Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1769 are 1
Results from 0 - 25
siRNA sequence "guaaccgaaaucgguugaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "guaaccgaaaucgguugaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1769 " record
Length: 21
GC Content:48 %
Starting position: 32
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Codebreaker
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 32
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Codebreaker
Incubation Time (Hours):48
Offtargets for "guaaccgaaaucgguugaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19826423
Article:Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells.
Authors:Hong D, Lu W, Ye F, Hu Y, Xie X.
Journal:Br J Cancer. 2009 Nov 17;101(10):1798-804. Epub 2009 Oct 13.
Entrez:19826423
Article:Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells.
Authors:Hong D, Lu W, Ye F, Hu Y, Xie X.
Journal:Br J Cancer. 2009 Nov 17;101(10):1798-804. Epub 2009 Oct 13.
Entrez:19826423
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1769 | guaaccgaaaucgguugaacc | Human Papillomavirus [HPV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm