NM_014000 NM_014002 NM_014030 NM_014046 NM_014112 NM_014172 NM_014212 NM_014216 NM_014235 NM_014263 NM_014293 NM_014313 NM_014326 NM_014403 NM_014418 NM_014434 NM_014460 NM_014513 NM_014550 NM_014556 NM_014586 NM_014587 NM_014600 NM_014615 NM_014635 NM_014636 NM_014656 NM_014661 NM_014665 NM_014667 NM_014690 NM_014723 NM_014732 NM_014734 NM_014747 NM_014757 NM_014759 NM_014766 NM_014767 NM_014784 NM_014789 NM_014844 NM_014849 NM_014850 NM_014862 NM_014864 NM_014867 NM_014902 NM_014935 NM_014940 NM_014944 NM_014947 NM_014969 NM_014988 NM_014994 NM_015002 NM_015022 NM_015033 NM_015035 NM_015039 NM_015064 NM_015074 NM_015076 NM_015077 NM_015082 NM_015088 NM_015090 NM_015092 NM_015094 NM_015107 NM_015111 NM_015140 NM_015141 NM_015194 NM_015206 NM_015245 NM_015254 NM_015260 NM_015264 NM_015285 NM_015288 NM_015289 NM_015318 NM_015329 NM_015340 NM_015343 NM_015347 NM_015375 NM_015399 NM_015430 NM_015458 NM_015470 NM_015537 NM_015557 NM_015564 NM_015621 NM_015651 NM_015666 NM_015680 NM_015686 NM_015836 NM_015891 NM_015995 NM_016025 NM_016079 NM_016089 NM_016147 NM_016169 NM_016173 NM_016201 NM_016202 NM_016206 NM_016257 NM_016263 NM_016272 NM_016297 NM_016339 NM_016418 NM_016426 NM_016458 NM_016540 NM_016541 NM_016543 NM_016544 NM_016575 NM_016577 NM_016579 NM_016605 NM_016632 NM_017410 NM_017424 NM_017449 NM_017451 NM_017495 NM_017521 NM_017540 NM_017549 NM_017556 NM_017583 NM_017592 NM_017655 NM_017662 NM_017713 NM_017728 NM_017740 NM_017770 NM_017772 NM_017781 NM_017797 NM_017848 NM_017849 NM_017873 NM_017882 NM_017893 NM_017902 NM_017912 NM_017928 NM_017966 NM_017990 NM_018017 NM_018023 NM_018029 NM_018066 NM_018153 NM_018168 NM_018181 NM_018194 NM_018199 NM_018201 NM_018205 NM_018209 NM_018224 NM_018239 NM_018244 NM_018304 NM_018320 NM_018340 NM_018409 NM_018641 NM_018653 NM_018656 NM_018715 NM_018719 NM_018727 NM_018941 NM_018947 NM_018977 NM_018991 NM_019008 NM_019014 NM_019022 NM_019027 NM_019061 NM_019089 NM_019094 NM_019099 NM_019106 NM_019601 NM_019857 NM_019885 NM_020039 NM_020064 NM_020134 NM_020142 NM_020151 NM_020168 NM_020182 NM_020190 NM_020200 NM_020208 NM_020245 NM_020338 NM_020377 NM_020405 NM_020429 NM_020431 NM_020433 NM_020444 NM_020448 NM_020451 NM_020462 NM_020552 NM_020553 NM_020698 NM_020713 NM_020724 NM_020728 NM_020746 NM_020750 NM_020754 NM_020769 NM_020773 NM_020777 NM_020778 NM_020792 NM_020804 NM_020850 NM_020877 NM_020898 NM_020899 NM_020914 NM_020917 NM_020925 NM_020956 NM_020970 NM_020988 NM_021008 NM_021020 NM_021035 NM_021038 NM_021088 NM_021100 NM_021116 NM_021117 NM_021167 NM_021168 NM_021181 NM_021200 NM_021202 NM_021255 NM_021627 NM_021635 NM_021705 NM_021735 NM_021736 NM_021737 NM_021813 NM_021828 NM_021907 NM_021962 NM_021965 NM_021977 NM_021988 NM_022036 NM_022098 NM_022106 NM_022131 NM_022153 NM_022169 NM_022170 NM_022367 NM_022405 NM_022437 NM_022442 NM_022465 NM_022468 NM_022473 NM_022480 NM_022566 NM_022658 NM_022663 NM_022718 NM_022730 NM_022787 NM_022791 NM_022821 NM_022832 NM_022844 NM_022893 NM_022898 NM_023002 NM_023019 NM_023107 NM_023108 NM_023930 NM_023947 NM_024003 NM_024017 NM_024080 NM_024103 NM_024111 NM_024297 NM_024311 NM_024325 NM_024342 NM_024421 NM_024506 NM_024512 NM_024513 NM_024522 NM_024551 NM_024569 NM_024611 NM_024616 NM_024620 NM_024627 NM_024646 NM_024647 NM_024667 NM_024705 NM_024709 NM_024718 NM_024735 NM_024761 NM_024771 NM_024830 NM_024843 NM_024845 NM_024847 NM_024859 NM_024866 NM_024873 NM_024874 NM_024881 NM_024887 NM_024907 NM_024915 NM_024917 NM_024923 NM_024935 NM_024940 NM_024955 NM_024974 NM_025042 NM_025057 NM_025059 NM_025083 NM_025104 NM_025151 NM_025154 NM_025182 NM_025189 NM_025219 NM_025220 NM_025222 NM_030621 NM_030629 NM_030655 NM_030781 NM_030783 NM_030799 NM_030812 NM_030884 NM_030918 NM_030927 NM_030936 NM_030952 NM_030957 NM_030964 NM_030981 NM_031265 NM_031281 NM_031282 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031468 NM_031490 NM_031886 NM_031889 NM_031905 NM_031954 NM_031992 NM_032012 NM_032017 NM_032041 NM_032042 NM_032045 NM_032051 NM_032105 NM_032160 NM_032174 NM_032281 NM_032287 NM_032294 NM_032296 NM_032348 NM_032374 NM_032508 NM_032638 NM_032643 NM_032644 NM_032701 NM_032706 NM_032710 NM_032711 NM_032737 NM_032741 NM_032750 NM_032753 NM_032756 NM_032783 NM_032804 NM_032809 NM_032815 NM_032826 NM_032866 NM_032899 NM_032924 NM_032932 NM_032960 NM_032966 NM_032967 NM_032971 NM_032972 NM_032975 NM_032980 NM_032983 NM_032984 NM_032988 NM_032998 NM_033045 NM_033086 NM_033089 NM_033102 NM_033129 NM_033133 NM_033147 NM_033148 NM_033198 NM_033224 NM_033240 NM_033244 NM_033245 NM_033274 NM_033288 NM_033346 NM_033397 NM_033516 NM_033549 NM_033624 NM_033631 NM_033656 NM_052811 NM_052834 NM_052847 NM_052848 NM_052862 NM_052874 NM_052890 NM_052906 NM_052909 NM_052916 NM_052925 NM_052928 NM_052941 NM_052949 NM_053042 NM_058178 NM_078487 NM_080551 NM_080588 NM_080589 NM_080591 NM_080612 NM_080704 NM_080705 NM_080706 NM_080821 NM_080836 NM_130386 NM_130387 NM_130807 NM_130848 NM_133170 NM_133171 NM_133279 NM_133280 NM_133371 NM_133444 NM_133452 NM_133459 NM_133463 NM_133490 NM_134264 NM_134422 NM_134423 NM_134424 NM_138281 NM_138298 NM_138300 NM_138338 NM_138368 NM_138384 NM_138415 NM_138444 NM_138450 NM_138456 NM_138458 NM_138468 NM_138473 NM_138576 NM_138731 NM_138799 NM_138961 NM_139012 NM_139014 NM_139016 NM_139018 NM_139071 NM_139125 NM_139170 NM_139267 NM_139312 NM_144579 NM_144582 NM_144617 NM_144618 NM_144692 NM_144984 NM_144991 NM_145056 NM_145060 NM_145166 NM_145173 NM_145174 NM_145185 NM_145231 NM_145265 NM_145279 NM_145282 NM_145313 NM_145646 NM_145733 NM_145734 NM_147134 NM_147147 NM_147148 NM_147161 NM_147192 NM_147202 NM_147780 NM_147781 NM_147782 NM_147783 NM_148169 NM_148171 NM_148964 NM_152235 NM_152253 NM_152255 NM_152257 NM_152272 NM_152284 NM_152333 NM_152361 NM_152362 NM_152363 NM_152371 NM_152403 NM_152406 NM_152422 NM_152470 NM_152472 NM_152475 NM_152480 NM_152496 NM_152568 NM_152622 NM_152624 NM_152686 NM_152717 NM_152785 NM_152793 NM_152831 NM_152860 NM_152888 NM_152891 NM_152903 NM_152913 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152990 NM_153033 NM_153035 NM_153041 NM_153202 NM_153233 NM_153246 NM_153247 NM_153273 NM_153347 NM_153375 NM_153442 NM_153453 NM_153487 NM_153498 NM_153619 NM_153705 NM_153712 NM_170706 NM_170710 NM_170743 NM_172069 NM_172206 NM_172217 NM_172225 NM_172239 NM_172241 NM_172388 NM_172389 NM_173042 NM_173043 NM_173044 NM_173064 NM_173065 NM_173079 NM_173342 NM_173352 NM_173463 NM_173476 NM_173509 NM_173555 NM_173566 NM_173582 NM_173602 NM_173607 NM_173611 NM_173640 NM_173661 NM_173669 NM_173681 NM_173687 NM_173825 NM_173833 NM_173854 NM_174869 NM_174902 NM_174911 NM_174934 NM_174953 NM_174954 NM_174955 NM_174956 NM_174957 NM_174958 NM_174975 NM_174976 NM_174977 NM_175039 NM_175040 NM_175060 NM_175609 NM_175736 NM_175745 NM_175859 NM_175871 NM_175892 NM_175901 NM_175908 NM_176812 NM_176815 NM_176823 NM_176871 NM_177401 NM_177405 NM_177438 NM_177972 NM_177978 NM_177979 NM_177995 NM_177999 NM_178037 NM_178038 NM_178039 NM_178040 NM_178122 NM_178126 NM_178140 NM_178151 NM_178152 NM_178153 NM_178422 NM_178448 NM_178500 NM_178509 NM_178516 NM_178544 NM_178564 NM_178565 NM_178568 NM_178814 NM_178820 NM_178830 NM_178831 NM_178849 NM_181265 NM_181349 NM_181356 NM_181430 NM_181431 NM_181453 NM_181489 NM_181701 NM_181709 NM_181719 NM_181740 NM_181744 NM_181784 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181844 NM_181846 NM_182500 NM_182507 NM_182509 NM_182534 NM_182557 NM_182643 NM_182645 NM_182685 NM_182688 NM_182704 NM_182728 NM_182764 NM_182798 NM_182799 NM_182801 NM_182848 NM_182894 NM_182901 NM_183006 NM_183360 NM_183361 NM_183377 NM_183397 NM_183425 NM_194286 NM_194288 NM_194295 NM_194309 NM_194310 NM_194316 NM_194358 NM_194359 NM_194452 NM_194453 NM_197974 NM_198066 NM_198080 NM_198157 NM_198196 NM_198236 NM_198253 NM_198254 NM_198266 NM_198274 NM_198277 NM_198320 NM_198321 NM_198390 NM_198441 NM_198442 NM_198457 NM_198476 NM_198483 NM_198490 NM_198501 NM_198540 NM_198542 NM_198545 NM_198549 NM_198554 NM_198562 NM_198568 NM_198571 NM_198587 NM_198589 NM_198590 NM_198591 NM_198679 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198850 NM_198859 NM_198887 NM_198893 NM_198900 NM_198926 NM_198990 NM_199040 NM_199044 NM_199045 NM_199072 NM_199144 NM_199169 NM_199170 NM_199171 NM_199203 NM_199265 NM_199296 NM_199359 NM_199360 NM_199361 NM_199362 NM_199363 NM_199461 NM_199462 NM_199484 NM_199485 NM_199487 NM_199513 NM_201263 NM_201348 NM_201378 NM_201379 NM_201380 NM_201381 NM_201382 NM_201383 NM_201384 NM_201403 NM_201432 NM_201433 NM_201524 NM_201525 NM_201574 NM_203305 NM_203329 NM_203330 NM_203331 NM_203351 NM_203426 NM_203452 NM_205861 NM_206832 NM_206835 NM_206889 NM_206926 NM_206962 NM_207115 NM_207119 NM_207292 NM_207293 NM_207294 NM_207295 NM_207296 NM_207297 NM_207320 NM_207326 NM_207335 NM_207367 NM_207388 NM_207394 NM_207412 NM_207419 NM_207428 NM_207434 NM_207444 NM_207447 NM_207448 NM_207451 NM_207458 NM_207463 NM_207467 NM_207477 NM_207478 NM_207505 NM_207511 NM_207514 NM_207646 NM_207672 NM_213566 NM_213589 NM_213590 XM_034274 XM_036115 XM_037557 XM_038436 XM_039393 XM_042936 XM_043493 XM_047610 XM_055866 XM_084529 XM_084852 XM_087353 XM_113743 XM_209363 XM_209824 XM_209913 XM_211871 XM_211896 XM_290502 XM_290540 XM_290579 XM_290670 XM_290737 XM_292717 XM_297816 XM_350880 XM_370696 XM_370878 XM_371082 XM_371176 XM_371177 XM_371214 XM_371302 XM_371304 XM_371399 XM_371461 XM_371488 XM_371655 XM_371755 XM_372035 XM_372038 XM_372193 XM_372194 XM_372205 XM_372716 XM_373513 XM_373704 XM_373737 XM_373744 XM_373765 XM_373798 XM_373883 XM_374086 XM_374120 XM_374169 XM_374399 XM_374414 XM_374781 XM_374976 XM_375174 XM_375183 XM_375357 XM_375456 XM_375491 XM_375602 XM_375606 XM_375629 XM_375729 XM_375816 XM_376018 XM_376212 XM_376254 XM_376269 XM_376454 XM_376522 XM_376558 XM_376560 XM_376587 XM_376607 XM_376658 XM_376677 XM_376679 XM_376784 XM_376902 XM_377002 XM_377742 XM_378208 XM_378238 XM_378321 XM_378327 XM_378394 XM_378511 XM_378546 XM_378558 XM_378567 XM_378631 XM_378655 XM_378667 XM_378678 XM_378730 XM_378760 XM_378783 XM_378786 XM_378825 XM_378855 XM_378876 XM_378971 XM_378993 XM_379030 XM_379044 XM_379075 XM_379100 XM_379106 XM_379114 XM_379135 XM_379136 XM_379177 XM_379214 XM_379276 XM_379280 XM_379318 XM_379363 XM_379409 XM_379417 XM_379454 XM_379456 XM_379458 XM_379510 XM_379594 XM_379595 XM_379597 XM_379643 XM_379648 XM_379827 XM_379840 XM_379897 XM_379927 XM_379931 XM_379933 XM_380103 XM_380131 XM_495888 XM_495909 XM_496134 XM_496191 XM_496351 XM_496575 XM_496581 XM_496619 XM_496690 XM_496692 XM_496879 XM_496907 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497080 XM_498440 XM_498479 XM_498484 XM_498534 XM_498540 XM_498545 XM_498563 XM_498572 XM_498614 XM_498649 XM_498683 XM_498687 XM_498828 XM_498859 XM_498894 XM_498907 XM_498910 XM_498912 XM_499022 XM_499046 XM_499051 XM_499056 XM_499106 XM_499130 XM_499147 XM_499152 XM_499161 XM_499170 XM_499298 XM_499343 XM_499362 XM_499503 XM_499570 XR_000182 XR_000227 XR_000263 XR_000268
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)