Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for E6 / E7 are 7
Results from 0 - 25
siRNA sequence "gggaauccauaugcuguaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggaauccauaugcuguaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1705 " record
Length: 21
GC Content:43 %
Starting position: 272
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:43 %
Starting position: 272
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "gggaauccauaugcuguaugu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
siRNA sequence "aauguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aauguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1707 " record
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "aauguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
siRNA sequence "ggacagagcccauuacaauau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggacagagcccauuacaauau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1708 " record
Length: 21
GC Content:43 %
Starting position: 702
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:43 %
Starting position: 702
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "ggacagagcccauuacaauau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1709 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
siRNA sequence "uaaccuguguauauugcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2352 " record
Length: 19
GC Content:32 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine
Length: 19
GC Content:32 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine
Offtargets for "uaaccuguguauauugcaa" siRNA in Human Genome sequences
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:
siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1706 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448
siRNA sequence "acccuacaagcuaccugau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acccuacaagcuaccugau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1719 " record
Length: 19
GC Content:47 %
Starting position: 134
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Surefector
Incubation Time (Hours):36
Length: 19
GC Content:47 %
Starting position: 134
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Surefector
Incubation Time (Hours):36
Offtargets for "acccuacaagcuaccugau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16865269
Article:Intratumor injection of small interfering RNA-targeting human papillomavirus 18 E6 and E7 successfully inhibits the growth of cervical cancer.
Authors:Fujii T, Saito M, Iwasaki E, Ochiya T, Takei Y, Hayashi S, Ono A, Hirao N, Nakamura M, Kubushiro K, Tsukazaki K, Aoki D.
Journal:Int J Oncol. 2006 Sep;29(3):541-8.
Entrez:16865269
Article:Intratumor injection of small interfering RNA-targeting human papillomavirus 18 E6 and E7 successfully inhibits the growth of cervical cancer.
Authors:Fujii T, Saito M, Iwasaki E, Ochiya T, Takei Y, Hayashi S, Ono A, Hirao N, Nakamura M, Kubushiro K, Tsukazaki K, Aoki D.
Journal:Int J Oncol. 2006 Sep;29(3):541-8.
Entrez:16865269
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1705 | gggaauccauaugcuguaugu | Human Papillomavirus [HPV] |  SL | refseqs |  | |||||
| virsi1707 | aauguguguacugcaagcaac | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1708 | ggacagagcccauuacaauau | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1709 | gcccauuacaauauuguaacc | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi2352 | uaaccuguguauauugcaa | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1706 | ggucgauguaugucuuguugc | Human Papillomavirus [HPV] | SL | refseqs |  | |||||
| virsi1719 | acccuacaagcuaccugau | Human Papillomavirus [HPV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm