Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1455 are 1
Results from 0 - 25
siRNA sequence "ggacauugacccguauaaagac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggacauugacccguauaaagac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1455 " record
Length: 22
GC Content:45 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168
Length: 22
GC Content:45 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168
Offtargets for "ggacauugacccguauaaagac" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1455 | ggacauugacccguauaaagac | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm