Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1298 are 1
Results from 0 - 25
siRNA sequence "aacuccuggaacaauggaacc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aacuccuggaacaauggaacc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1298 " record
Length: 21
GC Content:48 %
Starting position: 26423
Strain of Virus: CUHK-W1
GenBank Acc: AY278554
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 26423
Strain of Virus: CUHK-W1
GenBank Acc: AY278554
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aacuccuggaacaauggaacc" siRNA in Human Genome sequences
See AY278554 at Genbank
Pubmed:17590445
Article:siRNAs targeting terminal sequences of the SARS-associated coronavirus membrane gene inhibit M protein expression through degradation of M mRNA.
Authors:Qin ZL, Zhao P, Cao MM, Qi ZT.
Journal:J Virol Methods. 2007 Nov;145(2):146-54. Epub 2007 Jun 27.
Entrez:17590445
Article:siRNAs targeting terminal sequences of the SARS-associated coronavirus membrane gene inhibit M protein expression through degradation of M mRNA.
Authors:Qin ZL, Zhao P, Cao MM, Qi ZT.
Journal:J Virol Methods. 2007 Nov;145(2):146-54. Epub 2007 Jun 27.
Entrez:17590445
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1298 | aacuccuggaacaauggaacc | SARS Coronavirus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm