Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 15613331 are 1
Results from 0 - 25
siRNA sequence "gugcgauccagauuuguuuug" alignment with "Polio Virus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Polio Virus" virus
Browse "virsi3002 " record
Length: 21
GC Content:43 %
Starting position: 2417
GenBank Acc: FJ769385
Transfection Reagent: Lipofectamine 2000
Length: 21
GC Content:43 %
Starting position: 2417
GenBank Acc: FJ769385
Transfection Reagent: Lipofectamine 2000
Offtargets for "gugcgauccagauuuguuuug" siRNA in Human Genome sequences
See FJ769385 at Genbank
Pubmed:15613331
Article:Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches.
Authors:Gitlin L, Stone JK, Andino R.
Journal:J Virol. 2005 Jan;79(2):1027-35.
Entrez:15613331
Article:Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches.
Authors:Gitlin L, Stone JK, Andino R.
Journal:J Virol. 2005 Jan;79(2):1027-35.
Entrez:15613331
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi3002 | gugcgauccagauuuguuuug | Polio Virus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm