Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1496 are 1
Results from 0 - 25
siRNA sequence "gcuuaagagggagauaacauu" alignment with "Influenza A Virus" virus reference Genome sequences
siRNA sequence matching with "gcuuaagagggagauaacauu" Influenza A Virus" Virus reference Genome sequences

Browse all the records for "Influenza A Virus" virus
Browse "virsi1496 " record
Length: 21
GC Content:38 %
Starting position: 331
Strain of Virus: H1N1
GenBank Acc: L25818
Transfection Reagent: Lipofectamine
Incubation Time (Hours):10
Length: 21
GC Content:38 %
Starting position: 331
Strain of Virus: H1N1
GenBank Acc: L25818
Transfection Reagent: Lipofectamine
Incubation Time (Hours):10
Offtargets for "gcuuaagagggagauaacauu" siRNA in Human Genome sequences
See L25818 at Genbank
Pubmed:15218172
Article:Inhibition of influenza virus matrix (M1) protein expression and virus replication by U6 promoter-driven and lentivirus-mediated delivery of siRNA.
Authors:Hui EK, Yap EM, An DS, Chen IS, Nayak DP.
Journal:J Gen Virol. 2004 Jul;85(Pt 7):1877-84.
Entrez:15218172
Article:Inhibition of influenza virus matrix (M1) protein expression and virus replication by U6 promoter-driven and lentivirus-mediated delivery of siRNA.
Authors:Hui EK, Yap EM, An DS, Chen IS, Nayak DP.
Journal:J Gen Virol. 2004 Jul;85(Pt 7):1877-84.
Entrez:15218172
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1496 | gcuuaagagggagauaacauu | Influenza A Virus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm