Predicted Off-targets for siRNA "gguauguugcccguuugucu" Using siRNA SpecificityServer

Specificity Server [Result page v1.0]


SpecificityServer - An siRNA design program for determining siRNA specificity

Automatic recommendation
OK - siRNA is specific for both sense and antisense (guide) strands

2 hits were found for GUAUGUUGCCCGUUUGUCU (2 guide strand hits and 0 sense strand hits.)

Hits to Guide strand

AccessionGeneStartEndDetails of mismatchesSpec.
Score
MismatchesContiguousJackson style
specificity
Hits similar
gene
HSP
Score
HSP %
Identity
HSP lengthGene Length
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
NM_001005209 MGC99813 1725 1743 GUgUGUUGCCCGUgUGUCU60 2 10 c false   <90%   2239
NM_005932 MIPEP 1200 1218 cUAUaUUGCCCGUUUuUCU20 3 10 c false   <90%   2392



3 prime UTR Seed matches

Hits to same gene : 0
Hits to other genes : 2322
View matched accessions

3 prime seed match details

AccessionGene nameHits to this gene
NM_017813IMPAD15
NM_152793C7orf414
NM_001079526IKZF23
NM_016260IKZF23
NM_012082ZFPM23
NM_001039840CHIC13
NM_013255MKLN13
NM_001080416MYBL13
NM_032842FLJ148033
NM_018440PAG13
XM_001134363FOXK23
XM_001134364FOXK23
NM_004514FOXK23
NM_001044722CSNK1G33
NM_001031812CSNK1G33
NM_001044723CSNK1G33
NM_004384CSNK1G33
NM_000038APC3
NM_198468C6orf1673
NM_017665ZCCHC103
NM_181523PIK3R13
NM_181504PIK3R13
NM_181524PIK3R13
NM_012164FBXW23
NM_139281WDR363
NM_001003674C18orf13
NM_181483C18orf13
NM_181481C18orf13
NM_001003675C18orf13
NM_004338C18orf13
NM_181482C18orf13
XM_001129292MBOAT23
NM_016076C1orf1213
NM_015455CNOT63
NM_144571CNOT6L3
NM_032828ZNF5873
NM_015344LEPROTL13
NM_001042751STAG23
NM_001042750STAG23
NM_001042749STAG23
NM_006603STAG23
NM_018313PBRM13
NM_181042PBRM13
NM_018165PBRM13
NM_001310CREBL23
NM_020375C12orf53
NM_006283TACC13
NM_007013WWP12
NM_014701KIAA02562
XM_944029LOC6479792
NM_018841GNG122
NM_001002860BTBD72
NM_0056402
NM_002040GABPA2
NM_005915MCM62
XM_942952FLJ462842
XM_499123FLJ462842
NM_005065SEL1L2
NM_1449932
NM_002519NPAT2
NM_014056HIGD1A2
NM_0010996682
NM_0010996692
NM_001017440CALN12
NM_031468CALN12
NM_007203PALM2-AKAP22
NM_147150PALM2-AKAP22
NM_001004065AKAP22
NM_001042520MGC130572
NM_001042521MGC130572
NM_001042519MGC130572
NM_032321MGC130572
NM_033222PSIP12
NM_001001664LOC3397452
NM_015569DNM32
NM_078483SLC36A12
NM_002745MAPK12
NM_001010887ASAH3L2
NM_014415ZBTB112
NM_005324H3F3B2
NM_138959VANGL12
NM_018195C11orf572
NM_001082969C11orf572
NM_001082970C11orf572
NM_003679KMO2
NM_001530HIF1A2
NM_181054HIF1A2
NM_001039577CCNL22
NM_017742ZCCHC22
NM_130834OPA12
NM_015560OPA12
NM_130836OPA12
NM_130831OPA12
NM_130832OPA12
NM_130837OPA12
NM_130833OPA12
NM_130835OPA12
NM_0010986242
NM_033290MID12
NM_000381MID12
NM_006885ATBF12
NM_001023587ABCC52
NM_178815ARL5B2
NM_020673RAB22A2
NM_022735ACBD32
NM_018976SLC38A22
NM_018364RSBN12
NM_012287CENTB22
NM_206866BACH12
NM_001186BACH12
NM_007166PICALM2
NM_001008660PICALM2
NM_001040001MLLT42
NM_152374FLJ389842
NM_005056JARID1A2
NM_001042603JARID1A2
NM_005010NRCAM2
NM_001037133NRCAM2
NM_001037132NRCAM2
NM_000492CFTR2
NM_014989RIMS12
NM_0011132392
NM_022740HIPK22
NM_019044CCDC932
NM_080923PTPRC2
NM_194317LYPD62
NM_001656TRIM232
NM_006775QKI2
NM_018439IMPACT2
NM_000868HTR2C2
NM_003108SOX112
NM_022893BCL11A2
NM_001024647RAB3IP2
NM_022456RAB3IP2
NM_175624RAB3IP2
NM_175625RAB3IP2
NM_175623RAB3IP2
NM_145257C1orf962
NM_053056CCND12
NM_206909PSD32
NM_015310PSD32
NM_003417ZNF2642
NM_014707HDAC92
NM_001024596ZNF7722
NM_022901LRRC192
NM_001128AP1G12
NM_001030007AP1G12
NM_152291MUC72
NM_017645FAM29A2
NM_012405ICMT2
NM_025191EDEM32
NM_001024680LOC5542512
NM_198460GBP62
NM_006036PREPL2
NM_001042386PREPL2
NM_001042385PREPL2
NM_002092GRSF12
NM_0010984772
NM_024996GFM12
NM_145167PIGM2
NM_0333902
XM_376795FLJ458722
XM_940037FLJ458722
NM_002610PDK12
NM_181435C1QTNF32
NM_030945C1QTNF32
NM_003408ZFP372
NM_194434VAPA2
NM_003574VAPA2
NM_138473SP12
NM_020342SLC39A102
NM_001017992DKFZp686D09722
NM_001017973P4HA22
NM_001017974P4HA22
NM_004199P4HA22
NM_148957TNFRSF192
NM_030627CPEB42
NM_024408NOTCH22
XM_001133349NOTCH22
NM_015087SPG202
NM_005840SPRY32
NM_001003712OSBPL82
NM_020841OSBPL82
XM_001130839NR1D22
NM_005126NR1D22
NM_006252PRKAA22
NM_014867KBTBD112
NM_001801CDO12
NM_006020ALKBH12
NM_015534ZZZ32
NM_005669REEP52
NM_020198CCDC472
NM_001077440BCLAF12
NM_001077441BCLAF12
NM_014739BCLAF12
NM_020718USP312
NM_004852ONECUT22
NM_152388ALS2CR42
NM_001044385ALS2CR42
NM_007195POLI2
NM_017563IL17RD2
NM_001080973IL17RD2
NM_002211ITGB12
NM_133370YTHDC12
NM_001031732YTHDC12
NM_014774KIAA04942
NM_001241CCNT22
NM_058241CCNT22
NM_005665EVI52
NM_020552TCL62
NM_020553TCL62
NM_001010000ARHGAP282
NM_0010937722
NM_000222KIT2
NM_198844ZPBP22
NM_199321ZPBP22
NM_001160APAF12
NM_181868APAF12
NM_181869APAF12
NM_013229APAF12
NM_181861APAF12
NM_004859CLTC2
NM_017650PPP1R9A2
NM_032435KIAA18042
NM_182935MOBP2
NM_002359MAFG2
NM_032711MAFG2
NM_138348FAM105B2
NM_130446KLHL62
NM_012096APPL12
NM_030817APOLD12
NM_022087GALNT112
NM_003483HMGA22
NM_018647TNFRSF192
NM_000084CLCN52
NM_182511CBLN22
NM_138927SON2
NM_173167UNC45B2
NM_001033576UNC45B2
NM_030791SGPP12
NM_014021SSX2IP2
NM_198395G3BP12
NM_005754G3BP12
NM_005871SMNDC12
NM_001004346MTHFD2L2
NM_005342HMGB32
NM_014518ZNF2292
NM_001167BIRC42
NM_172037RDH102
NM_212558LOC4014982
NM_020782KLHDC52
NM_133496SLC30A72
NM_001024948FNBP1L2
NM_152903KBTBD62
NM_148170CTSC2
XM_001129054LOC7283622
XM_001128984LOC7308382
NM_152835PDIK1L2
NM_0011055292
NM_006095ATP8A12
NM_016946F11R2
NM_175607CNTN42
NM_175612CNTN42
NM_198968DZIP12
NM_014934DZIP12
NM_144949SOCS52
NM_014011SOCS52
NM_016217HECA2
NM_012330MYST42
NM_006359SLC9A62
NM_001042537SLC9A62
NM_018403DCP1A2
NM_0010986382
NM_015557CHD52
NM_020666CLK42
NM_006380APPBP22
NM_021148ZNF2732
NM_152556FLJ318182
NM_005346HSPA1B2
NM_173827COX182
NM_002223ITPR22
NM_025134CHD92
NM_172071RC3H12
NM_004275TRFP2
NM_005204MAP3K82
NM_014487ZNF3302
NM_032783CBR42
NM_138468ICA1L2
NM_153354TMEM161B1
NM_004705PRKRIR1
XM_001128792LOC7287481
NM_138395MARS21
NM_033083EAF11
NM_014822SEC24D1
NM_004034ANXA71
NM_001156ANXA71
NM_032547SCOC1
NM_014809KIAA03191
NM_025203C2orf441
NM_019610RBMXL11
NM_015942MTERFD11
NM_005435ARHGEF51
NM_001663ARF61
NM_014648DZIP31
NM_032433ZNF3331
NM_022375OCLM1
NM_173454PDE8A1
NM_002605PDE8A1
NM_031415MLZE1
NM_003722TP73L1
NM_178544ZNF5461
NM_0010839621
NM_003199TCF41
NM_032335PHF61
NM_000859HMGCR1
NM_000292PHKA21
NM_000452SLC10A21
NM_144642SYNPR1
NM_206943LTBP11
NM_000627LTBP11
NM_001013659ZNF7931
NM_030938TMEM491
NM_174911FAM84B1
NM_194291TMEM651
NM_013302EEF2K1
XM_001132109LOC7300201
NM_002674PMCH1
NM_0010982071
NM_004966HNRPF1
NM_0010982051
NM_0010982081
NM_0010982041
NM_0010982061
NM_004617TM4SF41
NM_004815ARHGAP291
NM_001009186CCT6A1
NM_001762CCT6A1
NM_001957EDNRA1
NM_003437ZNF1361
XM_001126650ZNF1361
NM_133266SHANK21
NM_198182GRHL11
NM_014552GRHL11
NM_198887NUP431
NM_003425ZNF451
NM_203451LOC4001201
NM_002628PFN21
NM_053024PFN21
NM_006099PIAS31
NM_020951ZNF5291
NM_015235CSTF2T1
NM_001419ELAVL11
NM_018303EXOC21
NM_018170P15RS1
NM_033036GAL3ST31
NM_003597KLF111
XM_001129527KLF111
NM_020154C15orf241
NM_020734FAM80B1
NM_004056CA81
NM_004999MYO61
NM_000052ATP7A1
NM_080760DACH11
NM_080759DACH11
NM_004392DACH11
NM_002501NFIX1
NM_182697UBE2H1
NM_003344UBE2H1
NM_007159SLMAP1
XM_001131454LOC7311041
XM_001132231LOC7288511
XM_938941LOC6437901
XM_927071LOC6437901
NM_004965HMGN11
NM_032679ZNF5771
NM_004133HNF4G1
NM_152623CDC20B1
NM_017915C12orf481
NM_005164ABCD21
NM_000636SOD21
NM_052811TRIM131
NM_213590TRIM131
NM_001007278TRIM131
NM_005798TRIM131
NM_015234GPR1161
NM_0010985181
NM_005340HINT11
NM_022898BCL11B1
NM_138576BCL11B1
NM_005746PBEF11
NM_015892GALNAC4S-6ST1
NM_014970KIFAP31
NM_001775CD381
NM_001146ANGPT11
NM_080860TSGA21
NM_0011004171
NM_175748C14orf1301
NM_080663EXOD11
XM_001127963LOC7309821
XM_001127725LOC7285441
NM_021912GABRB31
NM_000814GABRB31
NM_207012AP3M11
NM_012095AP3M11
NM_000245MET1
NM_005795CALCRL1
NM_000351STS1
NM_018138TBCCD11
NM_153207AEBP21
NM_152624DCP21
NM_0010853681
NM_001009960ZNF6551
NM_0010839561
NM_138494ZNF6551
NM_001013699LOC4400931
NM_024946NIP301
NM_001125ADPRH1
NM_002158FOXN21
NM_177948ARMCX31
NM_177947ARMCX31
NM_016607ARMCX31
NM_016351ADAM221
NM_021723ADAM221
NM_021722ADAM221
NM_022116FIGNL11
NM_001042762FIGNL11
NM_020639RIPK41
NM_012464TLL11
NM_015910LOC510571
NM_001042692LOC510571
NM_031314HNRPC1
NM_001077443HNRPC1
NM_001077442HNRPC1
NM_004500HNRPC1
NM_024794ABHD91
NM_002015FOXO1A1
NM_0249361
NM_004776B4GALT51
NM_001945HBEGF1
NM_003287TPD52L11
NM_001003395TPD52L11
NM_001003396TPD52L11
NM_001003397TPD52L11
NM_145297ZNF6261
XM_941026ING51
XM_001126273LOC7277731
NM_032329ING51
NM_002971SATB11
NM_152446C14orf1451
NM_015891CDC401
NM_016277RAB231
NM_183227RAB231
NM_145307PLEKHK11
NM_080872UNC5D1
NM_002397MEF2C1
NM_194286KIAA18531
NM_052943FAM46B1
NM_006047RBM121
NM_152838RBM121
NM_020773TBC1D141
XM_001133521MGC513381
XM_001132564LOC7288821
NM_005786TSHZ11
NM_001083615MYO3B1
NM_138995MYO3B1
NM_173698RP1-32F7.21
NM_007231SLC6A141
NM_012437SNAPAP1
NM_0011031701
NM_0011031691
NM_006158NEFL1
NM_017444CHRAC11
NM_022474MPP51
NM_006541TXNL21
NM_001664RHOA1
NM_006372SYNCRIP1
NM_018365MNS11
NM_002430MN11
NM_020800IFT801
NM_006773DDX181
NM_207297MBNL11
NM_001296CCBP21
NM_014711CP1101
NM_006636MTHFD21
NM_001040409MTHFD21
NM_0011127361
NM_015224C3orf631
NM_001007098SCP21
NM_0011006261
NM_006459ERLIN11
NM_003648DGKD1
NM_152879DGKD1
NM_033481FBXO91
NM_033480FBXO91
NM_012347FBXO91
NM_198830ACLY1
NM_001096ACLY1
NM_021936PAPPA21
NM_002655PLAG11
NM_052932TMEM1231
NM_032300TCHP1
NM_153261TMEM1881
NM_032846RAB2B1
NM_0011013961
NM_006628ARPP-191
NM_0011013861
NM_015147CEP681
NM_030650KIAA17151
NM_024052C17orf391
NM_016132MYEF21
NM_016018PHF20L11
NM_022098XPNPEP31
XM_001129792LOC7291481
NM_138459NUS11
NM_004419DUSP51
NM_002915RFC31
NM_021826FASTKD51
NM_015461ZNF5211
NM_014574STRN31
NM_001083893STRN31
NM_052832SLC26A71
NM_000217KCNA11
NM_001037278GGPS11
NM_004837GGPS11
NM_001037277GGPS11
XM_049078KIAA12391
XM_940885KIAA12391
NM_020204LHX91
NM_001014434LHX91
NM_017545HAO11
NM_005472KCNE31
XM_499356LOC4426091
XM_935540LOC4426091
NM_0010994351
NM_175064WBSCR191
NM_017599VEZT1
NM_006851GLIPR11
NM_003666BLZF11
NM_020871LRCH21
NM_006379SEMA3C1
NM_005497GJA71
NM_001080383GJA71
NM_017847C1orf271
NM_181723EFHA21
NM_000811GABRA61
NM_024666FLJ115061
NM_001024401SBK11
NM_032873STS-11
NM_007054KIF3A1
NM_024834C10orf1191
XM_933333LOC6534491
NM_002009FGF71
XM_940960LOC6517441
XM_928125LOC6450861
NM_014267C11orf581
NM_198539ZNF5681
NM_020177FEM1C1
NM_006650CPLX21
NM_001008220CPLX21
NM_014410CLUL11
NM_199167CLUL11
NM_024915GRHL21
NM_001039693FLJ379531
NM_012465TLL21
NM_176814ZNF8001
NM_014959CARD81
NM_001040273TYSND11
NM_173555TYSND11
NM_024577SH3TC21
NM_012229NT5C21
NM_000450SELE1
NM_005113GOLGA51
NM_152429FGFBP31
NM_0011018011
NM_0011018001
NM_016603C5orf51
NM_004063CDH171
NM_024301FKRP1
NM_001039885FKRP1
NM_152874FAS1
NM_152876FAS1
NM_152877FAS1
NM_152872FAS1
NM_152871FAS1
NM_152873FAS1
NM_000043FAS1
NM_152875FAS1
XM_932289LOC6446601
XM_943717LOC6446601
NM_145259ACVR1C1
NM_0011110311
NM_0011110331
NM_0011110321
NM_0010986121
NM_024345WDR321
NM_175052ST8SIA41
NM_004169SHMT11
NM_148918SHMT11
NM_017902HIF1AN1
NM_003296CRISP21
NM_182920ADAMTS91
NM_006731FCMD1
NM_001079802FCMD1
NM_015079TBC1D2B1
NM_001002800SMC41
NM_005496SMC41
NM_052886MAL21
NM_005822DSCR1L11
NM_030637DDHD11
NM_013351TBX211
XM_945008LOC6519081
XM_932981LOC6455811
NM_000280PAX61
NM_001604PAX61
NM_024785FAM124B1
NM_016083CNR11
NM_033181CNR11
NM_012446SSBP21
NM_138400NOM11
NM_001079877RASA41
NM_006989RASA41
NM_0010987211
NM_0010987221
NM_004485GNG41
NM_017761PNRC21
NM_002639SERPINB51
NM_001011513PDLIM51
NM_006457PDLIM51
NM_198529EFCAB51
NM_138635H2AFV1
NM_001037339PDE4B1
NM_002600PDE4B1
NM_001037340PDE4B1
NM_001037341PDE4B1
NM_0011008291
NM_033227TRIM231
NM_033228TRIM231
NM_032505KBTBD81
NM_024808C13orf341
NM_032410HOOK31
NM_213645WARS1
NM_004184WARS1
NM_173701WARS1
NM_213646WARS1
NM_021629GNB41
NM_000772CYP2C181
NM_001010874SRD5A2L21
NM_021705NFYA1
NM_002505NFYA1
NM_018299UBE2W1
NM_001001481UBE2W1
NM_003369UVRAG1
NM_019027FLJ202731
NM_0010986341
NM_018157RIC8B1
NM_0208271
NM_206854QKI1
NM_206855QKI1
NM_138292ATM1
NM_000051ATM1
NM_030934C1orf251
NM_001964EGR11
NM_001009993LOC1300741
NM_005359SMAD41
NM_014232VAMP21
NM_024513FYCO11
NM_014672KIAA03911
NM_173499SPATA81
NM_006475POSTN1
NM_000380XPA1
NM_020766PCDH191
NM_0011052431
NM_000872HTR71
NM_019859HTR71
NM_019860HTR71
NM_004962GDF101
NM_144963FAM91A11
NM_018028SAMD4B1
NM_033020TRIM331
NM_015906TRIM331
NM_006504PTPRE1
NM_130435PTPRE1
XM_001129439LOC7308771
XM_001127905LOC7281961
NM_172069PLEKHH21
NM_147187TNFRSF10B1
NM_003842TNFRSF10B1
NM_032664FUT101
NM_020859SHROOM31
NM_003387WIPF11
NM_001077269WIPF11
NM_058166TRIM61
NM_001003818TRIM61
NM_001423EMP11
NM_016079VPS241
NM_001005753VPS241
NM_153022C12orf591
NM_0011001641
NM_0011001661
NM_014721PHACTR21
NM_0011001651
NM_025074FRAS11
NM_006438COLEC101
NM_000684ADRB11
NM_021807EXOC41
NM_000315PTH1
NM_024551ADIPOR21
NM_020120UGCGL11
NM_001025777UGCGL11
NM_153223CCDC1001
NM_001083591CUGBP21
NM_001025077CUGBP21
NM_006561CUGBP21
NM_001025076CUGBP21
NM_016480PAIP21
NM_001033112PAIP21
NM_001039580MAP91
NM_001259CDK61
NM_016204GDF21
NM_024411PDYN1
NM_005032PLS31
NM_004403DFNA51
NM_015450POT11
NM_001042594POT11
NM_031445AMMECR1L1
NM_004346CASP31
NM_032991CASP31
XM_937933LOC6465611
XM_929496LOC6465611
NM_022096ANKRD51
NM_198798ANKRD51
NM_052905FMNL21
NM_014877HELZ1
NM_000115EDNRB1
NM_052845MMAB1
NM_001033056GLUL1
NM_002065GLUL1
NM_001033044GLUL1
NM_016252BIRC61
NM_017661SUHW41
NM_001002843SUHW41
NM_173683XKR61
NM_020299AKR1B101
NM_004464FGF51
NM_033143FGF51
NM_014504RABGEF11
NM_001080556WDR161
NM_145054WDR161
NM_014953DIS31
NM_198485FAM79B1
NM_031900AGXT21
NM_014875KIF141
NM_006241PPP1R21
NM_003577UTF11
NM_005000NDUFA51
NM_144974CCDC1221
NM_016358IRX41
NM_198896RAB6A1
NM_002869RAB6A1
NM_001077637LOC1507861
NM_032144RAB6C1
NM_006814PSMF11
NM_178578PSMF11
NM_005533IFI351
NM_006486FBLN11
NM_020781ZNF3981
NM_170686ZNF3981
NM_021804ACE21
NM_030800C15orf441
NM_017801CMTM61
NM_152902TIPRL1
NM_016265ZNF121
NM_006956ZNF121
NM_001002814RAB11FIP11
NM_001002233RAB11FIP11
NM_025151RAB11FIP11
NM_015051TXNDC41
NM_001008777FBXO471
NM_007022CYB561D21
NM_002843PTPRJ1
NM_015609C1orf1441
NM_144720JAKMIP11
NM_015257KIAA02861
NM_001040633PRKAG21
NM_016203PRKAG21
NM_024429PRKAG21
NM_020805KLHL141
NM_182765HECTD21
NM_145735ARHGEF71
NM_0011023711
NM_024955FOXRED21
NM_032482DOT1L1
NM_001012302TMEM16J1
NM_002830PTPN41
NM_0010996661
NM_145207SPATA51
NM_001025252TPD521
NM_001025253TPD521
NM_005079TPD521
NM_032859ABHD131
NM_006256PKN21
NM_207577MAP61
NM_016206VGLL31
NM_024953C12orf301
NM_032189ATP11A1
NM_015205ATP11A1
NM_002942ROBO21
NM_014279OLFM11
NM_013244MGAT4C1
NM_207381TNFAIP8L31
NM_020935USP371
NM_178842LASS31
NM_007118TRIO1
NM_024548LRRIQ21
NM_017612ZCCHC81
NM_032979DTNA1
NM_032978DTNA1
NM_001391DTNA1
NM_032981DTNA1
NM_004550NDUFS21
NM_001050SSTR21
NM_153025C16orf551
NM_016304C15orf151
NM_001010984C1orf1241
NM_016472C14orf1291
NM_183397PXMP41
NM_007238PXMP41
NM_144684ZNF4801
NM_080681COL11A21
NM_080680COL11A21
NM_080679COL11A21
NM_002245KCNK11
NM_030641APOL61
NM_005814GPA331
NM_182522FAM19A41
NM_001005527FAM19A41
NM_018557LRP1B1
XM_001126250LOC7305361
XM_001126199LOC7279441
NM_012234RYBP1
NM_003439ZKSCAN11
NM_001008393LOC2017251
NM_032295SLC37A31
NM_207113SLC37A31
NM_0011016691
NM_003866INPP4B1
NM_020776KIAA13281
NM_003617RGS51
NM_032495HOP1
NM_139212HOP1
NM_139211HOP1
NM_0251851
NM_016626RKHD21
NM_054014FKBP1A1
NM_001080480MBOAT11
XM_001131050MBOAT11
XM_001131044MBOAT11
XM_925864LOC6423251
XM_001129399LOC6423461
XM_928707LOC6423461
XM_925879LOC6423461
NM_001002912C1orf1731
XM_001129932LOC6453321
NM_000075CDK41
NM_201544LGALS81
NM_006499LGALS81
NM_201545LGALS81
NM_201543LGALS81
NM_033220TRIM141
NM_145251STYX1
XM_001125680LOC7304321
XM_001125705LOC7304321
NM_015292FAM62A1
NM_019009TOLLIP1
NM_005766FARP11
NM_002006FGF21
NM_003828MTMR11
NM_0011025591
NM_015191SNF1LK21
NM_0155621
NM_004423DVL31
NM_033666ITGB11
NM_030806C1orf211
NM_001024071GCH11
NM_001024024GCH11
NM_001024070GCH11
NM_000161GCH11
NM_012250RRAS21
NM_0011026691
NM_173570ZDHHC231
NM_033437PDE5A1
NM_001083PDE5A1
NM_033430PDE5A1
NM_015026MON21
NM_001039199C20orf1211
NM_024331C20orf1211
NM_001004304ZNF7401
NM_145055C18orf251
NM_001008239C18orf251
XM_001125827LOC7278201
NM_016075VPS361
NM_002099GYPA1
NM_015271TRIM21
NM_001718BMP61
NM_005431XRCC21
NM_001033925TIAL11
NM_003252TIAL11
NM_002858ABCD31
NM_001677ATP1B11
NM_001001787ATP1B11
NM_001037172ACPL21
NM_152282ACPL21
NM_018361AGPAT51
NM_002128HMGB11
NM_017770ELOVL21
NM_014671UBE3C1
NM_173560RFXDC11
NM_016039C14orf1661
NM_207521RTN41
NM_153828RTN41
NM_020532RTN41
NM_007008RTN41
NM_207520RTN41
NM_001012968LOC1398861
XM_936467BEXL11
NM_001080425BEXL11
NM_004680CDY11
NM_001003895CDY1B1
NM_014830ZBTB391
NM_005859PURA1
NM_001037317PAP2D1
NM_001010861PAP2D1
NM_152551C6orf1511
NM_001636SLC25A61
NM_003406YWHAZ1
NM_145690YWHAZ1
NM_147134NFX11
NM_152837SNX161
NM_152836SNX161
NM_022133SNX161
NM_153645NUP501
NM_007172NUP501
NM_003913PRPF4B1
NM_016544RBJ1
NM_004287GOSR21
NM_201266NRP21
NM_003872NRP21
NM_201279NRP21
NM_032758PHF5A1
NM_172344KCNG31
NM_133329KCNG31
NM_207467FLJ355301
NM_018271FLJ109161
NM_001033081MYCL11
NM_001033082MYCL11
NM_017667CCDC1321
NM_172359CD461
NM_172356CD461
NM_172361CD461
NM_172351CD461
NM_172350CD461
NM_172355CD461
NM_172352CD461
NM_172353CD461
NM_172357CD461
NM_172358CD461
NM_172354CD461
NM_153826CD461
NM_172360CD461
NM_002389CD461
NM_019083CCDC761
NM_178836LOC2011641
NM_006330LYPLA11
NM_000397CYBB1
NM_030971SFXN31
NM_004818DDX231
NM_133638ADAMTS191
NM_020676ABHD61
NM_000838GRM11
NM_020786PDP21
NM_198461LONRF21
NM_145277HFE21
NM_202004HFE21
NM_213652HFE21
NM_213653HFE21
NM_024784ZBTB31
NM_003644GAS71
NM_201432GAS71
NM_201433GAS71
NM_000860HPGD1
NM_000322PRPH21
XM_001131943LOC7299791
XM_001128763LOC7311881
NM_003079SMARCE11
NM_031442TMEM471
XM_001126375LOC7279221
XM_001126361LOC7279221
XM_001126406LOC7279221
XM_001126391LOC7279221
XM_001126417LOC7279221
NM_006625FUSIP11
NM_019063EML41
NM_003897IER31
NM_0011016761
NM_015902EDD11
NM_015225KIAA03671
XM_001132480SLCO3A11
NM_0011102131
NM_005042PRH21
NM_138448ACYP21
NM_198128RNF1381
NM_016271RNF1381
NM_153687IKIP1
NM_012412H2AFV1
NM_201516H2AFV1
NM_201436H2AFV1
NM_201517H2AFV1
NM_173552C3orf581
NM_001077244GRIA41
NM_0011128121
NM_021216ZNF711
NM_018386PCID21
NM_006933SLC5A31
NM_003038SLC1A41
NM_002234KCNA51
NM_004200SYT71
XM_943686SYT71
NM_015049TRAK21
NM_001007540LOC3891181
NM_017875SLC25A381
NM_057178RFFL1
NM_001017368RFFL1
NM_006716DBF41
NM_172056KCNH21
XM_930750LOC6423661
XM_943652LOC6423661
NM_001040429PCDH171
NM_015476C18orf101
NM_207333ZNF3201
NM_001035513SDHC1
NM_001035512SDHC1
NM_003001SDHC1
NM_001035511SDHC1
NM_006496GNAI31
NM_031488L3MBTL21
NM_007190SEC23IP1
NM_016575NT5DC31
NM_171825CAMK2A1
NM_015981CAMK2A1
NM_007086WDHD11
NM_001008396WDHD11
NM_006903PPA21
NM_176866PPA21
NM_176869PPA21
NM_176867PPA21
NM_001034191PPA21
NM_001007246BRWD11
NM_002310LIFR1
NM_024620ZNF3291
NM_015713RRM2B1
NM_001039395C9orf681
NM_017975ZWILCH1
NM_014906PPM1E1
NM_006291TNFAIP21
NM_033033KRT821
NM_006622PLK21
NM_030648SETD71
NM_012129CLDN121
NM_032025EIF2A1
NM_022162NOD21
NM_001012755MCART61
NM_032151PCBD21
NM_0010996921
XM_926071LOC6425921
NM_003470USP71
XM_933539MGC30321
XM_944529MGC30321
NM_001776ENTPD11
NM_0010981751
NM_020345NKIRAS11
NM_020143PNO11
NM_014660PHF141
NM_006164NFE2L21
NM_012424RPS6KC11
NM_152309PIK3AP11
NM_012224NEK11
NM_001033568RHOT11
NM_001033566RHOT11
NM_018307RHOT11
NM_020954KIAA16181
NM_000926PGR1
NM_004549NDUFC21
NM_020133AGPAT41
NM_001008537KIAA20221
NM_016571GLULD11
NM_002401MAP3K31
NM_203351MAP3K31
NM_003128SPTBN11
NM_001030060SAMD51
XM_496115LOC4403381
XM_940659LOC4403381
NM_015460MYRIP1
NM_001014380KATNAL11
NM_032116KATNAL11
NM_002460IRF41
NM_024908WDR761
NM_032511C6orf1681
NM_005504BCAT11
NM_005596NFIB1
NM_015045WAPAL1
NM_001300KLF61
NM_014787DNAJC61
NM_005197CHES11
NM_0010854711
NM_001991EZH11
NM_199126ZNF585A1
NM_152655ZNF585A1
NM_080764SUHW21
NM_001011709PNLIPRP31
NM_138444KCTD121
NM_198966PTHLH1
NM_198965PTHLH1
NM_020347LZTFL11
NM_018374TMEM106B1
NM_024102WDR771
NM_032168WDR751
NM_006313USP151
NM_014362HIBCH1
NM_198047HIBCH1
NM_018999KIAA11281
NM_018342TMEM1441
NM_006823PKIA1
NM_181839PKIA1
NM_198334GANAB1
NM_198335GANAB1
NM_173177C1D1
NM_006333C1D1
NM_198484ZNF6211
NM_0010984141
NM_001011720XKR91
NM_019903ADD31
NM_016824ADD31
NM_001121ADD31
NM_001077268ZFYVE191
NM_016593CYP39A11
NM_024873TNIP31
NM_004348RUNX21
NM_001015051RUNX21
NM_001024630RUNX21
NM_001018067SERBP11
NM_015640SERBP11
NM_001018069SERBP11
NM_001018068SERBP11
NM_145305SLC25A431
NM_001569IRAK11
NM_001025243IRAK11
NM_001025242IRAK11
NM_003762VAMP41
NM_206963RARRES11
NM_018584CAMK2N11
NM_177972TUB1
NM_003320TUB1
NM_015848KRT761
NM_001039771CBLN31
NM_006606RBBP91
XM_930224LOC6471901
XM_941815LOC6471901
NM_015299KIAA03231
NM_012255XRN21
NM_005044PRKX1
NM_002760PRKY1
NM_152424FAM123B1
NM_022754SFXN11
NM_001827CKS21
NM_006489NOVA11
NM_002515NOVA11
XM_001126705LOC7306581
NM_020336KIAA12191
NM_002547OPHN11
NM_032154PCGF61
NM_001011663PCGF61
NM_176824BBS71
NM_016255FAM8A11
NM_018366CNO1
NM_014757MAML11
XM_001126853MAML11
NM_173808NEGR11
NM_001017922ERMAP1
NM_018538ERMAP1
NM_014335EID11
NM_001969EIF51
NM_183004EIF51
NM_006862TDRKH1
NM_194298SLC16A91
NM_002406MGAT11
NM_138799MBOAT21
NM_024702ZNF7501
NM_006067COX4NB1
NM_032208ANTXR11
NM_173505ANKRD291
NM_020772NUFIP21
NM_173470TMEM321
NM_153051MTMR31
NM_021090MTMR31
NM_153050MTMR31
NM_003980MAP71
NM_0011009121
NM_006355TRIM381
NM_001011668CHCHD71
NM_024300CHCHD71
NM_001011671CHCHD71
NM_001011667CHCHD71
NM_001011670CHCHD71
NM_001011669CHCHD71
NM_178043LARP21
NM_001892CSNK1A11
NM_001025105CSNK1A11
NM_207372SH2D4B1
NM_006464TGOLN21
NM_006393NEBL1
NM_001013650LOC3891511
NM_013438UBQLN11
NM_003488AKAP11
NM_153718NUP621
NM_012346NUP621
NM_153719NUP621
NM_016553NUP621
NM_018124RFWD31
NM_001328CTBP11
NM_001012614CTBP11
NM_152308C16orf751
NM_001031684SFRS71
NM_004438EPHA41
NM_025201PLEKHQ11
NM_012345NUFIP11
NM_002653PITX11
NM_133458ZFP901
NM_003094SNRPE1
NM_004564PET112L1
NM_022458LMBR11
NM_001148ANK21
NM_020977ANK21
NM_004281BAG31
NM_0010994031
NM_020226PRDM81
NM_031262HNRPK1
NM_002140HNRPK1
NM_031263HNRPK1
XM_942428DUSP271
NM_001080426DUSP271
NM_000833GRIN2A1
NM_0155511
NM_025059C6orf971
NM_0071501
NM_020917ZFP141
NM_015506MMACHC1
NM_006013RPL101
NM_139279MCFD21
XM_001130495LOC7284291
NM_001004328ZNF705A1
NM_021958HLX11
NM_007249KLF121
NM_025061LRRC8E1
NM_182749N6AMT11
NM_013240N6AMT11
NM_004051BDH11
NM_203315BDH11
NM_203314BDH11
NM_006772SYNGAP11
NM_021049MAGEA51
NM_005347HSPA51
NM_181774SLC36A31
NM_016617UFM11
NM_199206TCL1B1
NM_032701SUV420H21
NM_007137ZNF811
NM_001004441DP581
NM_001042595TMEM911
NM_021965PGM51
NM_014243ADAMTS31
XM_944724LOC6515011
XM_941706LOC6490091
NM_002618PEX131
NM_001039615LOC4400531
XM_001130086LOC7289571
NM_001040445ASB11
NM_024026MRP631
NM_018346RSAD11
NM_173598KSR21
NM_000555DCX1
NM_178152DCX1
NM_178153DCX1
NM_178151DCX1
NM_001001412FAM26C1
NM_001017916CYB5611
NM_001915CYB5611
NM_001017917CYB5611
NM_198511LANCL31
NM_002709PPP1CB1
NM_206876PPP1CB1
NM_175883OR7D21
NM_0150381
NM_006888CALM11
NM_005045RELN1
NM_173054RELN1
NM_003885CDK5R11
NM_133264WIPF21
NM_012215MGEA51
NM_015289VPS391
NM_024334TMEM431
NM_020796SEMA6A1
NM_002451MTAP1
NM_005639SYT11
NM_006915RP21
NM_004331BNIP3L1
NM_178548TFAP2E1
NM_031954KCTD101
NM_013381TRHDE1
NM_002382MAX1
NM_145113MAX1
NM_145112MAX1
NM_002033FUT41
NM_153218C13orf311
NM_018225SMU11
NM_145111C7orf381
NM_001008212OPTN1
NM_001008213OPTN1
NM_021980OPTN1
NM_001008211OPTN1
NM_032372DYDC21
NM_001006616TSPAN171
NM_012171TSPAN171
NM_130465TSPAN171
NM_003909CPNE31
NM_005482PIGK1
NM_182643DLC11
NM_006094DLC11
NM_020697KCNS21
NM_005302GPR371
NM_017409HOXC101
NM_014257CLEC4M1
NM_214679CLEC4M1
NM_214678CLEC4M1
NM_214676CLEC4M1
NM_214677CLEC4M1
NM_015912C8ORFK321
NM_033091TRIM41
NM_033017TRIM41
NM_145254TMEM1701
NM_014901RNF441
NM_001003652SMAD21
NM_005901SMAD21
NM_018078LARP21
NM_014736KIAA01011
NM_001029989KIAA01011
NM_006089SCML21
NM_001706BCL61
NM_138931BCL61
NM_001029864KIAA17551
NM_017455NPTN1
NM_012428NPTN1
NM_007039PTPN211
NM_001009552PPP2CB1
NM_004156PPP2CB1
NM_033428C9orf1231
NM_170740ALDH5A11
NM_001080ALDH5A11
NM_0010988141
NM_152653UBE2E21
NM_020820PREX11
NM_002061GCLM1
NM_004379CREB11
NM_134442CREB11
NM_006896HOXA71
NM_012110CHIC21
NM_001007237IGSF31
NM_001542IGSF31
XM_001132925DUSP221
NM_006726LRBA1
NM_170731BDNF1
NM_001709BDNF1
NM_170732BDNF1
NM_170733BDNF1
NM_170734BDNF1
NM_170735BDNF1
NM_001024688NBN1
NM_002485NBN1
NM_015687FILIP11
NM_004823KCNK61
NM_014951ZNF3651
NM_016937POLA11
NM_001039585PTGFR1
NM_000959PTGFR1
NM_001004053ACTBL11
NM_019051MRPL501
NM_053031MYLK1
NM_053025MYLK1
NM_053032MYLK1
NM_053028MYLK1
NM_053026MYLK1
NM_053027MYLK1
NM_0010984981
NM_0010984971
NM_001039948RUTBC21
NM_133454RUTBC21
NM_016623FAM49B1
NM_170750PSMD101
NM_002814PSMD101
NM_005509DMXL11
NM_018992KCTD51
NM_173644C20orf1971
NM_003822NR5A21
NM_205860NR5A21
NM_013286RBM15B1
NM_001939DRP21
NM_013372GREM11
NM_007350PHLDA11
NM_014268MAPRE21
NM_015264C22orf91
NM_001009880C22orf91
NM_005436CCDC61
NM_001002919LOC2850161
NM_0010986141
NM_031292PUS7L1
NM_0010986151
NM_173825RABL31
XM_926634LOC6532561
NM_002834PTPN111
NM_145048C4orf281
NM_017922PRPF391
NM_004956ETV11
NM_003747TNKS1
NM_178470WDR40B1
NM_024881SLC35E11
NM_005151USP141
NM_001037334USP141
NM_012142CCNDBP11
NM_037370CCNDBP11
NM_001042601TTC141
NM_012384GMEB21
NM_002703PPAT1
NM_019079L1TD11
NM_198506FLJ446911
NM_000275OCA21
NM_000437PAFAH21
XM_001133760ZNF5191
NM_001326CSTF31
NM_152433KBTBD31
NM_198439KBTBD31
NM_007035KERA1
NM_002267KPNA31
NM_032228MLSTD21
NM_019049FLJ200541
NM_001017970TMEM30B1
NM_0208461
NM_007269STXBP31
NM_000382ALDH3A21
NM_001031806ALDH3A21
NM_177968PPM1B1
NM_207015NAALADL21
NM_017759FLJ203091
NM_152774MGC420901
NM_013231FLRT21
NM_198451FOXR21
NM_001981EPS151
NM_152787MAP3K7IP31
NM_006416SLC35A11
NM_015071ARHGAP261
XM_938268TBX181
NM_001080508TBX181
NM_001040875GDAP11
NM_018972GDAP11
NM_203472SELS1
NM_024046CAMKV1
NM_018141MRPS101
NM_015555ZNF4511
NM_001031623ZNF4511
NM_016201AMOTL21
NM_022780RMND5A1
NM_004128GTF2F21
NM_001938DR11
NM_003107SOX41
XM_931945LOC6439621
XM_943665LOC6439621
NM_001042492NF11
NM_000267NF11
NM_207406CCDC41
NM_194282LIN541
NM_006534NCOA31
NM_181659NCOA31
NM_002670PLS11
NM_006832PLEKHC11
NM_080284ABCA61
XM_001130020KIAA11471
XM_001130081KIAA11471
NM_001080392KIAA11471
NM_022336EDAR1
NM_153711FAM26E1
NM_021994ZNF277P1
NM_018150C1orf1641
NM_153702ELMOD21
NM_017712PGPEP11
NM_182752FAM79A1
NM_001025108AFF31
NM_002285AFF31
NM_002544OMG1
NM_017945SLC35A51
NM_006154NEDD41
NM_198400NEDD41
XM_001132495SLC26A111
NM_173626SLC26A111
NM_015001SPEN1
NM_024692CLIP41
NM_001752CAT1
NM_0010994021
NM_003858CCNK1
NM_181846ZSCAN221
NM_178812MTDH1
NM_001079673FNDC3A1
NM_014923FNDC3A1
NM_003100SNX21
NM_018086FIGN1
NM_021158TRIB31
NM_002336LRP61
NM_004326BCL91
NM_145032FBXL131
NM_0011110381
NM_018191RCBTB11
NM_032165LRRIQ11
NM_015701C2orf301
NM_001127AP1B11
NM_145730AP1B11
NM_0010109061
NM_015323KIAA07761
XM_937397ANKRD311
XM_927671ANKRD311
NM_002607PDGFA1
NM_033023PDGFA1
NM_017549EPDR11
NM_0010996911
NM_003236TGFA1
NM_018471ZC3H151
NM_032342C9orf1251
NM_017420SIX41
NM_1829691
NM_173487C4orf331
NM_0010997831
NM_002203ITGA21
NM_013300C12orf241
NM_014864FAM20B1
NM_007347AP4E11
NM_007114TMF11
NM_004402DFFB1
NM_005829AP3S21
NM_004845PCYT1B1
XM_001134344FLJ374531
XM_942245FLJ327901
XM_926604FLJ327901
NM_015879ST8SIA31
NM_001003684UCRC1
NM_013387UCRC1
NM_004914RAB361
NM_001009959KIAA11891
NM_020711KIAA11891
NM_005989AKR1D11
NM_014325CORO1C1
NM_001025073C3orf171
NM_015412C3orf171
NM_001025072C3orf171
NM_018057SLC6A151
NM_015141GPD1L1
NM_025009CEP1351
NM_017737FNBP1L1
NM_198392TCF211
NM_021813BACH21
NM_207337AMN11
XM_001126195LOC7279421
NM_019018FAM105A1
NM_199072MDFIC1
NM_006785MALT11
NM_173844MALT11
NM_015553PIP3-E1
NM_016010C8orf701
NM_018312SAPS31
NM_002924RGS71
XM_376444LOC1334911
XM_941190LOC1334911
NM_000536RAG21
NM_018970GPR851
NM_025205MED281
NM_025057C14orf451
NM_198098AQP11
NM_018847KLHL91
NM_183078RNF81
NM_003958RNF81
NM_017644KLHL241
NM_001007559SS181
NM_005637SS181
NM_018362LIN7C1
NM_198066GNPNAT11
NM_007149ZNF1841
NM_152265BTF3L41
NM_018363C10orf591
NM_020774MIB11
NM_001010911C10orf1141
NM_007325GRIA31
NM_000828GRIA31
NM_0153511
NM_003772JRKL1
NM_032826SLC35B41
NM_004100EYA41
NM_172105EYA41
NM_172103EYA41
NM_178509STXBP41
NM_080283ABCA91
NM_019022TXNDC101
NM_024884L2HGDH1
NM_001080498EMR41
NM_001357DHX91
NM_018706DHTKD11
NM_006609MAP3K21
XM_001128799MAP3K21
NM_138369FAM44B1
NM_175856CHSY-21
NM_004521KIF5B1
NM_173463DKFZp761B1071
NM_1827627A51
NM_004232SOCS61
NM_014782ARMCX21
NM_177949ARMCX21
NM_005870SAP181
XM_001128149LOC7303161
XM_001129924LOC7293161
NM_172020POM1211
NM_0010994151
NM_005858AKAP81
NM_007373SHOC21
NM_017994C7orf421
NM_021814ELOVL51
NM_016235GPRC5B1
NM_032412C5orf321
NM_006495EVI2B1
NM_001012981ZKSCAN21
NM_000151G6PC1
NM_0150211
NM_152597FSIP11
NM_152281SCYL1BP11
NM_014153ZC3H7A1
NM_144778MBNL21
NM_207304MBNL21
NM_032351MRPL451
XM_001126219MRPL451
XM_929714LOC6467621
XM_938418LOC6467621
XM_935722LOC6467621
NM_016216DBR11
NM_002835PTPN121
NM_012319SLC39A61
NM_004925AQP31
NM_020752GPR1581
NM_001007027ALG81
NM_004681EIF1AY1
NM_018133MSL2L11
NM_012399PITPNB1
NM_020962NOPE1
NM_014331SLC7A111
NM_024989PGAP11
NM_0330261
NM_004171SLC1A21
NM_080821C20orf1081
NM_007006NUDT211
NM_004125LOC5528911
NM_001017998GNG101
NM_2073061
NM_022756C1orf1491
NM_020964KIAA16321
NM_177422EIF2C31
NM_024852EIF2C31
NM_021815SLC5A71
NM_0011110191
NM_145117NAV21
NM_182964NAV21
NM_0011110181
NM_004028AQP41
NM_001650AQP41
NM_0010096101
NM_198087ZNF2001
NM_198088ZNF2001
NM_003454ZNF2001
NM_0010994131
NM_0010994121
NM_006766MYST31
NM_019117KLHL41
NM_007157ZXDB1
NM_000133F91
NM_001013848EXOC61
NM_019053EXOC61
NM_176816CCDC1251
NM_198124CSMD31
NM_198123CSMD31
NM_052900CSMD31
NM_198836ACACA1
NM_198837ACACA1
NM_198834ACACA1
NM_198838ACACA1
NM_198839ACACA1
NM_198281GPRIN31
NM_144775SMCR81
NM_014417BBC31
NM_001081686G6PC21
NM_021176G6PC21
NM_013262MYLIP1
NM_001003800BICD21
NM_004124GMFB1
NM_005819STX61
NM_153427PITX21
NM_000325PITX21
NM_153426PITX21
NM_006981NR4A31
NM_173198NR4A31
NM_173200NR4A31
NM_000370TTPA1
NM_024496C14orf41
NM_000681ADRA2A1
NM_032172USP421
XM_001125730LOC7278321
XM_001129814LOC7292721
XM_496041LOC4402431
XM_001128563FLJ361311
NM_0010014131
XM_496037LOC4402331
XM_001134268LOC7300271
XM_208835LOC4403201
XM_928237LOC6452021
NM_030782CLPTM1L1
NM_031912SYT151
NM_203463LASS61
NM_033405PRIC2851
NM_001037335PRIC2851
NM_001077484SLC38A11
NM_030674SLC38A11
NM_053044HTRA31
NM_002345LUM1
NM_014733ZFYVE161
NM_0011052511
NM_139126PPIL41
NM_014423AFF41
NM_012307EPB41L31
NM_020728FAM62B1
NM_006951TAF51
NM_015313ARHGEF121
NM_002878RAD51L31
NM_133629RAD51L31
NM_183075CYP2U11
NM_017423GALNT71
NM_000791DHFR1
XM_942780SYNPO21
XM_001126326AGRIN1
NM_198576AGRN1
NM_014411NAG81
NM_152682RWDD4A1
NM_000442PECAM11
NM_004878PTGES1
NM_178136POLDIP31
NM_032311POLDIP31
NM_001024649CANX1
NM_001746CANX1
NM_024546C13orf71
NM_000444PHEX1
NM_178582HM131
NM_006476ATP5L1
NM_005414SKIL1
NM_001011551C1GALT1C11
NM_152692C1GALT1C11
NM_001042599ERBB41
NM_005235ERBB41
NM_024828C9orf821
NM_014763MRPL191
NM_003640IKBKAP1
NM_018298MCOLN31
NM_001271CHD21
NM_198401ANKRD461
NM_006045ATP9A1
NM_182487OLFML2A1
NM_152261C12orf231
NM_014631SH3PXD2A1
NM_001891CSN21
NM_006389HYOU11
NM_173545C2orf131
NM_015044GGA21
NM_006203PDE4D1
NM_0011046311
NM_022748TNS31
NM_005752CLEC3A1
NM_005177ATP6V0A11
NM_0011112831
NM_000618IGF11
NM_0011112841
NM_023076C16orf281
NM_001858COL19A11
NM_001077619LOC1378861
NM_013396USP251
NM_015447CAMSAP11
NM_001172ARG21
NM_1735691
NM_018650MARK11
NM_004796NRXN31
NM_0011052501
NM_138970NRXN31
NM_004728DDX211
NM_015040PIP5K31
NM_001008536TCHHL11
NM_006306SMC1A1
NM_002658PLAU1
NM_0010994321
NM_017679BCAS31
NM_020853KIAA14671
NM_004386NCAN1
NM_152275TTC30A1
XM_943522LOC4410051
XM_498961LOC4410051
NM_017691LRRC491
NM_199073C3orf601
NM_199070C3orf601
NM_199417C3orf601
NM_199074C3orf601
NM_199069C3orf601
NM_152233SNX61
NM_021249SNX61
NM_0010985251
NM_018204CKAP21
NM_032778MINA1
NM_153182MINA1
NM_001042533MINA1
NM_003270TSPAN61
NM_006052DSCR31
NM_006700TRAFD11
NM_004417DUSP11
NM_001042383CEP631
NM_001042400CEP631
NM_025180CEP631
NM_004132HABP21
NM_022831C1orf801
NM_177452TRAPPC6B1
NM_001079537TRAPPC6B1
NM_001012418LOC3401561
NM_001987ETV61
NM_012463ATP6V0A21
NM_015387PREI31
NM_199482PREI31
NM_0011008191
NM_032268ZNRF11
NM_173469UBE2Q21
NM_152753SCUBE31
NM_176792MRPL431
NM_004653JARID1D1
NM_006713SUB11
NM_004709CXorf11
NM_018181ZNF5321
NM_001009934DNASE1L11
NM_001009932DNASE1L11
NM_006730DNASE1L11
NM_001009933DNASE1L11
NM_006493CLN51
NM_001009909LUZP21
NM_153183NUDT101
NM_005725TSPAN21
NM_133482RAD501
NM_005732RAD501
NM_006843SDS1
NM_001949E2F31
NM_012223MYO1B1
NM_000647CCR21
XM_001133430LOC7292301
NM_052913KIAA19131
NM_194442LBR1
NM_002296LBR1
NM_000202IDS1
NM_014663JMJD2A1
NM_000965RARB1
NM_016152RARB1
NM_018419SOX181
NM_032932RAB11FIP41
NM_033224PURB1
NM_003453ZMYM21
NM_197968ZMYM21
NM_006763BTG21
NM_007027TOPBP11
NM_144590ANKRD221
NM_000719CACNA1C1
NM_144722FLJ235771
NM_001338CXADR1
XM_001134421C1orf1521
XM_035299ZSWIM61
XM_936273ZSWIM61
NM_020453ATP10D1
NM_018638ETNK11
NM_005399PRKAB21
NM_0011045861
NM_024744ALS2CR81
NM_014028OSTM11
NM_014682ST181
NM_001040214TCBA11
NM_017646TRIT11
NM_021818SAV11
NM_001025249DUT1
NM_001025248DUT1
NM_001948DUT1
NM_017637BNC21
NM_001080421UNC13A1
NM_178586PPP2R5C1
NM_002719PPP2R5C1
NM_022351EFCBP11
NM_021217ZNF771
NM_001024843TNRC6B1
NM_015088TNRC6B1
NM_013943CLIC41
NM_017966VPS37C1
NM_173156SMG71
NM_201569SMG71
NM_201568SMG71
NM_000916OXTR1
NM_005137DGCR21
NM_003615SLC4A71
NM_007068DMC11
NM_020405PLXDC11
NM_003559PIP5K2B1
NM_015247CYLD1
NM_001042412CYLD1
NM_001042355CYLD1
NM_005226EDG31
NM_001048209HNT1
NM_016522HNT1
NM_002806PSMC61
NM_001008539SLC7A21
NM_003046SLC7A21
NM_080874ASB51
NM_198474OLFML11
NM_024721ZFHX41
NM_001032283TMPO1
NM_001032284TMPO1
NM_002716PPP2R1B1
NM_002526NT5E1
NM_005168RND31
NM_006987RPH3AL1
NM_015154MESDC21
NM_001033910TRAF51
NM_145759TRAF51
NM_004619TRAF51
NM_014982PCNX1
NM_152527SLC16A141
NM_203301FBXO331
NM_003948CDKL21
NM_015194MYO1D1
NM_021067GINS11
NM_015137KIAA01431
NM_198715PTGER31
NM_000046ARSB1
NM_000780CYP7A11
NM_0010854001
NM_000235LIPA1
NM_001332CTNND21
NM_015236LPHN31
NM_172193KLHDC11
NM_001007229SPOP1
NM_001007230SPOP1
NM_001007226SPOP1
NM_003563SPOP1
NM_001007228SPOP1
NM_001007227SPOP1
NM_001745CAMLG1
NM_001003760KLHL311
NM_005100AKAP121
NM_144497AKAP121
XM_001131161HEATR21
NM_017802HEATR21
NM_138727ST7L1
NM_138728ST7L1
NM_017744ST7L1
NM_004136IREB21
NM_020661AICDA1
NM_033631LUZP11
NM_022918TMEM1351
NM_000800FGF11
NM_033137FGF11
NM_033136FGF11
XM_942502LOC6427571
XM_926793LOC6427571
NM_014256B3GNT31
XM_001126144LOC7305101
NM_203329CD591
NM_203331CD591
NM_203330CD591
NM_000611CD591
NM_024817THSD41
NM_006420ARFGEF21
XM_934514LOC6447141
XM_945782LOC6447141
NM_032291SGIP11
NM_020466LYRM21
NM_001042493C6orf1621
NM_020425C6orf1621
NM_001080975REPS21
NM_004726REPS21
NM_144980C6orf1181
NM_006722MITF1
NM_000248MITF1
NM_198158MITF1
NM_198177MITF1
NM_198178MITF1
NM_198159MITF1
NM_001713BHMT1
NM_001033723ZNF7041
NM_031296RAB33B1
NM_002507NGFR1
NM_206595ESRRG1
NM_001438ESRRG1
NM_206594ESRRG1
NM_024665TBL1XR11
NM_006031PCNT1
NM_145865ANKS4B1
NM_002844PTPRK1
NM_002822TWF11
NM_021239RBM251
NM_002874RAD23B1
NM_033285TP53INP11
NM_006469IVNS1ABP1
NM_153262SYT141
NM_001014372SYT14L1
NM_173826C3orf231
NM_024628SLC12A81
NM_004788UBE4A1
NM_177538CYP20A11
NM_0208401
NM_003110SP21
XM_938689KIAA16711
XM_371461KIAA16711
XM_001128377LOC7287551
XM_001131475LOC7319781
NM_015394ZNF101
NM_024638QTRTD11
NM_0010996791
NM_012210TRIM321
NM_006581FUT91
NM_003014SFRP41
NM_005188CBL1
XM_001133189INPP5A1
NM_005539INPP5A1
NM_000277PAH1
NM_006352ZNF2381
NM_205768ZNF2381
NM_016952CDON1
NM_139177SLC39A111
NM_022899ACTR81
NM_004279PMPCB1
NM_002877RAD51L11
NM_003883HDAC31
NM_015176FBXO281
NM_001881CREM1
NM_022828YTHDC21
NM_032047B3GNT51
NM_006642SDCCAG81
NM_003192TBCC1
NM_018048FLJ102921
NM_078469BCCIP1
NM_173562KCTD201
NM_173512FLJ398221
NM_033656BRWD11
NM_032199ARID5B1
NM_024611NARG21
NM_001018089NARG21
NM_018945PDE7B1
NM_007038ADAMTS51
NM_198261RSRC21
NM_198262RSRC21
NM_023012RSRC21
NM_012175FBXO31
NM_020748INTS21
NM_001042646TRAK11
NM_0010839081
NM_018139C14orf1041
NM_181705LYRM71
NM_023074ZNF6491
NM_001082534CA101
NM_020178CA101
NM_001082533CA101
NM_014299BRD41
NM_032458PHF61
NM_001015877PHF61
NM_007214SEC631
XM_001134327LOC7323241
XM_001134208LOC7299751
NM_194247HNRPA31
NM_020456C13orf11
NM_012316KPNA61
NM_016027LACTB21
NM_004583RAB5C1
NM_201434RAB5C1
NM_025164KIAA09991
XM_373553LOC3878951
XM_945559LOC3878951
NM_000813GABRB21
NM_021911GABRB21
NM_018696ELAC11
NM_213589RAPH11
NM_001077528FBXO431
NM_001029860FBXO431
NM_017437CPSF21
NM_0207331
NM_022490POLR1E1
NM_0010982721
NM_002130HMGCS11
NM_014883FAM13A11
NM_001015045FAM13A11
NM_014178STXBP61
XM_001128291PARP81
NM_014911AAK11
NM_001002255SUMO41
NM_006937SUMO21
NM_001005849SUMO21
NM_004481GALNT21
NM_182972IRF2BP21
NM_001077397IRF2BP21
NM_020801ARRDC31
NM_002168IDH21
NM_004593SFRS101
NM_005826HNRPR1
NM_0011023981
NM_0011023971
NM_0011023991
NM_015431TRIM581
NM_024311MFSD111
NM_014805EPM2AIP11
NM_020440PTGFRN1
NM_012193FZD41
NM_016143NSFL1C1
NM_182483NSFL1C1
NM_018839NSFL1C1
NM_018351FGD61
NM_173801PLAC1L1
NM_017956TRMT121
NM_006914RORB1
NM_002859PXN1
NM_173654C3orf641
NM_003358UGCG1
XM_037557KIAA09841
XM_939476KIAA09841
NM_000990RPL27A1
NM_0010087811
XM_936538FAT31
XM_926199FAT31
NM_181335ARHGAP81
NM_181334LOC5531581
NM_001017526ARHGAP81
NM_152269C12orf651
NM_144996ARL13B1
NM_182896ARL13B1
NM_0010985001
NM_019590KIAA12171
NM_0010985011
NM_006214PHYH1
NM_001037537PHYH1
NM_080742B3GAT21
NM_181655C17orf581
NM_181656C17orf581
NM_003468FZD51
NM_014302SEC61G1
NM_001012456SEC61G1
NM_003498SNN1
NM_002518NPAS21
NM_152754SEMA3D1
NM_005121THRAP11
NM_020933ZNF3171
NM_005779LHFPL21
NM_032933C18orf451
NM_007057ZWINT1
NM_032997ZWINT1
NM_001005413ZWINT1
NM_0011055731
NM_001329CTBP21
NM_0010839141
NM_022802CTBP21
NM_002787PSMA21
NM_001040665STEAP21
NM_152999STEAP21
NM_004522KIF5C1
XM_373030LOC2855561
XM_939505LOC2855561
NM_001004317LIN28B1
NM_152522ARL6IP61
NM_173602DIP2B1
NM_004094EIF2S11
NM_021205RHOU1
NM_014382ATP2C11
NM_016848SHC31
NM_004755RPS6KA51
XM_001125791LOC6427881
XM_001127886LOC7281001
NM_014429MORC11
NM_003157NEK41
XM_944246LOC6486951
XM_931860LOC6429541
NM_005610RBBP41
NM_002748MAPK61
NM_178127ANGPTL51
NM_006243PPP2R5A1
NM_003262TLOC11
NM_001029884PLEKHG11
NM_153256C10orf471
NM_005842SPRY21
NM_014732KIAA05131
NM_001018053PFKFB21
NM_003101SOAT11
NM_005966NAB11
NM_023927GRAMD31
NM_177424STX121
NM_013412RABL2A1
NM_007082RABL2A1
NM_007081RABL2B1
NM_001003789RABL2B1
NM_002017FLI11
NM_001040441ZBTB81
XM_001124597LOC7304111
NM_006315PCGF31
NM_018659CYTL11
NM_014615KIAA01821
NM_001006600ERBB2IP1
NM_018695ERBB2IP1
NM_007173PRSS231
NM_152399TMEM1551
NM_001077203SENP71
NM_020654SENP71
NM_022153C10orf541
NM_002024FMR11
NM_173468MOBKL1A1
NM_032276RHBDD11
NM_030579CYB5B1
NM_004791ITGBL11
NM_006212PFKFB21
NM_177924ASAH11
NM_004315ASAH11
NM_015035ZHX31
NM_030799YIPF51
NM_002535OAS21
NM_015885PCF111
NM_020144PAPOLB1
NM_000378WT11
NM_024424WT11
NM_024425WT11
NM_024426WT11
NM_002356MARCKS1
NM_205848SYT61
NM_020193C11orf301
NM_020755SERINC11
NM_153488MAGEA2B1
NM_175743MAGEA21
NM_175742MAGEA21
NM_005361MAGEA21
NM_003847PEX11A1
NM_006287TFPI1
NM_001009554MFAP3L1
NM_021647MFAP3L1
NM_006575MAP4K51
NM_198794MAP4K51
NM_004586RPS6KA31
NM_173582PGM2L11
NM_005222DLX61
NM_015046SETX1
NM_032490C14orf1421
NM_001037631CTLA41
NM_005214CTLA41
NM_014216ITPK11
NM_002845PTPRM1
NM_0011052441
NM_017896C20orf111
NM_015349KIAA02401
NM_005460SNCAIP1
NM_138786TM4SF181
NM_0010994071
NM_173354SNF1LK1
NM_203462MRFAP1L11
NM_152301MRFAP1L11
NM_000844GRM71
NM_181874GRM71
XM_928871LOC6440381
XM_926379LOC4408391
XM_001128517LOC7286011
XM_001125884LOC7278361
XM_926363LOC6423131
NM_001039591USP9X1
NM_001039590USP9X1
NM_144508CASC51
NM_170589CASC51
XM_943193LOC4000271
XM_931434LOC4000271
NM_001432EREG1
NM_001017371SP31
NM_003111SP31
NM_005898CAPRIN11
NM_020348CNNM11
NM_002242KCNJ131
NM_020432PHTF21
NM_002809PSMD31
NM_004264SURB71
NM_001014283DCUN1D21
NM_203327SLC23A21
NM_005116SLC23A21
NM_152641ARID21
NM_199328CLDN81
NM_005590MRE11A1
NM_005591MRE11A1
NM_001448GPC41
NM_002229JUNB1
NM_001031804MAF1
XM_944031LOC6442481
XM_932073LOC6442481
NM_001039659IL18BP1
NM_001039660IL18BP1
NM_173042IL18BP1
NM_015355SUZ121
NM_006526ZNF2171
NM_032946NXF51

Immunostimulatory motif search results


UGUGU - Judge et al. Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA. Nat Biotechnol. 2005 Apr;23(4):457-62. (PMID: 15778705)
No Immunostimulatory motif found (UGUGU).

GUCCUUCAA - Hornung et al. Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7. Nat Med. 2005 Mar;11(3):263-70. Epub 2005 Feb 20. (PMID: 15723075)
No Immunostimulatory motif found (GUCCUUCAA).



Settings used for search

Scores were calculated using scoring scheme SS1
Using AVG scoring mode.

Hit scores

ParameterSpec. Score cut-offColourComment
Hit to same geneColourHits to the same accession or genes with 100 percent identity (i.e. likely transcript variants). It is advisable to always check the genes hit.
High scoring hit≥80ColourHits are very likely to cause an off-target effect
Medium scoring hit<80¸≥40ColourHits with a small chance of causing an off target effect.
Low scoring hitColourHits very unlikely to cause an off-target effect

The mismatches are colour coded based on the weighting of that position.

Cut-offColour
MatchColour
Wobble base pairs (G-U)Colour
Critical bases (none)Colour
0.6 bitsColour
0.4 bitsColour
0.2 bitsColour

About SpecificityServer

SpecificityServer is designed to help you identify potential non-specific matches to your siRNA. It incorporates the latest information about non-specific matches (sequence-specific only).

Designed by: Alistair Chalk, Quan Du, Zicai Liang and Erik L.L. Sonnhammer


For more details about the algorithm "siRNA specificity searching incorporating mismatch tolerance data" Bioinformatics (2008) 24 (10): 1316-1317