Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1186 are 1
Results from 0 - 25
siRNA sequence "aaaggccuugugguacugccu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aaaggccuugugguacugccu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1186 " record
Length: 21
GC Content:52 %
Starting position: 274
Strain of Virus: Genotype 2a
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 274
Strain of Virus: Genotype 2a
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "aaaggccuugugguacugccu" siRNA in Human Genome sequences
Pubmed:17079316
Article:Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect.
Authors:Kanda T, Steele R, Ray R, Ray RB.
Journal:J Virol. 2007 Jan;81(2):669-76. Epub 2006 Nov 1.
Entrez:17079316
Article:Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect.
Authors:Kanda T, Steele R, Ray R, Ray RB.
Journal:J Virol. 2007 Jan;81(2):669-76. Epub 2006 Nov 1.
Entrez:17079316
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1186 | aaaggccuugugguacugccu | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm