Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1781 are 1
Results from 0 - 25
siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences

Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1781 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48
Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1781 | agaaauuggcucgaauuguuuuaauauua | Enterovirus [EV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm