VIRsiRNAdb
Database of Viral siRNA / shRNA
Home
Search
Advance Search
Browse
By Family
By Virus
Gene
Pubmed
VIRsiID
EscapeDb
Tools
siTarAlign
siRNAmap
VIRsiblast
Submit
About
Database
Tools
Search
Browse
Team
Contact
Predicted off-targets seeds for siRNA
"ggcucgaguauuguguacgag"
Using
siRNA Seed Locator
Algorithm
siRNA Seed Locator
Total Genes with at least one seed match :
564
.
Total Genes with multiple seed matches:
20
.
Genes with at least one seed match:
NM_000027 NM_000068 NM_000111 NM_000210 NM_000214 NM_000220 NM_000319 NM_000320 NM_000368 NM_000380 NM_000436 NM_000500 NM_000547 NM_000633 NM_000664 NM_000693 NM_000719 NM_000793 NM_000834 NM_000840 NM_000869 NM_000997 NM_001001132 NM_001001323 NM_001001791 NM_001003396 NM_001003397 NM_001003800 NM_001004106 NM_001004285 NM_001004286 NM_001004301 NM_001004329 NM_001004439 NM_001005388 NM_001005463 NM_001005737 NM_001005845 NM_001007023 NM_001007269 NM_001007270 NM_001007466 NM_001007529 NM_001008742 NM_001010910 NM_001010911 NM_001010989 NM_001010990 NM_001012420 NM_001012423 NM_001012969 NM_001015885 NM_001017523 NM_001018051 NM_001018072 NM_001024592 NM_001025266 NM_001062 NM_001271 NM_001390 NM_001682 NM_001908 NM_001931 NM_001992 NM_002025 NM_002056 NM_002082 NM_002124 NM_002139 NM_002142 NM_002193 NM_002268 NM_002304 NM_002393 NM_002499 NM_002582 NM_002641 NM_002662 NM_002676 NM_002737 NM_002802 NM_002833 NM_002893 NM_002956 NM_002957 NM_002998 NM_003010 NM_003048 NM_003149 NM_003412 NM_003435 NM_003473 NM_003484 NM_003486 NM_003496 NM_003610 NM_003624 NM_003704 NM_003749 NM_003778 NM_003799 NM_003816 NM_003842 NM_003850 NM_003939 NM_004093 NM_004101 NM_004273 NM_004302 NM_004368 NM_004383 NM_004393 NM_004402 NM_004482 NM_004521 NM_004627 NM_004717 NM_004724 NM_004737 NM_004745 NM_004768 NM_004921 NM_004932 NM_004948 NM_005026 NM_005160 NM_005206 NM_005208 NM_005233 NM_005338 NM_005346 NM_005479 NM_005488 NM_005512 NM_005544 NM_005602 NM_005665 NM_005677 NM_005724 NM_005725 NM_005749 NM_005815 NM_005834 NM_005870 NM_005883 NM_005966 NM_006037 NM_006108 NM_006131 NM_006132 NM_006154 NM_006166 NM_006212 NM_006378 NM_006481 NM_006622 NM_006625 NM_006673 NM_006738 NM_006749 NM_006788 NM_006926 NM_007084 NM_007087 NM_007088 NM_007174 NM_007200 NM_007306 NM_007322 NM_007335 NM_007336 NM_007338 NM_007375 NM_012157 NM_012174 NM_012211 NM_012215 NM_012244 NM_012257 NM_012271 NM_012397 NM_013396 NM_013437 NM_013444 NM_013989 NM_014057 NM_014246 NM_014345 NM_014468 NM_014655 NM_014685 NM_014728 NM_014732 NM_014741 NM_014783 NM_014838 NM_014840 NM_014841 NM_014917 NM_014934 NM_014935 NM_014956 NM_014974 NM_015027 NM_015075 NM_015079 NM_015087 NM_015090 NM_015101 NM_015116 NM_015226 NM_015229 NM_015230 NM_015288 NM_015336 NM_015347 NM_015409 NM_015447 NM_015493 NM_015537 NM_015638 NM_015683 NM_015836 NM_015885 NM_015891 NM_015908 NM_015989 NM_016215 NM_016290 NM_016423 NM_016499 NM_016592 NM_016608 NM_016620 NM_016823 NM_017415 NM_017582 NM_017592 NM_017628 NM_017632 NM_017635 NM_017656 NM_017671 NM_017742 NM_017778 NM_017848 NM_017851 NM_017899 NM_017904 NM_017968 NM_018137 NM_018179 NM_018197 NM_018306 NM_018407 NM_018424 NM_018450 NM_018639 NM_018685 NM_018702 NM_018990 NM_019067 NM_019094 NM_019887 NM_020132 NM_020159 NM_020245 NM_020341 NM_020362 NM_020472 NM_020473 NM_020652 NM_020699 NM_020917 NM_020939 NM_020956 NM_021014 NM_021033 NM_021106 NM_021132 NM_021147 NM_021161 NM_021164 NM_021184 NM_021205 NM_021615 NM_021936 NM_021942 NM_021979 NM_022088 NM_022130 NM_022138 NM_022471 NM_022493 NM_022571 NM_022733 NM_023107 NM_023108 NM_024035 NM_024109 NM_024295 NM_024329 NM_024336 NM_024416 NM_024421 NM_024490 NM_024580 NM_024587 NM_024631 NM_024636 NM_024641 NM_024652 NM_024707 NM_024859 NM_024865 NM_024949 NM_024989 NM_025197 NM_025250 NM_030621 NM_030622 NM_030626 NM_030650 NM_030920 NM_030964 NM_031445 NM_031887 NM_031888 NM_032186 NM_032207 NM_032228 NM_032271 NM_032317 NM_032505 NM_032706 NM_032709 NM_032803 NM_032932 NM_032933 NM_032975 NM_032980 NM_033014 NM_033133 NM_033207 NM_033285 NM_033364 NM_033637 NM_052832 NM_052839 NM_052846 NM_052878 NM_052949 NM_052968 NM_052988 NM_054016 NM_058172 NM_058181 NM_080538 NM_080539 NM_080540 NM_080541 NM_080542 NM_080543 NM_080544 NM_080551 NM_130795 NM_130848 NM_133175 NM_133176 NM_133496 NM_133642 NM_134264 NM_134427 NM_138295 NM_138317 NM_138318 NM_138415 NM_138777 NM_138795 NM_138929 NM_138930 NM_139182 NM_144488 NM_144489 NM_144611 NM_144621 NM_144707 NM_144721 NM_144767 NM_145251 NM_145648 NM_145818 NM_147187 NM_147188 NM_147780 NM_147781 NM_147782 NM_147783 NM_148968 NM_148969 NM_148971 NM_148972 NM_148973 NM_148974 NM_152270 NM_152290 NM_152309 NM_152322 NM_152382 NM_152400 NM_152402 NM_152414 NM_152437 NM_152470 NM_152554 NM_152594 NM_152608 NM_152658 NM_152722 NM_152737 NM_152776 NM_153031 NM_153184 NM_153240 NM_153348 NM_153381 NM_153463 NM_153639 NM_153689 NM_153764 NM_153765 NM_153766 NM_153767 NM_172239 NM_173459 NM_173470 NM_173536 NM_173570 NM_173589 NM_173800 NM_174972 NM_175719 NM_175721 NM_175722 NM_175734 NM_175767 NM_175907 NM_176095 NM_176789 NM_176814 NM_177403 NM_177438 NM_177454 NM_177963 NM_177964 NM_177990 NM_178500 NM_178507 NM_181355 NM_181533 NM_181814 NM_182598 NM_182633 NM_182728 NM_182800 NM_182812 NM_194286 NM_198240 NM_198396 NM_198400 NM_198441 NM_198493 NM_198582 NM_198835 NM_198902 NM_198968 NM_198993 NM_199040 NM_199053 NM_199176 NM_199177 NM_199368 NM_199426 NM_201263 NM_201269 NM_201277 NM_201446 NM_203301 NM_203374 NM_203447 NM_206835 NM_207357 NM_207358 NM_207362 NM_207405 NM_207430 NM_207445 NM_207447 NM_207506 NM_207647 NM_212543 NM_213621 XM_027236 XM_028810 XM_031689 XM_036936 XM_036942 XM_057107 XM_084529 XM_085634 XM_114735 XM_293828 XM_370837 XM_370839 XM_370843 XM_370845 XM_370849 XM_370917 XM_371132 XM_371429 XM_371474 XM_371783 XM_371956 XM_372205 XM_373827 XM_375152 XM_375816 XM_376444 XM_376784 XM_378327 XM_378411 XM_378538 XM_378617 XM_378798 XM_379280 XM_379363 XM_379535 XM_379932 XM_380160 XM_496070 XM_496351 XM_496981 XM_496982 XM_496983 XM_496984 XM_496985 XM_498446 XM_498463 XM_498619 XM_498620 XM_498621 XM_498751 XM_498841 XM_498857 XM_498894 XM_499084 XM_499128 XM_499539 XM_499586 XM_499593 XR_000182 XR_000195 XR_000261 XR_000292
Genes with multiple seed matches:
NM_000210 NM_001012420 NM_001012423 NM_003412 NM_004745 NM_005544 NM_006037 NM_006132 NM_006481 NM_012397 NM_030650 NM_032207 NM_032933 NM_080551 NM_152554 NM_153463 XM_370837 XM_370843 XM_370917 XM_375152
For Details about the algorithm please see
"3' UTR seed matches, but not overall identity, are associated with RNAi off-targets
" ,Nature Methods - 3, 199 - 204 (2006)