Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1183 are 1
Results from 0 - 25
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
Pubmed:16872906
Article:Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes.
Authors:Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ.
Journal:Mol Ther. 2006 Oct;14(4):485-93. Epub 2006 Jul 26.
Entrez:16872906
Article:Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes.
Authors:Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ.
Journal:Mol Ther. 2006 Oct;14(4):485-93. Epub 2006 Jul 26.
Entrez:16872906
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1183 | gacacugagacaccaauugac | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm