Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 3C Pro are 2
Results from 0 - 25
siRNA sequence "agcuacuuugcgaguaugcaaggugagau" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agcuacuuugcgaguaugcaaggugagau" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1780 " record
Length: 29
GC Content:45 %
Starting position: 5919
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48
Length: 29
GC Content:45 %
Starting position: 5919
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48
Offtargets for "agcuacuuugcgaguaugcaaggugagau" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836
siRNA sequence "cuacuuugcgaguaugca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "cuacuuugcgaguaugca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1784 " record
Length: 18
GC Content:44 %
Starting position: 5918
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 18
GC Content:44 %
Starting position: 5918
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cuacuuugcgaguaugca" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1780 | agcuacuuugcgaguaugcaaggugagau | Enterovirus [EV] |  SL | refseqs |  | |||||
| virsi1784 | cuacuuugcgaguaugca | Enterovirus [EV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm