Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1472 are 1
Results from 0 - 25
siRNA sequence "uggccaaaauucgcaguccccaacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uggccaaaauucgcaguccccaacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Offtargets for "uggccaaaauucgcaguccccaacc" siRNA in Human Genome sequences
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1472 | uggccaaaauucgcaguccccaacc | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm