Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1844 are 1
Results from 0 - 25
siRNA sequence "aaggugugagcauggugucau" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "aaggugugagcauggugucau" Human Coxsackievirus [CV]" Virus reference Genome sequences

Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1844 " record
Length: 21
GC Content:48 %
Starting position: 3636
Strain of Virus: B3
GenBank Acc: M33854
Transfection Reagent: Oligofectamine
Incubation Time (Hours):12
Length: 21
GC Content:48 %
Starting position: 3636
Strain of Virus: B3
GenBank Acc: M33854
Transfection Reagent: Oligofectamine
Incubation Time (Hours):12
Offtargets for "aaggugugagcauggugucau" siRNA in Human Genome sequences
See M33854 at Genbank
Pubmed:15795330
Article:Targeting 2A protease by RNA interference attenuates coxsackieviral cytopathogenicity and promotes survival in highly susceptible mice.
Authors:Merl S, Michaelis C, Jaschke B, Vorpahl M, Seidl S, Wessely R.
Journal:Circulation. 2005 Apr 5;111(13):1583-92. Epub 2005 Mar 28.
Entrez:15795330
Article:Targeting 2A protease by RNA interference attenuates coxsackieviral cytopathogenicity and promotes survival in highly susceptible mice.
Authors:Merl S, Michaelis C, Jaschke B, Vorpahl M, Seidl S, Wessely R.
Journal:Circulation. 2005 Apr 5;111(13):1583-92. Epub 2005 Mar 28.
Entrez:15795330
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1844 | aaggugugagcauggugucau | Human Coxsackievirus [CV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm