Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1480 are 1
Results from 0 - 25
| VIRsiRNAid | siRNA Sequence | PMID | Offtarget | Align With | ALIGN0 Result | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1480 | gccgagaucgcacagagacuu | Influenza A Virus | SL | refseqs |      ![]() |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm

