Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1480 are 1
Results from 0 - 25
siRNA sequence "gccgagaucgcacagagacuu" alignment with "Influenza A Virus" virus reference Genome sequences
siRNA sequence matching with "gccgagaucgcacagagacuu" Influenza A Virus" Virus reference Genome sequences
Browse all the records for "Influenza A Virus" virus
Browse "virsi1480 " record
Length: 21
GC Content:57 %
Starting position: 89
Strain of Virus: H1N1
GenBank Acc: L25818
Transfection Reagent: Lipofectamine
Incubation Time (Hours):13
Length: 21
GC Content:57 %
Starting position: 89
Strain of Virus: H1N1
GenBank Acc: L25818
Transfection Reagent: Lipofectamine
Incubation Time (Hours):13
Offtargets for "gccgagaucgcacagagacuu" siRNA in Human Genome sequences
See L25818 at Genbank
Pubmed:15218172
Article:Inhibition of influenza virus matrix (M1) protein expression and virus replication by U6 promoter-driven and lentivirus-mediated delivery of siRNA.
Authors:Hui EK, Yap EM, An DS, Chen IS, Nayak DP.
Journal:J Gen Virol. 2004 Jul;85(Pt 7):1877-84.
Entrez:15218172
Article:Inhibition of influenza virus matrix (M1) protein expression and virus replication by U6 promoter-driven and lentivirus-mediated delivery of siRNA.
Authors:Hui EK, Yap EM, An DS, Chen IS, Nayak DP.
Journal:J Gen Virol. 2004 Jul;85(Pt 7):1877-84.
Entrez:15218172
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1480 | gccgagaucgcacagagacuu | Influenza A Virus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm