Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 17636212 are 2
Results from 0 - 25
siRNA sequence "cacuucacugcaagacaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacuucacugcaagacaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1710 " record
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "cacuucacugcaagacaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
siRNA sequence "ccaccaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaccaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1711 " record
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "ccaccaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1710 | cacuucacugcaagacaua | Human Papillomavirus [HPV] |  SL | refseqs |  | |||||
| virsi1711 | ccaccaacgucacacaaugu | Human Papillomavirus [HPV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm