Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for P/X are 3
Results from 0 - 25
siRNA sequence "ugugcacuucgcuucaccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ugugcacuucgcuucaccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1040 " record
Length: 19
GC Content:53 %
Starting position: 1580
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:53 %
Starting position: 1580
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ugugcacuucgcuucaccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868
siRNA sequence "gauccugcgcgggacguccuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gauccugcgcgggacguccuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1476 " record
Length: 21
GC Content:67 %
Starting position: 1403
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Length: 21
GC Content:67 %
Starting position: 1403
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Offtargets for "gauccugcgcgggacguccuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
siRNA sequence "gcacuucgcuucaccucugcacgu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucugcacgu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1479 " record
Length: 24
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Length: 24
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Offtargets for "gcacuucgcuucaccucugcacgu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1040 | ugugcacuucgcuucaccu | Hepatitis B Virus [HBV] |  SL | refseqs |  | |||||
| virsi1476 | gauccugcgcgggacguccuu | Hepatitis B Virus [HBV] | SL | refseqs |  | |||||
| virsi1479 | gcacuucgcuucaccucugcacgu | Hepatitis B Virus [HBV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm