Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1416 are 1
Results from 0 - 25
siRNA sequence "aaauuuggagaguggcaggugg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaauuuggagaguggcaggugg" La Crosse Virus" Virus reference Genome sequences

Browse all the records for "La Crosse Virus" virus
Browse "virsi1416 " record
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aaauuuggagaguggcaggugg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1416 | aaauuuggagaguggcaggugg | La Crosse Virus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm