Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for ZNP are 2
Results from 0 - 25
| VIRsiRNAid | siRNA Sequence | PMID | Offtarget | Align With | ALIGN0 Result | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1925 | ggcaucagugugcucaguuga | Ebolavirus [EBOV] | SL | refseqs |      ![]() | |||||
| virsi1924 | ggcaucagugugcucaguuga | Ebolavirus [EBOV] | SL | refseqs |      ![]() |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm



