Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1442 are 1
Results from 0 - 25
siRNA sequence "cgaccgaccuugaggcauacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccgaccuugaggcauacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1442 " record
Length: 21
GC Content:57 %
Starting position: 1689
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120
Length: 21
GC Content:57 %
Starting position: 1689
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120
Offtargets for "cgaccgaccuugaggcauacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1442 | cgaccgaccuugaggcauacu | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm