Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1018 are 1
Results from 0 - 25
siRNA sequence "aacacuuccggaaacuacugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacacuuccggaaacuacugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1018 " record
Length: 21
GC Content:43 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Length: 21
GC Content:43 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Offtargets for "aacacuuccggaaacuacugu" siRNA in Human Genome sequences
Pubmed:17300745
Article:Inhibition of Hepatitis B virus cccDNA replication by siRNA.
Authors:Li GQ, Gu HX, Li D, Xu WZ.
Journal:Biochem Biophys Res Commun. 2007 Apr 6;355(2):404-8. Epub 2007 Feb 6.
Entrez:17300745
Article:Inhibition of Hepatitis B virus cccDNA replication by siRNA.
Authors:Li GQ, Gu HX, Li D, Xu WZ.
Journal:Biochem Biophys Res Commun. 2007 Apr 6;355(2):404-8. Epub 2007 Feb 6.
Entrez:17300745
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1018 | aacacuuccggaaacuacugu | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm