Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1711 are 1
Results from 0 - 25
siRNA sequence "ccaccaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaccaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences

Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1711 " record
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "ccaccaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1711 | ccaccaacgucacacaaugu | Human Papillomavirus [HPV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm