VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"cgucuaggcccccgaaccac"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
4920
.
Total Genes with multiple seed matches:
1041
.
Genes with at least one seed match:
NM_000025 NM_000028 NM_000029 NM_000030 NM_000031 NM_000037 NM_000043 NM_000046 NM_000056 NM_000065 NM_000069 NM_000070 NM_000077 NM_000080 NM_000081 NM_000091 NM_000097 NM_000103 NM_000104 NM_000107 NM_000113 NM_000116 NM_000121 NM_000122 NM_000133 NM_000134 NM_000136 NM_000148 NM_000161 NM_000167 NM_000173 NM_000176 NM_000188 NM_000195 NM_000199 NM_000207 NM_000214 NM_000215 NM_000216 NM_000220 NM_000221 NM_000222 NM_000230 NM_000240 NM_000245 NM_000246 NM_000250 NM_000254 NM_000268 NM_000272 NM_000276 NM_000278 NM_000293 NM_000297 NM_000299 NM_000310 NM_000322 NM_000327 NM_000332 NM_000334 NM_000335 NM_000337 NM_000342 NM_000348 NM_000351 NM_000362 NM_000365 NM_000367 NM_000368 NM_000382 NM_000397 NM_000401 NM_000405 NM_000406 NM_000411 NM_000418 NM_000424 NM_000428 NM_000429 NM_000430 NM_000433 NM_000439 NM_000441 NM_000447 NM_000463 NM_000489 NM_000491 NM_000492 NM_000494 NM_000499 NM_000506 NM_000530 NM_000543 NM_000554 NM_000555 NM_000564 NM_000565 NM_000567 NM_000569 NM_000570 NM_000574 NM_000575 NM_000579 NM_000585 NM_000587 NM_000592 NM_000593 NM_000595 NM_000609 NM_000616 NM_000621 NM_000623 NM_000632 NM_000633 NM_000635 NM_000637 NM_000639 NM_000642 NM_000643 NM_000644 NM_000645 NM_000646 NM_000647 NM_000663 NM_000664 NM_000670 NM_000682 NM_000686 NM_000687 NM_000693 NM_000695 NM_000702 NM_000710 NM_000726 NM_000755 NM_000761 NM_000781 NM_000785 NM_000791 NM_000792 NM_000793 NM_000799 NM_000805 NM_000806 NM_000809 NM_000821 NM_000832 NM_000834 NM_000843 NM_000844 NM_000851 NM_000861 NM_000875 NM_000877 NM_000883 NM_000887 NM_000890 NM_000896 NM_000901 NM_000902 NM_000914 NM_000918 NM_000927 NM_000950 NM_000953 NM_000959 NM_000961 NM_000963 NM_000983 NM_000991 NM_001001188 NM_001001323 NM_001001342 NM_001001419 NM_001001420 NM_001001522 NM_001001552 NM_001001557 NM_001001567 NM_001001568 NM_001001569 NM_001001570 NM_001001571 NM_001001572 NM_001001573 NM_001001574 NM_001001575 NM_001001576 NM_001001577 NM_001001578 NM_001001579 NM_001001580 NM_001001581 NM_001001582 NM_001001583 NM_001001584 NM_001001585 NM_001001669 NM_001001675 NM_001001679 NM_001001690 NM_001001703 NM_001001704 NM_001001709 NM_001001713 NM_001001723 NM_001001794 NM_001001851 NM_001001870 NM_001001871 NM_001001874 NM_001001878 NM_001001890 NM_001001894 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001002029 NM_001002234 NM_001002257 NM_001002260 NM_001002758 NM_001002762 NM_001002836 NM_001002860 NM_001002861 NM_001002914 NM_001002920 NM_001002924 NM_001003406 NM_001003407 NM_001003408 NM_001003665 NM_001003674 NM_001003675 NM_001003679 NM_001003681 NM_001003689 NM_001003698 NM_001003699 NM_001003712 NM_001003722 NM_001003795 NM_001003800 NM_001003807 NM_001003818 NM_001003819 NM_001003827 NM_001003938 NM_001003940 NM_001003942 NM_001003943 NM_001003945 NM_001004053 NM_001004054 NM_001004127 NM_001004197 NM_001004285 NM_001004286 NM_001004299 NM_001004301 NM_001004302 NM_001004308 NM_001004317 NM_001004325 NM_001004339 NM_001004349 NM_001004352 NM_001004360 NM_001004432 NM_001004433 NM_001004441 NM_001004720 NM_001004722 NM_001005176 NM_001005337 NM_001005353 NM_001005364 NM_001005365 NM_001005386 NM_001005387 NM_001005388 NM_001005404 NM_001005405 NM_001005409 NM_001005413 NM_001005414 NM_001005463 NM_001005473 NM_001005474 NM_001005609 NM_001005611 NM_001005746 NM_001005747 NM_001005845 NM_001005861 NM_001005914 NM_001006113 NM_001006600 NM_001006604 NM_001006612 NM_001006613 NM_001006614 NM_001006615 NM_001006634 NM_001006641 NM_001006642 NM_001006643 NM_001006655 NM_001006656 NM_001006657 NM_001006665 NM_001006932 NM_001006935 NM_001006936 NM_001006937 NM_001006939 NM_001006946 NM_001007023 NM_001007024 NM_001007025 NM_001007072 NM_001007088 NM_001007094 NM_001007097 NM_001007188 NM_001007224 NM_001007225 NM_001007234 NM_001007237 NM_001007239 NM_001007254 NM_001007258 NM_001007262 NM_001007269 NM_001007270 NM_001007271 NM_001007274 NM_001007275 NM_001007534 NM_001007546 NM_001007593 NM_001008220 NM_001008223 NM_001008224 NM_001008226 NM_001008239 NM_001008390 NM_001008392 NM_001008396 NM_001008407 NM_001008409 NM_001008410 NM_001008490 NM_001008493 NM_001008529 NM_001008537 NM_001008568 NM_001008569 NM_001008570 NM_001008571 NM_001008657 NM_001008697 NM_001008707 NM_001008710 NM_001008711 NM_001008738 NM_001008742 NM_001008745 NM_001008781 NM_001008800 NM_001008883 NM_001008917 NM_001009555 NM_001009565 NM_001009569 NM_001009610 NM_001009612 NM_001009880 NM_001009883 NM_001009909 NM_001009921 NM_001009932 NM_001009933 NM_001009934 NM_001009991 NM_001010852 NM_001010854 NM_001010861 NM_001010867 NM_001010871 NM_001010883 NM_001010888 NM_001010891 NM_001010902 NM_001010910 NM_001010925 NM_001010935 NM_001010939 NM_001010980 NM_001011513 NM_001011514 NM_001011539 NM_001011553 NM_001011655 NM_001011658 NM_001011666 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011703 NM_001011708 NM_001011713 NM_001012239 NM_001012329 NM_001012339 NM_001012361 NM_001012418 NM_001012426 NM_001012427 NM_001012514 NM_001012516 NM_001012642 NM_001012651 NM_001012707 NM_001012710 NM_001012714 NM_001012732 NM_001012733 NM_001012734 NM_001012750 NM_001012751 NM_001012752 NM_001012755 NM_001012761 NM_001012763 NM_001012957 NM_001012968 NM_001012973 NM_001012977 NM_001012979 NM_001012980 NM_001012984 NM_001012985 NM_001012986 NM_001012989 NM_001012993 NM_001013031 NM_001013399 NM_001013404 NM_001013406 NM_001013624 NM_001013627 NM_001013634 NM_001013637 NM_001013656 NM_001013669 NM_001013675 NM_001013677 NM_001013678 NM_001013681 NM_001013682 NM_001013687 NM_001013690 NM_001013697 NM_001013710 NM_001013715 NM_001013721 NM_001013724 NM_001013727 NM_001013728 NM_001013839 NM_001014283 NM_001014434 NM_001014450 NM_001014765 NM_001014797 NM_001014809 NM_001014831 NM_001014832 NM_001014833 NM_001014834 NM_001014835 NM_001014975 NM_001014987 NM_001014988 NM_001014989 NM_001015047 NM_001015051 NM_001015053 NM_001015055 NM_001015056 NM_001015887 NM_001015891 NM_001017368 NM_001017392 NM_001017395 NM_001017396 NM_001017405 NM_001017408 NM_001017418 NM_001017420 NM_001017430 NM_001017440 NM_001017523 NM_001017961 NM_001017970 NM_001017972 NM_001017973 NM_001017974 NM_001017987 NM_001017989 NM_001018003 NM_001018009 NM_001018050 NM_001018051 NM_001018052 NM_001018053 NM_001018061 NM_001018062 NM_001018065 NM_001018066 NM_001018072 NM_001018074 NM_001018075 NM_001018076 NM_001018077 NM_001018089 NM_001018095 NM_001018097 NM_001018099 NM_001018111 NM_001020818 NM_001020819 NM_001020820 NM_001020821 NM_001020825 NM_001023562 NM_001023563 NM_001023566 NM_001023582 NM_001024024 NM_001024070 NM_001024094 NM_001024209 NM_001024216 NM_001024218 NM_001024457 NM_001024593 NM_001024608 NM_001024611 NM_001024630 NM_001024649 NM_001024657 NM_001024660 NM_001024668 NM_001024669 NM_001024670 NM_001024671 NM_001024680 NM_001024681 NM_001024688 NM_001024847 NM_001024855 NM_001024912 NM_001025068 NM_001025069 NM_001025076 NM_001025077 NM_001025100 NM_001025107 NM_001025109 NM_001025231 NM_001025252 NM_001025253 NM_001025266 NM_001025295 NM_001043 NM_001046 NM_001050 NM_001058 NM_001072 NM_001080 NM_001092 NM_001093 NM_001095 NM_001111 NM_001116 NM_001119 NM_001126 NM_001141 NM_001144 NM_001160 NM_001165 NM_001167 NM_001185 NM_001191 NM_001196 NM_001206 NM_001218 NM_001224 NM_001227 NM_001244 NM_001247 NM_001256 NM_001259 NM_001267 NM_001271 NM_001274 NM_001284 NM_001286 NM_001291 NM_001293 NM_001296 NM_001310 NM_001313 NM_001326 NM_001334 NM_001375 NM_001381 NM_001382 NM_001383 NM_001384 NM_001386 NM_001387 NM_001388 NM_001390 NM_001391 NM_001392 NM_001394 NM_001396 NM_001399 NM_001401 NM_001410 NM_001414 NM_001418 NM_001421 NM_001432 NM_001438 NM_001457 NM_001458 NM_001461 NM_001465 NM_001481 NM_001482 NM_001497 NM_001520 NM_001538 NM_001542 NM_001543 NM_001547 NM_001551 NM_001557 NM_001558 NM_001560 NM_001567 NM_001568 NM_001585 NM_001587 NM_001605 NM_001606 NM_001609 NM_001614 NM_001617 NM_001636 NM_001649 NM_001656 NM_001674 NM_001679 NM_001682 NM_001695 NM_001701 NM_001706 NM_001709 NM_001712 NM_001716 NM_001718 NM_001719 NM_001722 NM_001738 NM_001746 NM_001748 NM_001753 NM_001754 NM_001756 NM_001759 NM_001760 NM_001761 NM_001768 NM_001773 NM_001788 NM_001789 NM_001791 NM_001795 NM_001796 NM_001798 NM_001806 NM_001815 NM_001817 NM_001830 NM_001831 NM_001839 NM_001848 NM_001851 NM_001858 NM_001859 NM_001883 NM_001896 NM_001903 NM_001908 NM_001921 NM_001924 NM_001946 NM_001949 NM_001968 NM_001981 NM_001987 NM_001990 NM_001991 NM_001993 NM_001995 NM_001999 NM_002015 NM_002020 NM_002025 NM_002033 NM_002040 NM_002052 NM_002061 NM_002064 NM_002076 NM_002077 NM_002080 NM_002081 NM_002086 NM_002102 NM_002103 NM_002121 NM_002122 NM_002158 NM_002160 NM_002197 NM_002203 NM_002204 NM_002205 NM_002209 NM_002216 NM_002218 NM_002221 NM_002222 NM_002223 NM_002235 NM_002241 NM_002250 NM_002251 NM_002271 NM_002272 NM_002293 NM_002298 NM_002299 NM_002313 NM_002314 NM_002357 NM_002358 NM_002359 NM_002375 NM_002382 NM_002390 NM_002399 NM_002420 NM_002427 NM_002431 NM_002435 NM_002442 NM_002447 NM_002460 NM_002468 NM_002473 NM_002481 NM_002483 NM_002485 NM_002490 NM_002492 NM_002501 NM_002507 NM_002508 NM_002518 NM_002524 NM_002526 NM_002547 NM_002558 NM_002566 NM_002577 NM_002579 NM_002581 NM_002588 NM_002591 NM_002596 NM_002603 NM_002604 NM_002606 NM_002609 NM_002610 NM_002613 NM_002623 NM_002629 NM_002631 NM_002637 NM_002640 NM_002642 NM_002655 NM_002657 NM_002665 NM_002666 NM_002668 NM_002677 NM_002679 NM_002693 NM_002698 NM_002702 NM_002709 NM_002715 NM_002716 NM_002720 NM_002735 NM_002737 NM_002747 NM_002752 NM_002765 NM_002786 NM_002802 NM_002823 NM_002827 NM_002829 NM_002832 NM_002834 NM_002838 NM_002840 NM_002843 NM_002844 NM_002847 NM_002850 NM_002857 NM_002859 NM_002869 NM_002884 NM_002886 NM_002898 NM_002906 NM_002913 NM_002919 NM_002928 NM_002938 NM_002941 NM_002948 NM_002953 NM_002955 NM_002958 NM_002959 NM_002972 NM_002974 NM_002982 NM_002997 NM_002998 NM_002999 NM_003003 NM_003004 NM_003005 NM_003010 NM_003012 NM_003022 NM_003023 NM_003030 NM_003034 NM_003043 NM_003045 NM_003060 NM_003071 NM_003074 NM_003076 NM_003077 NM_003092 NM_003094 NM_003101 NM_003106 NM_003108 NM_003112 NM_003114 NM_003118 NM_003122 NM_003128 NM_003129 NM_003131 NM_003137 NM_003141 NM_003144 NM_003149 NM_003155 NM_003156 NM_003159 NM_003161 NM_003167 NM_003173 NM_003179 NM_003180 NM_003186 NM_003189 NM_003190 NM_003194 NM_003200 NM_003203 NM_003205 NM_003212 NM_003215 NM_003234 NM_003236 NM_003239 NM_003242 NM_003243 NM_003247 NM_003255 NM_003257 NM_003262 NM_003281 NM_003291 NM_003307 NM_003314 NM_003315 NM_003316 NM_003320 NM_003326 NM_003337 NM_003343 NM_003344 NM_003348 NM_003349 NM_003359 NM_003362 NM_003373 NM_003379 NM_003384 NM_003387 NM_003388 NM_003389 NM_003390 NM_003392 NM_003404 NM_003408 NM_003413 NM_003415 NM_003417 NM_003421 NM_003436 NM_003438 NM_003439 NM_003444 NM_003454 NM_003463 NM_003466 NM_003471 NM_003474 NM_003489 NM_003490 NM_003494 NM_003498 NM_003507 NM_003509 NM_003538 NM_003559 NM_003565 NM_003581 NM_003590 NM_003593 NM_003594 NM_003596 NM_003597 NM_003605 NM_003611 NM_003615 NM_003617 NM_003618 NM_003624 NM_003639 NM_003640 NM_003643 NM_003644 NM_003647 NM_003661 NM_003663 NM_003670 NM_003677 NM_003679 NM_003681 NM_003702 NM_003708 NM_003710 NM_003711 NM_003713 NM_003714 NM_003721 NM_003722 NM_003724 NM_003727 NM_003728 NM_003734 NM_003735 NM_003736 NM_003737 NM_003740 NM_003741 NM_003743 NM_003745 NM_003749 NM_003774 NM_003778 NM_003783 NM_003794 NM_003800 NM_003804 NM_003816 NM_003820 NM_003829 NM_003831 NM_003835 NM_003858 NM_003861 NM_003862 NM_003877 NM_003883 NM_003888 NM_003889 NM_003896 NM_003901 NM_003904 NM_003909 NM_003920 NM_003926 NM_003943 NM_003948 NM_003949 NM_003950 NM_003954 NM_003955 NM_003966 NM_003968 NM_003972 NM_003974 NM_003978 NM_003980 NM_003985 NM_003987 NM_003988 NM_003989 NM_003990 NM_004003 NM_004024 NM_004037 NM_004059 NM_004060 NM_004063 NM_004077 NM_004080 NM_004091 NM_004092 NM_004103 NM_004105 NM_004112 NM_004113 NM_004117 NM_004120 NM_004124 NM_004132 NM_004133 NM_004140 NM_004147 NM_004154 NM_004155 NM_004162 NM_004171 NM_004183 NM_004197 NM_004199 NM_004200 NM_004204 NM_004213 NM_004229 NM_004237 NM_004256 NM_004258 NM_004276 NM_004278 NM_004283 NM_004288 NM_004300 NM_004302 NM_004315 NM_004319 NM_004329 NM_004330 NM_004333 NM_004337 NM_004338 NM_004342 NM_004346 NM_004348 NM_004350 NM_004370 NM_004376 NM_004382 NM_004386 NM_004389 NM_004391 NM_004392 NM_004393 NM_004394 NM_004402 NM_004417 NM_004418 NM_004426 NM_004428 NM_004434 NM_004437 NM_004438 NM_004442 NM_004454 NM_004458 NM_004464 NM_004481 NM_004484 NM_004498 NM_004505 NM_004506 NM_004513 NM_004514 NM_004523 NM_004527 NM_004553 NM_004554 NM_004557 NM_004561 NM_004566 NM_004569 NM_004583 NM_004588 NM_004598 NM_004602 NM_004612 NM_004613 NM_004620 NM_004622 NM_004627 NM_004636 NM_004641 NM_004650 NM_004656 NM_004657 NM_004671 NM_004673 NM_004676 NM_004681 NM_004686 NM_004703 NM_004711 NM_004717 NM_004723 NM_004724 NM_004728 NM_004730 NM_004738 NM_004745 NM_004747 NM_004756 NM_004762 NM_004770 NM_004776 NM_004781 NM_004790 NM_004795 NM_004796 NM_004797 NM_004801 NM_004804 NM_004821 NM_004843 NM_004844 NM_004845 NM_004848 NM_004850 NM_004859 NM_004860 NM_004862 NM_004863 NM_004871 NM_004878 NM_004893 NM_004896 NM_004902 NM_004904 NM_004912 NM_004913 NM_004914 NM_004924 NM_004926 NM_004938 NM_004947 NM_004952 NM_004958 NM_004964 NM_004982 NM_004992 NM_004996 NM_005023 NM_005026 NM_005036 NM_005045 NM_005050 NM_005063 NM_005068 NM_005070 NM_005076 NM_005079 NM_005082 NM_005093 NM_005094 NM_005096 NM_005097 NM_005102 NM_005105 NM_005109 NM_005116 NM_005142 NM_005160 NM_005181 NM_005184 NM_005187 NM_005190 NM_005197 NM_005201 NM_005202 NM_005206 NM_005207 NM_005224 NM_005233 NM_005235 NM_005238 NM_005239 NM_005242 NM_005243 NM_005245 NM_005253 NM_005263 NM_005276 NM_005296 NM_005301 NM_005308 NM_005313 NM_005316 NM_005329 NM_005334 NM_005338 NM_005358 NM_005360 NM_005374 NM_005379 NM_005388 NM_005397 NM_005399 NM_005407 NM_005410 NM_005417 NM_005419 NM_005429 NM_005430 NM_005436 NM_005437 NM_005453 NM_005458 NM_005460 NM_005461 NM_005470 NM_005471 NM_005472 NM_005474 NM_005475 NM_005479 NM_005487 NM_005495 NM_005499 NM_005501 NM_005502 NM_005504 NM_005506 NM_005519 NM_005523 NM_005532 NM_005537 NM_005540 NM_005542 NM_005546 NM_005550 NM_005553 NM_005558 NM_005562 NM_005578 NM_005581 NM_005587 NM_005602 NM_005607 NM_005629 NM_005631 NM_005632 NM_005638 NM_005647 NM_005650 NM_005652 NM_005658 NM_005663 NM_005665 NM_005668 NM_005669 NM_005677 NM_005683 NM_005687 NM_005699 NM_005704 NM_005715 NM_005722 NM_005724 NM_005725 NM_005729 NM_005737 NM_005741 NM_005766 NM_005775 NM_005778 NM_005779 NM_005806 NM_005808 NM_005810 NM_005816 NM_005819 NM_005822 NM_005829 NM_005840 NM_005843 NM_005847 NM_005851 NM_005858 NM_005859 NM_005860 NM_005870 NM_005873 NM_005877 NM_005882 NM_005884 NM_005892 NM_005895 NM_005899 NM_005902 NM_005903 NM_005904 NM_005908 NM_005915 NM_005920 NM_005935 NM_005943 NM_005957 NM_005965 NM_005969 NM_005977 NM_005986 NM_005987 NM_005988 NM_005989 NM_005990 NM_005994 NM_005995 NM_005998 NM_006011 NM_006020 NM_006033 NM_006037 NM_006040 NM_006043 NM_006057 NM_006060 NM_006071 NM_006077 NM_006089 NM_006100 NM_006108 NM_006111 NM_006113 NM_006116 NM_006125 NM_006133 NM_006134 NM_006135 NM_006139 NM_006141 NM_006148 NM_006166 NM_006167 NM_006178 NM_006184 NM_006187 NM_006190 NM_006213 NM_006221 NM_006224 NM_006235 NM_006237 NM_006239 NM_006241 NM_006251 NM_006252 NM_006254 NM_006258 NM_006262 NM_006266 NM_006282 NM_006283 NM_006285 NM_006286 NM_006290 NM_006291 NM_006306 NM_006310 NM_006312 NM_006327 NM_006348 NM_006353 NM_006359 NM_006371 NM_006375 NM_006393 NM_006397 NM_006413 NM_006418 NM_006457 NM_006466 NM_006469 NM_006481 NM_006488 NM_006493 NM_006494 NM_006496 NM_006505 NM_006517 NM_006520 NM_006521 NM_006526 NM_006532 NM_006534 NM_006540 NM_006541 NM_006546 NM_006548 NM_006549 NM_006555 NM_006557 NM_006561 NM_006572 NM_006581 NM_006598 NM_006599 NM_006615 NM_006620 NM_006621 NM_006622 NM_006625 NM_006635 NM_006650 NM_006667 NM_006669 NM_006691 NM_006697 NM_006699 NM_006706 NM_006720 NM_006729 NM_006730 NM_006731 NM_006736 NM_006737 NM_006742 NM_006746 NM_006747 NM_006748 NM_006754 NM_006761 NM_006763 NM_006767 NM_006778 NM_006780 NM_006788 NM_006793 NM_006800 NM_006805 NM_006807 NM_006814 NM_006823 NM_006824 NM_006826 NM_006830 NM_006831 NM_006842 NM_006843 NM_006867 NM_006868 NM_006883 NM_006884 NM_006887 NM_006888 NM_006889 NM_006899 NM_006902 NM_006905 NM_006908 NM_006909 NM_006915 NM_006916 NM_006919 NM_006930 NM_006938 NM_006945 NM_006947 NM_006952 NM_006955 NM_006962 NM_006965 NM_006974 NM_006979 NM_006980 NM_006981 NM_006984 NM_006989 NM_006995 NM_007010 NM_007013 NM_007028 NM_007038 NM_007049 NM_007050 NM_007051 NM_007057 NM_007063 NM_007064 NM_007073 NM_007084 NM_007085 NM_007086 NM_007099 NM_007106 NM_007110 NM_007120 NM_007123 NM_007126 NM_007129 NM_007136 NM_007148 NM_007150 NM_007159 NM_007171 NM_007173 NM_007174 NM_007187 NM_007189 NM_007193 NM_007203 NM_007207 NM_007231 NM_007247 NM_007249 NM_007256 NM_007270 NM_007271 NM_007287 NM_007288 NM_007289 NM_007293 NM_007306 NM_007312 NM_007320 NM_007322 NM_007327 NM_007335 NM_007336 NM_007338 NM_007341 NM_007374 NM_007375 NM_012071 NM_012087 NM_012096 NM_012099 NM_012104 NM_012105 NM_012106 NM_012119 NM_012121 NM_012124 NM_012125 NM_012134 NM_012137 NM_012143 NM_012153 NM_012156 NM_012164 NM_012174 NM_012193 NM_012208 NM_012215 NM_012224 NM_012244 NM_012249 NM_012250 NM_012262 NM_012301 NM_012306 NM_012309 NM_012310 NM_012315 NM_012316 NM_012334 NM_012344 NM_012346 NM_012384 NM_012388 NM_012400 NM_012416 NM_012429 NM_012431 NM_012434 NM_012453 NM_012455 NM_012463 NM_012477 NM_012478 NM_012479 NM_012486 NM_013229 NM_013231 NM_013238 NM_013247 NM_013254 NM_013255 NM_013260 NM_013261 NM_013276 NM_013277 NM_013279 NM_013284 NM_013286 NM_013302 NM_013309 NM_013313 NM_013322 NM_013336 NM_013339 NM_013341 NM_013372 NM_013375 NM_013381 NM_013382 NM_013386 NM_013389 NM_013390 NM_013402 NM_013410 NM_013422 NM_013433 NM_013445 NM_013447 NM_013951 NM_013952 NM_013953 NM_013974 NM_013989 NM_013992 NM_013999 NM_014000 NM_014001 NM_014007 NM_014014 NM_014023 NM_014037 NM_014038 NM_014042 NM_014048 NM_014049 NM_014064 NM_014066 NM_014077 NM_014078 NM_014098 NM_014106 NM_014109 NM_014112 NM_014141 NM_014146 NM_014153 NM_014154 NM_014155 NM_014157 NM_014160 NM_014178 NM_014189 NM_014190 NM_014208 NM_014220 NM_014231 NM_014232 NM_014243 NM_014250 NM_014258 NM_014282 NM_014286 NM_014291 NM_014294 NM_014301 NM_014310 NM_014313 NM_014323 NM_014326 NM_014333 NM_014337 NM_014349 NM_014352 NM_014354 NM_014361 NM_014365 NM_014368 NM_014372 NM_014382 NM_014387 NM_014388 NM_014395 NM_014409 NM_014411 NM_014421 NM_014432 NM_014451 NM_014455 NM_014459 NM_014470 NM_014479 NM_014484 NM_014502 NM_014504 NM_014506 NM_014518 NM_014521 NM_014553 NM_014563 NM_014570 NM_014571 NM_014573 NM_014586 NM_014594 NM_014598 NM_014600 NM_014604 NM_014607 NM_014613 NM_014623 NM_014629 NM_014631 NM_014636 NM_014637 NM_014640 NM_014642 NM_014644 NM_014646 NM_014653 NM_014655 NM_014661 NM_014666 NM_014671 NM_014674 NM_014678 NM_014690 NM_014702 NM_014707 NM_014711 NM_014715 NM_014721 NM_014723 NM_014724 NM_014728 NM_014729 NM_014732 NM_014739 NM_014744 NM_014746 NM_014748 NM_014751 NM_014755 NM_014762 NM_014764 NM_014766 NM_014770 NM_014771 NM_014774 NM_014776 NM_014779 NM_014782 NM_014787 NM_014788 NM_014789 NM_014790 NM_014804 NM_014805 NM_014808 NM_014809 NM_014812 NM_014822 NM_014827 NM_014830 NM_014832 NM_014835 NM_014840 NM_014844 NM_014850 NM_014854 NM_014860 NM_014864 NM_014868 NM_014870 NM_014871 NM_014873 NM_014888 NM_014890 NM_014891 NM_014897 NM_014898 NM_014901 NM_014902 NM_014904 NM_014905 NM_014909 NM_014910 NM_014913 NM_014918 NM_014919 NM_014920 NM_014922 NM_014924 NM_014932 NM_014934 NM_014935 NM_014936 NM_014937 NM_014945 NM_014946 NM_014947 NM_014949 NM_014951 NM_014952 NM_014955 NM_014959 NM_014961 NM_014965 NM_014974 NM_014996 NM_014997 NM_015008 NM_015015 NM_015020 NM_015027 NM_015032 NM_015033 NM_015035 NM_015039 NM_015043 NM_015045 NM_015049 NM_015051 NM_015053 NM_015056 NM_015057 NM_015063 NM_015064 NM_015071 NM_015074 NM_015076 NM_015082 NM_015085 NM_015090 NM_015093 NM_015094 NM_015097 NM_015112 NM_015113 NM_015115 NM_015134 NM_015141 NM_015144 NM_015151 NM_015157 NM_015158 NM_015166 NM_015172 NM_015178 NM_015191 NM_015194 NM_015200 NM_015202 NM_015219 NM_015224 NM_015225 NM_015226 NM_015236 NM_015245 NM_015247 NM_015250 NM_015257 NM_015264 NM_015266 NM_015267 NM_015270 NM_015278 NM_015282 NM_015285 NM_015291 NM_015296 NM_015299 NM_015303 NM_015310 NM_015313 NM_015314 NM_015317 NM_015318 NM_015320 NM_015328 NM_015330 NM_015332 NM_015335 NM_015336 NM_015340 NM_015344 NM_015345 NM_015346 NM_015350 NM_015353 NM_015358 NM_015359 NM_015362 NM_015371 NM_015374 NM_015378 NM_015383 NM_015393 NM_015396 NM_015398 NM_015401 NM_015407 NM_015409 NM_015411 NM_015416 NM_015419 NM_015428 NM_015433 NM_015446 NM_015455 NM_015457 NM_015483 NM_015490 NM_015506 NM_015509 NM_015511 NM_015530 NM_015545 NM_015550 NM_015553 NM_015554 NM_015564 NM_015567 NM_015569 NM_015570 NM_015596 NM_015601 NM_015609 NM_015627 NM_015635 NM_015651 NM_015652 NM_015660 NM_015675 NM_015678 NM_015683 NM_015691 NM_015695 NM_015698 NM_015713 NM_015715 NM_015723 NM_015726 NM_015831 NM_015840 NM_015841 NM_015865 NM_015885 NM_015886 NM_015892 NM_015898 NM_015910 NM_015935 NM_015937 NM_015941 NM_015978 NM_015980 NM_015982 NM_015983 NM_015987 NM_015995 NM_016008 NM_016016 NM_016018 NM_016022 NM_016025 NM_016028 NM_016034 NM_016035 NM_016039 NM_016046 NM_016059 NM_016065 NM_016073 NM_016076 NM_016081 NM_016100 NM_016101 NM_016107 NM_016111 NM_016121 NM_016123 NM_016124 NM_016132 NM_016138 NM_016143 NM_016169 NM_016175 NM_016202 NM_016206 NM_016217 NM_016225 NM_016226 NM_016231 NM_016233 NM_016234 NM_016235 NM_016245 NM_016252 NM_016255 NM_016256 NM_016257 NM_016261 NM_016263 NM_016275 NM_016282 NM_016283 NM_016284 NM_016297 NM_016302 NM_016303 NM_016320 NM_016322 NM_016331 NM_016334 NM_016339 NM_016340 NM_016352 NM_016388 NM_016389 NM_016395 NM_016418 NM_016424 NM_016426 NM_016441 NM_016445 NM_016448 NM_016452 NM_016454 NM_016463 NM_016499 NM_016505 NM_016513 NM_016525 NM_016531 NM_016532 NM_016540 NM_016546 NM_016547 NM_016553 NM_016557 NM_016562 NM_016575 NM_016577 NM_016580 NM_016589 NM_016590 NM_016592 NM_016596 NM_016604 NM_016605 NM_016607 NM_016608 NM_016611 NM_016620 NM_016622 NM_016628 NM_016641 NM_016643 NM_016735 NM_016821 NM_016823 NM_016826 NM_016827 NM_016828 NM_016829 NM_016830 NM_016932 NM_016936 NM_016940 NM_016953 NM_017414 NM_017431 NM_017438 NM_017449 NM_017452 NM_017453 NM_017454 NM_017456 NM_017460 NM_017483 NM_017485 NM_017486 NM_017488 NM_017515 NM_017523 NM_017540 NM_017546 NM_017548 NM_017551 NM_017554 NM_017556 NM_017563 NM_017577 NM_017583 NM_017590 NM_017599 NM_017602 NM_017617 NM_017623 NM_017626 NM_017628 NM_017629 NM_017636 NM_017640 NM_017645 NM_017646 NM_017656 NM_017666 NM_017671 NM_017682 NM_017686 NM_017711 NM_017713 NM_017717 NM_017719 NM_017721 NM_017723 NM_017724 NM_017725 NM_017736 NM_017738 NM_017744 NM_017747 NM_017748 NM_017752 NM_017753 NM_017762 NM_017763 NM_017765 NM_017770 NM_017772 NM_017773 NM_017775 NM_017777 NM_017779 NM_017785 NM_017787 NM_017798 NM_017799 NM_017803 NM_017805 NM_017811 NM_017822 NM_017823 NM_017824 NM_017828 NM_017832 NM_017847 NM_017849 NM_017851 NM_017857 NM_017870 NM_017887 NM_017891 NM_017894 NM_017896 NM_017902 NM_017924 NM_017925 NM_017926 NM_017927 NM_017929 NM_017936 NM_017949 NM_017952 NM_017972 NM_017982 NM_017990 NM_017991 NM_017994 NM_017998 NM_018003 NM_018010 NM_018017 NM_018023 NM_018027 NM_018036 NM_018045 NM_018046 NM_018050 NM_018054 NM_018057 NM_018058 NM_018061 NM_018074 NM_018119 NM_018120 NM_018121 NM_018129 NM_018130 NM_018141 NM_018150 NM_018154 NM_018156 NM_018157 NM_018158 NM_018169 NM_018170 NM_018171 NM_018172 NM_018184 NM_018185 NM_018189 NM_018190 NM_018198 NM_018199 NM_018200 NM_018201 NM_018208 NM_018212 NM_018214 NM_018222 NM_018224 NM_018228 NM_018234 NM_018238 NM_018240 NM_018242 NM_018243 NM_018244 NM_018246 NM_018247 NM_018256 NM_018257 NM_018263 NM_018272 NM_018273 NM_018276 NM_018280 NM_018281 NM_018286 NM_018293 NM_018308 NM_018310 NM_018314 NM_018325 NM_018327 NM_018330 NM_018332 NM_018347 NM_018352 NM_018361 NM_018364 NM_018371 NM_018375 NM_018379 NM_018385 NM_018389 NM_018392 NM_018398 NM_018414 NM_018423 NM_018424 NM_018440 NM_018449 NM_018450 NM_018452 NM_018466 NM_018476 NM_018482 NM_018487 NM_018498 NM_018518 NM_018566 NM_018579 NM_018590 NM_018593 NM_018602 NM_018660 NM_018662 NM_018663 NM_018667 NM_018672 NM_018684 NM_018689 NM_018695 NM_018702 NM_018706 NM_018713 NM_018715 NM_018717 NM_018719 NM_018724 NM_018727 NM_018834 NM_018836 NM_018839 NM_018845 NM_018847 NM_018890 NM_018894 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018912 NM_018913 NM_018914 NM_018915 NM_018916 NM_018917 NM_018918 NM_018919 NM_018920 NM_018921 NM_018922 NM_018923 NM_018924 NM_018925 NM_018926 NM_018927 NM_018928 NM_018929 NM_018944 NM_018947 NM_018963 NM_018969 NM_018970 NM_018976 NM_018982 NM_018984 NM_018990 NM_018993 NM_019001 NM_019008 NM_019018 NM_019046 NM_019054 NM_019055 NM_019067 NM_019069 NM_019072 NM_019075 NM_019076 NM_019077 NM_019078 NM_019084 NM_019085 NM_019089 NM_019092 NM_019093 NM_019094 NM_019096 NM_019106 NM_019109 NM_019557 NM_019591 NM_019594 NM_019624 NM_019625 NM_019644 NM_019855 NM_019857 NM_019862 NM_019884 NM_019885 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020039 NM_020116 NM_020117 NM_020119 NM_020125 NM_020131 NM_020133 NM_020148 NM_020149 NM_020150 NM_020162 NM_020163 NM_020168 NM_020177 NM_020181 NM_020182 NM_020188 NM_020194 NM_020198 NM_020199 NM_020204 NM_020208 NM_020215 NM_020228 NM_020237 NM_020239 NM_020248 NM_020315 NM_020323 NM_020324 NM_020325 NM_020326 NM_020337 NM_020338 NM_020341 NM_020342 NM_020350 NM_020375 NM_020377 NM_020381 NM_020384 NM_020388 NM_020398 NM_020399 NM_020400 NM_020405 NM_020410 NM_020429 NM_020431 NM_020432 NM_020438 NM_020443 NM_020447 NM_020448 NM_020452 NM_020453 NM_020456 NM_020457 NM_020462 NM_020474 NM_020475 NM_020476 NM_020477 NM_020478 NM_020479 NM_020480 NM_020481 NM_020530 NM_020638 NM_020645 NM_020655 NM_020657 NM_020663 NM_020664 NM_020673 NM_020686 NM_020689 NM_020698 NM_020699 NM_020702 NM_020708 NM_020714 NM_020715 NM_020717 NM_020724 NM_020727 NM_020728 NM_020745 NM_020746 NM_020766 NM_020769 NM_020770 NM_020772 NM_020776 NM_020777 NM_020779 NM_020782 NM_020783 NM_020791 NM_020792 NM_020796 NM_020802 NM_020803 NM_020804 NM_020806 NM_020807 NM_020808 NM_020809 NM_020812 NM_020813 NM_020826 NM_020828 NM_020834 NM_020839 NM_020841 NM_020844 NM_020851 NM_020858 NM_020867 NM_020868 NM_020886 NM_020889 NM_020896 NM_020899 NM_020909 NM_020914 NM_020917 NM_020919 NM_020921 NM_020927 NM_020940 NM_020947 NM_020956 NM_020963 NM_020983 NM_021005 NM_021020 NM_021027 NM_021030 NM_021032 NM_021033 NM_021036 NM_021045 NM_021061 NM_021079 NM_021088 NM_021090 NM_021096 NM_021100 NM_021116 NM_021128 NM_021132 NM_021133 NM_021135 NM_021141 NM_021146 NM_021164 NM_021165 NM_021167 NM_021168 NM_021188 NM_021198 NM_021202 NM_021205 NM_021222 NM_021225 NM_021239 NM_021242 NM_021258 NM_021569 NM_021612 NM_021616 NM_021629 NM_021635 NM_021642 NM_021649 NM_021735 NM_021736 NM_021737 NM_021784 NM_021795 NM_021810 NM_021812 NM_021813 NM_021814 NM_021815 NM_021825 NM_021905 NM_021925 NM_021939 NM_021957 NM_021961 NM_021962 NM_021972 NM_021976 NM_021977 NM_021988 NM_022002 NM_022040 NM_022049 NM_022050 NM_022052 NM_022062 NM_022063 NM_022067 NM_022071 NM_022074 NM_022079 NM_022081 NM_022087 NM_022100 NM_022102 NM_022103 NM_022113 NM_022114 NM_022121 NM_022126 NM_022130 NM_022131 NM_022133 NM_022138 NM_022145 NM_022151 NM_022153 NM_022166 NM_022167 NM_022169 NM_022170 NM_022171 NM_022343 NM_022346 NM_022354 NM_022369 NM_022405 NM_022442 NM_022444 NM_022451 NM_022455 NM_022461 NM_022465 NM_022468 NM_022473 NM_022477 NM_022481 NM_022482 NM_022491 NM_022493 NM_022497 NM_022652 NM_022663 NM_022716 NM_022718 NM_022720 NM_022733 NM_022754 NM_022755 NM_022756 NM_022758 NM_022759 NM_022770 NM_022817 NM_022818 NM_022826 NM_022831 NM_022840 NM_022844 NM_022894 NM_022971 NM_022977 NM_023007 NM_023016 NM_023028 NM_023037 NM_023073 NM_023079 NM_023080 NM_023107 NM_023108 NM_023112 NM_023914 NM_023923 NM_023936 NM_023947 NM_024022 NM_024025 NM_024033 NM_024048 NM_024050 NM_024052 NM_024056 NM_024071 NM_024080 NM_024086 NM_024099 NM_024103 NM_024109 NM_024116 NM_024294 NM_024298 NM_024300 NM_024309 NM_024328 NM_024336 NM_024344 NM_024408 NM_024411 NM_024430 NM_024490 NM_024504 NM_024512 NM_024513 NM_024525 NM_024526 NM_024539 NM_024541 NM_024551 NM_024557 NM_024575 NM_024580 NM_024583 NM_024588 NM_024594 NM_024607 NM_024610 NM_024611 NM_024613 NM_024616 NM_024620 NM_024623 NM_024624 NM_024627 NM_024640 NM_024644 NM_024646 NM_024648 NM_024656 NM_024665 NM_024666 NM_024670 NM_024671 NM_024674 NM_024678 NM_024683 NM_024689 NM_024692 NM_024702 NM_024704 NM_024705 NM_024707 NM_024709 NM_024711 NM_024713 NM_024726 NM_024730 NM_024749 NM_024768 NM_024772 NM_024785 NM_024786 NM_024787 NM_024789 NM_024808 NM_024816 NM_024833 NM_024834 NM_024836 NM_024845 NM_024854 NM_024863 NM_024864 NM_024866 NM_024871 NM_024874 NM_024877 NM_024887 NM_024889 NM_024891 NM_024907 NM_024910 NM_024913 NM_024915 NM_024921 NM_024923 NM_024926 NM_024935 NM_024939 NM_024943 NM_024949 NM_024954 NM_024955 NM_024974 NM_024986 NM_025042 NM_025057 NM_025063 NM_025073 NM_025074 NM_025083 NM_025084 NM_025099 NM_025128 NM_025160 NM_025191 NM_025195 NM_025198 NM_025208 NM_025218 NM_025219 NM_025220 NM_025222 NM_025236 NM_025243 NM_025250 NM_030569 NM_030572 NM_030576 NM_030627 NM_030630 NM_030634 NM_030637 NM_030640 NM_030641 NM_030643 NM_030644 NM_030645 NM_030759 NM_030774 NM_030781 NM_030783 NM_030795 NM_030798 NM_030805 NM_030806 NM_030815 NM_030816 NM_030821 NM_030882 NM_030884 NM_030885 NM_030899 NM_030918 NM_030919 NM_030925 NM_030926 NM_030927 NM_030935 NM_030940 NM_030944 NM_030948 NM_030953 NM_030964 NM_031205 NM_031215 NM_031216 NM_031226 NM_031265 NM_031268 NM_031281 NM_031293 NM_031301 NM_031305 NM_031307 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031407 NM_031411 NM_031417 NM_031418 NM_031419 NM_031426 NM_031427 NM_031431 NM_031435 NM_031442 NM_031444 NM_031453 NM_031455 NM_031462 NM_031468 NM_031469 NM_031473 NM_031480 NM_031484 NM_031488 NM_031490 NM_031849 NM_031857 NM_031858 NM_031860 NM_031862 NM_031886 NM_031900 NM_031910 NM_031911 NM_031912 NM_031920 NM_031935 NM_031952 NM_031961 NM_031962 NM_031992 NM_032013 NM_032017 NM_032023 NM_032039 NM_032041 NM_032045 NM_032050 NM_032051 NM_032052 NM_032088 NM_032092 NM_032105 NM_032108 NM_032111 NM_032112 NM_032124 NM_032128 NM_032139 NM_032144 NM_032175 NM_032186 NM_032193 NM_032208 NM_032221 NM_032222 NM_032227 NM_032262 NM_032264 NM_032268 NM_032271 NM_032287 NM_032289 NM_032291 NM_032293 NM_032300 NM_032314 NM_032328 NM_032329 NM_032331 NM_032367 NM_032372 NM_032373 NM_032374 NM_032389 NM_032401 NM_032403 NM_032404 NM_032413 NM_032421 NM_032423 NM_032436 NM_032439 NM_032446 NM_032454 NM_032463 NM_032464 NM_032486 NM_032487 NM_032501 NM_032505 NM_032508 NM_032509 NM_032511 NM_032538 NM_032539 NM_032561 NM_032564 NM_032565 NM_032578 NM_032583 NM_032584 NM_032588 NM_032608 NM_032625 NM_032639 NM_032646 NM_032664 NM_032682 NM_032709 NM_032711 NM_032714 NM_032718 NM_032735 NM_032738 NM_032744 NM_032777 NM_032800 NM_032801 NM_032814 NM_032817 NM_032818 NM_032826 NM_032828 NM_032840 NM_032842 NM_032859 NM_032864 NM_032865 NM_032876 NM_032892 NM_032895 NM_032900 NM_032910 NM_032920 NM_032932 NM_032947 NM_032966 NM_032968 NM_032969 NM_032973 NM_032975 NM_032978 NM_032979 NM_032980 NM_032981 NM_032983 NM_032984 NM_032988 NM_032991 NM_032995 NM_032997 NM_033004 NM_033006 NM_033007 NM_033013 NM_033027 NM_033030 NM_033036 NM_033045 NM_033046 NM_033048 NM_033049 NM_033055 NM_033083 NM_033086 NM_033100 NM_033102 NM_033106 NM_033107 NM_033115 NM_033119 NM_033121 NM_033135 NM_033136 NM_033137 NM_033138 NM_033139 NM_033140 NM_033143 NM_033151 NM_033157 NM_033159 NM_033170 NM_033171 NM_033172 NM_033173 NM_033182 NM_033191 NM_033207 NM_033210 NM_033212 NM_033221 NM_033224 NM_033229 NM_033238 NM_033239 NM_033240 NM_033242 NM_033244 NM_033245 NM_033247 NM_033250 NM_033262 NM_033267 NM_033274 NM_033309 NM_033331 NM_033338 NM_033339 NM_033340 NM_033387 NM_033389 NM_033393 NM_033397 NM_033405 NM_033407 NM_033410 NM_033414 NM_033425 NM_033426 NM_033428 NM_033429 NM_033450 NM_033453 NM_033495 NM_033496 NM_033497 NM_033498 NM_033500 NM_033503 NM_033515 NM_033516 NM_033540 NM_033542 NM_033543 NM_033550 NM_033631 NM_033633 NM_033634 NM_033635 NM_033636 NM_033640 NM_052816 NM_052820 NM_052827 NM_052828 NM_052834 NM_052840 NM_052861 NM_052864 NM_052869 NM_052876 NM_052880 NM_052889 NM_052901 NM_052903 NM_052910 NM_052913 NM_052917 NM_052918 NM_052919 NM_052926 NM_052934 NM_052936 NM_052938 NM_052953 NM_052954 NM_052972 NM_052988 NM_052996 NM_053025 NM_053026 NM_053027 NM_053028 NM_053029 NM_053030 NM_053031 NM_053032 NM_053056 NM_053064 NM_053277 NM_053279 NM_053286 NM_054026 NM_054027 NM_057158 NM_057159 NM_057169 NM_057170 NM_057175 NM_057177 NM_057178 NM_057180 NM_058166 NM_058180 NM_058195 NM_058197 NM_058240 NM_078469 NM_078470 NM_078476 NM_078483 NM_078485 NM_078629 NM_078630 NM_080283 NM_080422 NM_080423 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080550 NM_080588 NM_080589 NM_080605 NM_080612 NM_080617 NM_080627 NM_080645 NM_080650 NM_080652 NM_080653 NM_080671 NM_080704 NM_080705 NM_080706 NM_080725 NM_080738 NM_080744 NM_080759 NM_080760 NM_080792 NM_080818 NM_080822 NM_080829 NM_080863 NM_080865 NM_080872 NM_080879 NM_080911 NM_080921 NM_080922 NM_100264 NM_100486 NM_101395 NM_130389 NM_130436 NM_130437 NM_130438 NM_130440 NM_130446 NM_130466 NM_130760 NM_130761 NM_130762 NM_130766 NM_130768 NM_130778 NM_130783 NM_130807 NM_130830 NM_130842 NM_130843 NM_130847 NM_130853 NM_130854 NM_130855 NM_131917 NM_133170 NM_133177 NM_133178 NM_133181 NM_133326 NM_133332 NM_133333 NM_133334 NM_133367 NM_133372 NM_133448 NM_133451 NM_133459 NM_133477 NM_133490 NM_133496 NM_133509 NM_133631 NM_133632 NM_133633 NM_134325 NM_134422 NM_134423 NM_134424 NM_134433 NM_134440 NM_138270 NM_138271 NM_138278 NM_138288 NM_138298 NM_138300 NM_138338 NM_138340 NM_138348 NM_138357 NM_138373 NM_138395 NM_138399 NM_138402 NM_138410 NM_138415 NM_138426 NM_138428 NM_138433 NM_138434 NM_138450 NM_138457 NM_138459 NM_138468 NM_138492 NM_138499 NM_138567 NM_138569 NM_138573 NM_138574 NM_138578 NM_138609 NM_138610 NM_138619 NM_138635 NM_138693 NM_138713 NM_138714 NM_138726 NM_138727 NM_138728 NM_138735 NM_138764 NM_138795 NM_138805 NM_138819 NM_138931 NM_138958 NM_138967 NM_138970 NM_138971 NM_138972 NM_138973 NM_138991 NM_138992 NM_138995 NM_139015 NM_139016 NM_139053 NM_139068 NM_139069 NM_139070 NM_139071 NM_139075 NM_139076 NM_139132 NM_139156 NM_139159 NM_139161 NM_139168 NM_139169 NM_139177 NM_139202 NM_139207 NM_139264 NM_139265 NM_139283 NM_139321 NM_139323 NM_144494 NM_144498 NM_144567 NM_144568 NM_144579 NM_144582 NM_144595 NM_144604 NM_144607 NM_144621 NM_144623 NM_144633 NM_144635 NM_144649 NM_144670 NM_144684 NM_144690 NM_144701 NM_144703 NM_144711 NM_144716 NM_144728 NM_144729 NM_144734 NM_144782 NM_144968 NM_144974 NM_145012 NM_145033 NM_145034 NM_145035 NM_145048 NM_145053 NM_145055 NM_145061 NM_145071 NM_145074 NM_145112 NM_145113 NM_145117 NM_145165 NM_145176 NM_145179 NM_145186 NM_145187 NM_145188 NM_145189 NM_145190 NM_145204 NM_145206 NM_145233 NM_145241 NM_145244 NM_145248 NM_145255 NM_145259 NM_145263 NM_145273 NM_145296 NM_145307 NM_145308 NM_145311 NM_145314 NM_145316 NM_145320 NM_145321 NM_145322 NM_145323 NM_145324 NM_145342 NM_145343 NM_145344 NM_145637 NM_145638 NM_145639 NM_145640 NM_145641 NM_145642 NM_145654 NM_145660 NM_145731 NM_145735 NM_145738 NM_145800 NM_145802 NM_145803 NM_145808 NM_145818 NM_145858 NM_145861 NM_145865 NM_145906 NM_145909 NM_147131 NM_147132 NM_147134 NM_147147 NM_147166 NM_147180 NM_147189 NM_147190 NM_147196 NM_147223 NM_147233 NM_147780 NM_147781 NM_147782 NM_147783 NM_148169 NM_148170 NM_148171 NM_148571 NM_148887 NM_148894 NM_148957 NM_148960 NM_148976 NM_152253 NM_152270 NM_152272 NM_152275 NM_152280 NM_152281 NM_152282 NM_152286 NM_152291 NM_152300 NM_152305 NM_152306 NM_152309 NM_152315 NM_152322 NM_152327 NM_152330 NM_152332 NM_152336 NM_152343 NM_152352 NM_152355 NM_152356 NM_152373 NM_152374 NM_152379 NM_152380 NM_152391 NM_152393 NM_152395 NM_152399 NM_152403 NM_152405 NM_152411 NM_152412 NM_152416 NM_152417 NM_152422 NM_152423 NM_152433 NM_152439 NM_152451 NM_152460 NM_152466 NM_152470 NM_152480 NM_152488 NM_152490 NM_152492 NM_152493 NM_152496 NM_152510 NM_152515 NM_152519 NM_152525 NM_152529 NM_152538 NM_152540 NM_152552 NM_152553 NM_152557 NM_152558 NM_152559 NM_152563 NM_152568 NM_152581 NM_152583 NM_152607 NM_152608 NM_152609 NM_152610 NM_152619 NM_152624 NM_152628 NM_152638 NM_152649 NM_152653 NM_152655 NM_152663 NM_152675 NM_152677 NM_152685 NM_152686 NM_152695 NM_152701 NM_152704 NM_152705 NM_152717 NM_152734 NM_152740 NM_152743 NM_152754 NM_152760 NM_152763 NM_152765 NM_152774 NM_152776 NM_152789 NM_152796 NM_152834 NM_152836 NM_152837 NM_152840 NM_152841 NM_152842 NM_152857 NM_152858 NM_152871 NM_152872 NM_152873 NM_152874 NM_152875 NM_152876 NM_152877 NM_152902 NM_152908 NM_152913 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152933 NM_152934 NM_152943 NM_152999 NM_153005 NM_153010 NM_153013 NM_153020 NM_153028 NM_153032 NM_153035 NM_153041 NM_153050 NM_153051 NM_153186 NM_153202 NM_153206 NM_153218 NM_153226 NM_153238 NM_153253 NM_153254 NM_153263 NM_153264 NM_153265 NM_153276 NM_153277 NM_153278 NM_153279 NM_153281 NM_153282 NM_153283 NM_153284 NM_153285 NM_153286 NM_153331 NM_153335 NM_153338 NM_153342 NM_153347 NM_153348 NM_153360 NM_153371 NM_153374 NM_153377 NM_153442 NM_153451 NM_153456 NM_153462 NM_153463 NM_153478 NM_153479 NM_153487 NM_153499 NM_153500 NM_153607 NM_153613 NM_153615 NM_153616 NM_153617 NM_153618 NM_153619 NM_153634 NM_153646 NM_153647 NM_153648 NM_153649 NM_153675 NM_153676 NM_153683 NM_153687 NM_153709 NM_153711 NM_153712 NM_153718 NM_153719 NM_153747 NM_153756 NM_153757 NM_153764 NM_153765 NM_153766 NM_153767 NM_153823 NM_153831 NM_153836 NM_170587 NM_170674 NM_170675 NM_170676 NM_170677 NM_170696 NM_170697 NM_170706 NM_170711 NM_170731 NM_170732 NM_170733 NM_170734 NM_170735 NM_170740 NM_170743 NM_170744 NM_170769 NM_170770 NM_170776 NM_171827 NM_171998 NM_172020 NM_172070 NM_172101 NM_172102 NM_172159 NM_172160 NM_172174 NM_172175 NM_172213 NM_172216 NM_172217 NM_172218 NM_172226 NM_172232 NM_172234 NM_172239 NM_172241 NM_172315 NM_172316 NM_172346 NM_172349 NM_172375 NM_172386 NM_173042 NM_173043 NM_173054 NM_173055 NM_173056 NM_173057 NM_173058 NM_173064 NM_173065 NM_173082 NM_173087 NM_173088 NM_173089 NM_173090 NM_173174 NM_173175 NM_173176 NM_173198 NM_173200 NM_173214 NM_173459 NM_173463 NM_173468 NM_173469 NM_173470 NM_173473 NM_173475 NM_173476 NM_173478 NM_173481 NM_173492 NM_173497 NM_173505 NM_173508 NM_173509 NM_173510 NM_173511 NM_173519 NM_173522 NM_173524 NM_173528 NM_173536 NM_173537 NM_173542 NM_173545 NM_173549 NM_173551 NM_173562 NM_173564 NM_173566 NM_173573 NM_173579 NM_173580 NM_173582 NM_173588 NM_173599 NM_173602 NM_173607 NM_173610 NM_173622 NM_173627 NM_173629 NM_173638 NM_173644 NM_173648 NM_173649 NM_173650 NM_173661 NM_173664 NM_173669 NM_173683 NM_173687 NM_173688 NM_173689 NM_173698 NM_173699 NM_173700 NM_173728 NM_173793 NM_173800 NM_173805 NM_173807 NM_173808 NM_173809 NM_173812 NM_173827 NM_173847 NM_173851 NM_174855 NM_174856 NM_174882 NM_174892 NM_174902 NM_174905 NM_174911 NM_174917 NM_174921 NM_174925 NM_174926 NM_174936 NM_174939 NM_174950 NM_175058 NM_175060 NM_175064 NM_175566 NM_175567 NM_175569 NM_175610 NM_175726 NM_175733 NM_175747 NM_175767 NM_175854 NM_175859 NM_175861 NM_175862 NM_175864 NM_175872 NM_175876 NM_175902 NM_175907 NM_175908 NM_175913 NM_175921 NM_175923 NM_175931 NM_176084 NM_176085 NM_176086 NM_176792 NM_176801 NM_176814 NM_176815 NM_176823 NM_176894 NM_176895 NM_177414 NM_177427 NM_177532 NM_177551 NM_177554 NM_177924 NM_177947 NM_177948 NM_177949 NM_177963 NM_177965 NM_177972 NM_177977 NM_177978 NM_177979 NM_177980 NM_177986 NM_177990 NM_177995 NM_177996 NM_178012 NM_178014 NM_178031 NM_178037 NM_178038 NM_178039 NM_178040 NM_178130 NM_178145 NM_178151 NM_178152 NM_178153 NM_178170 NM_178270 NM_178271 NM_178432 NM_178445 NM_178448 NM_178466 NM_178470 NM_178491 NM_178500 NM_178505 NM_178509 NM_178514 NM_178563 NM_178564 NM_178565 NM_178568 NM_178578 NM_178579 NM_178816 NM_178820 NM_178831 NM_178833 NM_178835 NM_178839 NM_178842 NM_181041 NM_181311 NM_181312 NM_181313 NM_181314 NM_181349 NM_181355 NM_181358 NM_181359 NM_181430 NM_181431 NM_181457 NM_181458 NM_181459 NM_181460 NM_181472 NM_181481 NM_181482 NM_181483 NM_181484 NM_181489 NM_181492 NM_181493 NM_181502 NM_181504 NM_181523 NM_181524 NM_181527 NM_181528 NM_181531 NM_181533 NM_181571 NM_181642 NM_181654 NM_181659 NM_181672 NM_181673 NM_181711 NM_181714 NM_181723 NM_181733 NM_181740 NM_181774 NM_181785 NM_181789 NM_181814 NM_181826 NM_181827 NM_181828 NM_181829 NM_181830 NM_181832 NM_181833 NM_181834 NM_181835 NM_181839 NM_181844 NM_181846 NM_181861 NM_181868 NM_181869 NM_181874 NM_182314 NM_182483 NM_182487 NM_182490 NM_182494 NM_182497 NM_182499 NM_182501 NM_182503 NM_182511 NM_182513 NM_182516 NM_182518 NM_182519 NM_182526 NM_182533 NM_182534 NM_182540 NM_182551 NM_182554 NM_182560 NM_182562 NM_182568 NM_182584 NM_182585 NM_182596 NM_182597 NM_182605 NM_182609 NM_182613 NM_182621 NM_182637 NM_182638 NM_182644 NM_182685 NM_182688 NM_182691 NM_182692 NM_182697 NM_182715 NM_182717 NM_182718 NM_182719 NM_182720 NM_182721 NM_182722 NM_182723 NM_182724 NM_182725 NM_182728 NM_182734 NM_182740 NM_182751 NM_182769 NM_182770 NM_182771 NM_182772 NM_182798 NM_182799 NM_182801 NM_182812 NM_182827 NM_182831 NM_182832 NM_182833 NM_182848 NM_182850 NM_182853 NM_182898 NM_182899 NM_182909 NM_182915 NM_182920 NM_182923 NM_182932 NM_182933 NM_182936 NM_182960 NM_182962 NM_182964 NM_182965 NM_182966 NM_182975 NM_183002 NM_183006 NM_183010 NM_183011 NM_183012 NM_183013 NM_183043 NM_183044 NM_183050 NM_183060 NM_183075 NM_183239 NM_183243 NM_183372 NM_183376 NM_183412 NM_183413 NM_183414 NM_183415 NM_184042 NM_184234 NM_184237 NM_184241 NM_184244 NM_194071 NM_194278 NM_194283 NM_194286 NM_194287 NM_194295 NM_194299 NM_194310 NM_194314 NM_194317 NM_194324 NM_194327 NM_194352 NM_194454 NM_194455 NM_194456 NM_194463 NM_197951 NM_197952 NM_197953 NM_197955 NM_197966 NM_197967 NM_197970 NM_198056 NM_198081 NM_198086 NM_198087 NM_198088 NM_198138 NM_198149 NM_198154 NM_198195 NM_198196 NM_198197 NM_198217 NM_198218 NM_198219 NM_198220 NM_198256 NM_198257 NM_198258 NM_198268 NM_198269 NM_198270 NM_198274 NM_198275 NM_198281 NM_198291 NM_198321 NM_198324 NM_198325 NM_198327 NM_198328 NM_198330 NM_198336 NM_198337 NM_198392 NM_198399 NM_198406 NM_198428 NM_198439 NM_198441 NM_198447 NM_198458 NM_198460 NM_198461 NM_198462 NM_198465 NM_198476 NM_198484 NM_198511 NM_198512 NM_198516 NM_198521 NM_198527 NM_198530 NM_198539 NM_198545 NM_198550 NM_198554 NM_198568 NM_198569 NM_198581 NM_198681 NM_198686 NM_198705 NM_198706 NM_198707 NM_198708 NM_198715 NM_198797 NM_198829 NM_198833 NM_198834 NM_198835 NM_198836 NM_198837 NM_198838 NM_198839 NM_198844 NM_198846 NM_198847 NM_198859 NM_198868 NM_198896 NM_198902 NM_198907 NM_198920 NM_198943 NM_198968 NM_198993 NM_199040 NM_199045 NM_199071 NM_199072 NM_199078 NM_199126 NM_199129 NM_199138 NM_199139 NM_199141 NM_199144 NM_199160 NM_199163 NM_199169 NM_199170 NM_199171 NM_199189 NM_199203 NM_199229 NM_199245 NM_199246 NM_199262 NM_199297 NM_199335 NM_199348 NM_199351 NM_199355 NM_199436 NM_199437 NM_199438 NM_199439 NM_199454 NM_199487 NM_199513 NM_201269 NM_201274 NM_201280 NM_201349 NM_201399 NM_201400 NM_201431 NM_201432 NM_201433 NM_201434 NM_201546 NM_201548 NM_201567 NM_201574 NM_201598 NM_201599 NM_201613 NM_203305 NM_203316 NM_203327 NM_203339 NM_203342 NM_203343 NM_203349 NM_203364 NM_203373 NM_203379 NM_203380 NM_203391 NM_203395 NM_203404 NM_203412 NM_203413 NM_203414 NM_203415 NM_203444 NM_203445 NM_203447 NM_203454 NM_203463 NM_203464 NM_203506 NM_205846 NM_205852 NM_205857 NM_205861 NM_205862 NM_206594 NM_206595 NM_206835 NM_206876 NM_206877 NM_206892 NM_206907 NM_206909 NM_206914 NM_206925 NM_206933 NM_207036 NM_207037 NM_207038 NM_207040 NM_207043 NM_207044 NM_207047 NM_207115 NM_207122 NM_207289 NM_207299 NM_207306 NM_207309 NM_207316 NM_207318 NM_207327 NM_207333 NM_207348 NM_207350 NM_207357 NM_207358 NM_207362 NM_207366 NM_207368 NM_207371 NM_207378 NM_207381 NM_207388 NM_207389 NM_207390 NM_207397 NM_207400 NM_207412 NM_207419 NM_207428 NM_207434 NM_207435 NM_207438 NM_207444 NM_207445 NM_207448 NM_207451 NM_207454 NM_207461 NM_207463 NM_207465 NM_207468 NM_207475 NM_207478 NM_207482 NM_207483 NM_207485 NM_207486 NM_207488 NM_207495 NM_207497 NM_207501 NM_207504 NM_207505 NM_207510 NM_207514 NM_207578 NM_207646 NM_212464 NM_212465 NM_212467 NM_212502 NM_212503 NM_212533 NM_212539 NM_212543 NM_212556 NM_212558 NM_213593 NM_213595 NM_213596 NM_213598 NM_213619 NM_213620 NM_213651 NM_213654 XM_027236 XM_027307 XM_028810 XM_032996 XM_036988 XM_037523 XM_038436 XM_039515 XM_039570 XM_039627 XM_039676 XM_042066 XM_042698 XM_042833 XM_042936 XM_043493 XM_046581 XM_047355 XM_048592 XM_048898 XM_049952 XM_056455 XM_057107 XM_058628 XM_059318 XM_059689 XM_059832 XM_059909 XM_065166 XM_067585 XM_084529 XM_087089 XM_087137 XM_087225 XM_087386 XM_087672 XM_095991 XM_096688 XM_097278 XM_097580 XM_097977 XM_114303 XM_116980 XM_117117 XM_117294 XM_117408 XM_166140 XM_166320 XM_166966 XM_167044 XM_167147 XM_167275 XM_170754 XM_171054 XM_171165 XM_171855 XM_172917 XM_173068 XM_173087 XM_208545 XM_208990 XM_209363 XM_209429 XM_209569 XM_209607 XM_209824 XM_210048 XM_211028 XM_211089 XM_212061 XM_290401 XM_290546 XM_290579 XM_290597 XM_290629 XM_290670 XM_290712 XM_291019 XM_291128 XM_293828 XM_294775 XM_295178 XM_350880 XM_370603 XM_370648 XM_370654 XM_370664 XM_370707 XM_370716 XM_370756 XM_370829 XM_370838 XM_370878 XM_370879 XM_370932 XM_370995 XM_371074 XM_371177 XM_371179 XM_371181 XM_371184 XM_371204 XM_371214 XM_371261 XM_371299 XM_371312 XM_371423 XM_371474 XM_371476 XM_371486 XM_371514 XM_371590 XM_371664 XM_371668 XM_371680 XM_371741 XM_371760 XM_371777 XM_371783 XM_371820 XM_371838 XM_371891 XM_371933 XM_371943 XM_371956 XM_372039 XM_372097 XM_372198 XM_372716 XM_373431 XM_373451 XM_373453 XM_373500 XM_373513 XM_373561 XM_373616 XM_373660 XM_373686 XM_373690 XM_373744 XM_373750 XM_373763 XM_373775 XM_373822 XM_373873 XM_373883 XM_373886 XM_373893 XM_373896 XM_373906 XM_373973 XM_374046 XM_374115 XM_374117 XM_374162 XM_374167 XM_374170 XM_374295 XM_374399 XM_374414 XM_374422 XM_374435 XM_374460 XM_374491 XM_374529 XM_374767 XM_374803 XM_374842 XM_374912 XM_374915 XM_374973 XM_375029 XM_375033 XM_375065 XM_375174 XM_375183 XM_375275 XM_375359 XM_375378 XM_375430 XM_375449 XM_375491 XM_375500 XM_375543 XM_375558 XM_375606 XM_375619 XM_375629 XM_375697 XM_375838 XM_375853 XM_375928 XM_376018 XM_376049 XM_376062 XM_376148 XM_376150 XM_376165 XM_376212 XM_376303 XM_376305 XM_376334 XM_376386 XM_376412 XM_376423 XM_376433 XM_376444 XM_376560 XM_376567 XM_376587 XM_376588 XM_376602 XM_376658 XM_376677 XM_376680 XM_376720 XM_376784 XM_376869 XM_376903 XM_376981 XM_377002 XM_377073 XM_377476 XM_377742 XM_377761 XM_378202 XM_378203 XM_378236 XM_378238 XM_378240 XM_378247 XM_378250 XM_378259 XM_378272 XM_378273 XM_378299 XM_378312 XM_378327 XM_378368 XM_378374 XM_378379 XM_378399 XM_378430 XM_378437 XM_378494 XM_378507 XM_378550 XM_378553 XM_378558 XM_378573 XM_378589 XM_378608 XM_378620 XM_378623 XM_378625 XM_378649 XM_378667 XM_378678 XM_378700 XM_378708 XM_378741 XM_378743 XM_378746 XM_378758 XM_378760 XM_378780 XM_378783 XM_378786 XM_378793 XM_378798 XM_378799 XM_378843 XM_378860 XM_378861 XM_378879 XM_378886 XM_378914 XM_378925 XM_378957 XM_378964 XM_378971 XM_378993 XM_379036 XM_379065 XM_379068 XM_379074 XM_379075 XM_379079 XM_379094 XM_379096 XM_379100 XM_379108 XM_379111 XM_379118 XM_379121 XM_379141 XM_379145 XM_379154 XM_379161 XM_379177 XM_379189 XM_379204 XM_379214 XM_379243 XM_379254 XM_379258 XM_379260 XM_379280 XM_379295 XM_379309 XM_379320 XM_379324 XM_379363 XM_379381 XM_379391 XM_379398 XM_379402 XM_379406 XM_379409 XM_379432 XM_379452 XM_379454 XM_379482 XM_379484 XM_379485 XM_379498 XM_379520 XM_379594 XM_379595 XM_379597 XM_379603 XM_379622 XM_379629 XM_379634 XM_379635 XM_379637 XM_379656 XM_379720 XM_379722 XM_379774 XM_379800 XM_379820 XM_379858 XM_379877 XM_379897 XM_379931 XM_379932 XM_379934 XM_379958 XM_379967 XM_380098 XM_380100 XM_380104 XM_380117 XM_380146 XM_495814 XM_495868 XM_495902 XM_495909 XM_495937 XM_495939 XM_495961 XM_495984 XM_496050 XM_496070 XM_496093 XM_496134 XM_496143 XM_496191 XM_496202 XM_496255 XM_496271 XM_496335 XM_496351 XM_496379 XM_496391 XM_496394 XM_496399 XM_496400 XM_496431 XM_496549 XM_496603 XM_496608 XM_496635 XM_496690 XM_496692 XM_496773 XM_496797 XM_496814 XM_496836 XM_496844 XM_496892 XM_496894 XM_496895 XM_496898 XM_496899 XM_496905 XM_496907 XM_496912 XM_496931 XM_496933 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_497029 XM_497036 XM_497039 XM_497089 XM_498427 XM_498436 XM_498437 XM_498446 XM_498449 XM_498451 XM_498464 XM_498465 XM_498467 XM_498473 XM_498481 XM_498507 XM_498534 XM_498540 XM_498555 XM_498558 XM_498561 XM_498563 XM_498567 XM_498578 XM_498614 XM_498618 XM_498647 XM_498655 XM_498658 XM_498662 XM_498681 XM_498683 XM_498724 XM_498744 XM_498746 XM_498753 XM_498823 XM_498824 XM_498825 XM_498828 XM_498829 XM_498841 XM_498850 XM_498859 XM_498864 XM_498878 XM_498882 XM_498886 XM_498901 XM_498907 XM_498924 XM_498946 XM_498972 XM_498976 XM_498992 XM_499008 XM_499013 XM_499028 XM_499046 XM_499047 XM_499058 XM_499063 XM_499072 XM_499076 XM_499084 XM_499093 XM_499117 XM_499123 XM_499125 XM_499136 XM_499137 XM_499142 XM_499147 XM_499153 XM_499174 XM_499176 XM_499314 XM_499317 XM_499321 XM_499323 XM_499328 XM_499330 XM_499333 XM_499338 XM_499343 XM_499354 XM_499356 XM_499366 XM_499385 XM_499392 XM_499501 XM_499506 XM_499512 XM_499525 XM_499539 XM_499566 XM_499579 XM_499581 XM_499591 XM_499594 XM_499595 XM_499597 XR_000190 XR_000192 XR_000195 XR_000216 XR_000227 XR_000261 XR_000266 XR_000268 XR_000272 XR_000274 XR_000292
Genes with multiple seed matches:
NM_000037 NM_000077 NM_000091 NM_000116 NM_000136 NM_000188 NM_000214 NM_000246 NM_000322 NM_000332 NM_000334 NM_000337 NM_000382 NM_000401 NM_000428 NM_000489 NM_000555 NM_000567 NM_000574 NM_000587 NM_000664 NM_000682 NM_000686 NM_000785 NM_000791 NM_000793 NM_000809 NM_000834 NM_000861 NM_000890 NM_000914 NM_001001188 NM_001001557 NM_001001669 NM_001001709 NM_001001928 NM_001001929 NM_001001930 NM_001001938 NM_001002257 NM_001002260 NM_001002762 NM_001003674 NM_001003675 NM_001003681 NM_001003698 NM_001003699 NM_001003712 NM_001004127 NM_001004349 NM_001004432 NM_001005353 NM_001005387 NM_001005388 NM_001005404 NM_001005409 NM_001005414 NM_001005473 NM_001005609 NM_001006600 NM_001006665 NM_001007023 NM_001007254 NM_001007546 NM_001008220 NM_001008409 NM_001008493 NM_001009610 NM_001009880 NM_001009883 NM_001010871 NM_001010888 NM_001010891 NM_001011667 NM_001011668 NM_001011669 NM_001011670 NM_001011671 NM_001011708 NM_001012642 NM_001012733 NM_001012734 NM_001012957 NM_001012993 NM_001013031 NM_001013404 NM_001013627 NM_001013675 NM_001013678 NM_001013710 NM_001013839 NM_001014797 NM_001014831 NM_001014832 NM_001014833 NM_001014834 NM_001014835 NM_001015051 NM_001017368 NM_001017395 NM_001017396 NM_001017440 NM_001018050 NM_001018051 NM_001018052 NM_001023563 NM_001023582 NM_001024593 NM_001024608 NM_001024630 NM_001024669 NM_001024670 NM_001025266 NM_001050 NM_001080 NM_001095 NM_001116 NM_001196 NM_001206 NM_001244 NM_001247 NM_001256 NM_001259 NM_001286 NM_001375 NM_001386 NM_001387 NM_001390 NM_001399 NM_001410 NM_001438 NM_001465 NM_001481 NM_001636 NM_001695 NM_001759 NM_001798 NM_001859 NM_001908 NM_001924 NM_001949 NM_001987 NM_001995 NM_002015 NM_002025 NM_002033 NM_002158 NM_002216 NM_002221 NM_002222 NM_002241 NM_002272 NM_002298 NM_002314 NM_002357 NM_002399 NM_002526 NM_002579 NM_002581 NM_002610 NM_002613 NM_002640 NM_002655 NM_002677 NM_002715 NM_002716 NM_002829 NM_002906 NM_002941 NM_002953 NM_002955 NM_002959 NM_002999 NM_003023 NM_003034 NM_003043 NM_003108 NM_003112 NM_003137 NM_003161 NM_003190 NM_003200 NM_003234 NM_003236 NM_003243 NM_003257 NM_003320 NM_003359 NM_003387 NM_003392 NM_003413 NM_003415 NM_003466 NM_003474 NM_003489 NM_003559 NM_003617 NM_003624 NM_003644 NM_003661 NM_003681 NM_003714 NM_003722 NM_003734 NM_003740 NM_003861 NM_003877 NM_003950 NM_003954 NM_004063 NM_004112 NM_004113 NM_004171 NM_004200 NM_004213 NM_004229 NM_004302 NM_004338 NM_004348 NM_004392 NM_004442 NM_004554 NM_004566 NM_004612 NM_004657 NM_004730 NM_004747 NM_004756 NM_004776 NM_004781 NM_004797 NM_004845 NM_004862 NM_004863 NM_004896 NM_004992 NM_004996 NM_005036 NM_005050 NM_005063 NM_005076 NM_005093 NM_005102 NM_005116 NM_005187 NM_005197 NM_005207 NM_005238 NM_005242 NM_005301 NM_005313 NM_005338 NM_005358 NM_005417 NM_005458 NM_005472 NM_005475 NM_005479 NM_005487 NM_005523 NM_005546 NM_005558 NM_005578 NM_005632 NM_005638 NM_005647 NM_005737 NM_005816 NM_005877 NM_005884 NM_005902 NM_005904 NM_005908 NM_005935 NM_005957 NM_006011 NM_006134 NM_006135 NM_006187 NM_006235 NM_006251 NM_006252 NM_006282 NM_006306 NM_006371 NM_006505 NM_006517 NM_006521 NM_006540 NM_006549 NM_006557 NM_006599 NM_006622 NM_006650 NM_006706 NM_006731 NM_006742 NM_006763 NM_006778 NM_006793 NM_006830 NM_006888 NM_006902 NM_006995 NM_007049 NM_007050 NM_007148 NM_007171 NM_007203 NM_007249 NM_007270 NM_007306 NM_007375 NM_012104 NM_012125 NM_012153 NM_012156 NM_012193 NM_012208 NM_012309 NM_012310 NM_012334 NM_012346 NM_012384 NM_012400 NM_012431 NM_012434 NM_013238 NM_013279 NM_013339 NM_013341 NM_013375 NM_013386 NM_013402 NM_013410 NM_013447 NM_013951 NM_013952 NM_013953 NM_013989 NM_013992 NM_014048 NM_014098 NM_014155 NM_014157 NM_014160 NM_014231 NM_014243 NM_014250 NM_014323 NM_014326 NM_014333 NM_014368 NM_014372 NM_014382 NM_014388 NM_014479 NM_014571 NM_014573 NM_014604 NM_014613 NM_014636 NM_014637 NM_014655 NM_014661 NM_014671 NM_014702 NM_014723 NM_014728 NM_014729 NM_014732 NM_014751 NM_014764 NM_014766 NM_014787 NM_014805 NM_014830 NM_014850 NM_014871 NM_014888 NM_014904 NM_014909 NM_014924 NM_014934 NM_014946 NM_014949 NM_014997 NM_015008 NM_015020 NM_015056 NM_015063 NM_015064 NM_015074 NM_015076 NM_015090 NM_015097 NM_015113 NM_015178 NM_015219 NM_015225 NM_015236 NM_015264 NM_015267 NM_015278 NM_015296 NM_015299 NM_015310 NM_015313 NM_015317 NM_015328 NM_015332 NM_015350 NM_015359 NM_015383 NM_015393 NM_015396 NM_015401 NM_015455 NM_015490 NM_015506 NM_015553 NM_015564 NM_015570 NM_015627 NM_015683 NM_015691 NM_015695 NM_015713 NM_016018 NM_016059 NM_016081 NM_016206 NM_016217 NM_016233 NM_016235 NM_016257 NM_016261 NM_016263 NM_016426 NM_016448 NM_016540 NM_016547 NM_016553 NM_016575 NM_016577 NM_016590 NM_016596 NM_016611 NM_016735 NM_017546 NM_017577 NM_017583 NM_017599 NM_017666 NM_017721 NM_017736 NM_017748 NM_017762 NM_017787 NM_017811 NM_017832 NM_017847 NM_017891 NM_017896 NM_018023 NM_018198 NM_018208 NM_018212 NM_018273 NM_018327 NM_018352 NM_018389 NM_018440 NM_018482 NM_018498 NM_018662 NM_018667 NM_018689 NM_018695 NM_018847 NM_018898 NM_018899 NM_018900 NM_018901 NM_018902 NM_018903 NM_018904 NM_018905 NM_018906 NM_018907 NM_018908 NM_018909 NM_018910 NM_018911 NM_018947 NM_018984 NM_019001 NM_019008 NM_019046 NM_019067 NM_019089 NM_019857 NM_019862 NM_019885 NM_019898 NM_019899 NM_019900 NM_019901 NM_019902 NM_020039 NM_020119 NM_020133 NM_020149 NM_020162 NM_020177 NM_020198 NM_020239 NM_020323 NM_020324 NM_020325 NM_020337 NM_020342 NM_020350 NM_020381 NM_020429 NM_020431 NM_020448 NM_020456 NM_020462 NM_020474 NM_020475 NM_020476 NM_020477 NM_020708 NM_020717 NM_020724 NM_020727 NM_020746 NM_020766 NM_020770 NM_020776 NM_020782 NM_020792 NM_020796 NM_020803 NM_020826 NM_020834 NM_020841 NM_020844 NM_020858 NM_020899 NM_020914 NM_020947 NM_020956 NM_021020 NM_021032 NM_021061 NM_021079 NM_021088 NM_021116 NM_021128 NM_021132 NM_021133 NM_021165 NM_021168 NM_021202 NM_021222 NM_021258 NM_021635 NM_021735 NM_021736 NM_021737 NM_021925 NM_022049 NM_022133 NM_022138 NM_022151 NM_022465 NM_022477 NM_022482 NM_022759 NM_022770 NM_023073 NM_023112 NM_024080 NM_024116 NM_024300 NM_024408 NM_024513 NM_024525 NM_024541 NM_024551 NM_024656 NM_024689 NM_024713 NM_024749 NM_024768 NM_024786 NM_024816 NM_024854 NM_024877 NM_024889 NM_024910 NM_024943 NM_025083 NM_025218 NM_025219 NM_025243 NM_025250 NM_030783 NM_030806 NM_030882 NM_030918 NM_031265 NM_031268 NM_031362 NM_031363 NM_031364 NM_031365 NM_031366 NM_031411 NM_031426 NM_031435 NM_031453 NM_031462 NM_031468 NM_031484 NM_031849 NM_031857 NM_031860 NM_031886 NM_031961 NM_032013 NM_032041 NM_032050 NM_032052 NM_032262 NM_032264 NM_032268 NM_032314 NM_032329 NM_032374 NM_032446 NM_032486 NM_032608 NM_032625 NM_032639 NM_032646 NM_032682 NM_032744 NM_032826 NM_032900 NM_032932 NM_032947 NM_032968 NM_032969 NM_032973 NM_032975 NM_032980 NM_033030 NM_033121 NM_033191 NM_033207 NM_033238 NM_033274 NM_033309 NM_033393 NM_033425 NM_033496 NM_033497 NM_033498 NM_033500 NM_033542 NM_033640 NM_052827 NM_052828 NM_052840 NM_052864 NM_052869 NM_052880 NM_052918 NM_052996 NM_053056 NM_057175 NM_057177 NM_057178 NM_058195 NM_058197 NM_078476 NM_080759 NM_080760 NM_080792 NM_080872 NM_130446 NM_133170 NM_133334 NM_133451 NM_133496 NM_133631 NM_138270 NM_138271 NM_138298 NM_138338 NM_138402 NM_138428 NM_138450 NM_138573 NM_138713 NM_138714 NM_138726 NM_138795 NM_138967 NM_138971 NM_138972 NM_138973 NM_139159 NM_144568 NM_144579 NM_144621 NM_144684 NM_144734 NM_145061 NM_145117 NM_145259 NM_145307 NM_145316 NM_145342 NM_145343 NM_145344 NM_145637 NM_145800 NM_145802 NM_145808 NM_147189 NM_147223 NM_147780 NM_147781 NM_147782 NM_147783 NM_148171 NM_152282 NM_152291 NM_152309 NM_152374 NM_152393 NM_152422 NM_152423 NM_152460 NM_152470 NM_152488 NM_152493 NM_152609 NM_152754 NM_152765 NM_152774 NM_152836 NM_152837 NM_152916 NM_152917 NM_152918 NM_152919 NM_152920 NM_152921 NM_152943 NM_153010 NM_153032 NM_153284 NM_153442 NM_153451 NM_153456 NM_153487 NM_153499 NM_153500 NM_153616 NM_153617 NM_153618 NM_153619 NM_153683 NM_153718 NM_153719 NM_170674 NM_170675 NM_170676 NM_170677 NM_170740 NM_172101 NM_172213 NM_172216 NM_172217 NM_172226 NM_172239 NM_172315 NM_172316 NM_172375 NM_173065 NM_173214 NM_173505 NM_173509 NM_173522 NM_173536 NM_173638 NM_173664 NM_173700 NM_173805 NM_173851 NM_174917 NM_174921 NM_175610 NM_175859 NM_175864 NM_175923 NM_175931 NM_176084 NM_176085 NM_176086 NM_176815 NM_176823 NM_177963 NM_177972 NM_177978 NM_177995 NM_177996 NM_178037 NM_178038 NM_178039 NM_178040 NM_178151 NM_178152 NM_178153 NM_178509 NM_178563 NM_178568 NM_178839 NM_181041 NM_181311 NM_181312 NM_181313 NM_181314 NM_181349 NM_181481 NM_181482 NM_181483 NM_181531 NM_181533 NM_181654 NM_181789 NM_181814 NM_181826 NM_181827 NM_181844 NM_181846 NM_182487 NM_182497 NM_182518 NM_182551 NM_182585 NM_182798 NM_182799 NM_182801 NM_182827 NM_182831 NM_182909 NM_182964 NM_183372 NM_194071 NM_194286 NM_194299 NM_194310 NM_194324 NM_197966 NM_197967 NM_197970 NM_198138 NM_198196 NM_198291 NM_198327 NM_198328 NM_198686 NM_198833 NM_198835 NM_198844 NM_198859 NM_198968 NM_199072 NM_199160 NM_199245 NM_199335 NM_199351 NM_199436 NM_201280 NM_201432 NM_201433 NM_201546 NM_203305 NM_203327 NM_203464 NM_206594 NM_206595 NM_206835 NM_206907 NM_206909 NM_206914 NM_207122 NM_207306 NM_207309 NM_207316 NM_207350 NM_207362 NM_207412 NM_207434 NM_207435 NM_207438 NM_207451 NM_207461 NM_207463 NM_207475 NM_207497 NM_207504 NM_207646 NM_212464 NM_212467 NM_212556 NM_212558 NM_213596 NM_213651 XM_027236 XM_027307 XM_032996 XM_037523 XM_038436 XM_039570 XM_039676 XM_042936 XM_048898 XM_087386 XM_117294 XM_167044 XM_171855 XM_210048 XM_290546 XM_290597 XM_290670 XM_370654 XM_370664 XM_371486 XM_371668 XM_372039 XM_373500 XM_373513 XM_373906 XM_374803 XM_375029 XM_375033 XM_375378 XM_375430 XM_375491 XM_375697 XM_376018 XM_376049 XM_376062 XM_376165 XM_376305 XM_376386 XM_376412 XM_376423 XM_376720 XM_376784 XM_377476 XM_377742 XM_378312 XM_378608 XM_378667 XM_378700 XM_378708 XM_378741 XM_378798 XM_378843 XM_378964 XM_379075 XM_379079 XM_379204 XM_379214 XM_379280 XM_379309 XM_379363 XM_379398 XM_379402 XM_379432 XM_379452 XM_379454 XM_379484 XM_379595 XM_379622 XM_379634 XM_379722 XM_379967 XM_380100 XM_495909 XM_495937 XM_496093 XM_496134 XM_496335 XM_496391 XM_496394 XM_496399 XM_496549 XM_496603 XM_496608 XM_496844 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_498427 XM_498436 XM_498464 XM_498465 XM_498540 XM_498662 XM_498744 XM_498824 XM_498901 XM_499008 XM_499028 XM_499046 XM_499047 XM_499123 XM_499125 XM_499501 XM_499566 XM_499594 XM_499595 XR_000190 XR_000192 XR_000195 XR_000227 XR_000261 XR_000266 XR_000268 XR_000292
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)