VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for U51 are 4
Results from 0 - 25

siRNA sequence "gaauacgcuguguuuacau" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1912 " record
Length: 19
GC Content:37 %
Starting position: 83777
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gaauacgcuguguuuacau" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "auagcgcaucugccgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1913 " record
Length: 19
GC Content:53 %
Starting position: 84287
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "auagcgcaucugccgaaag" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "gucggucgagaauacgcugug" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1911 " record
Length: 21
GC Content:57 %
Starting position: 83768
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gucggucgagaauacgcugug" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "guaucuggcuggucaauuu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1914 " record
Length: 19
GC Content:42 %
Starting position: 84453
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "guaucuggcuggucaauuu" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1912	gaauacgcuguguuuacau	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1913	auagcgcaucugccgaaag	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1911	gucggucgagaauacgcugug	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	80	16140767	Blast SL	refseqs
virsi1914	guaucuggcuggucaauuu	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	80	16140767	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm