Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1869 are 1
Results from 0 - 25
siRNA sequence "ccgggagcgauagagcagggccccg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccgggagcgauagagcagggccccg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1869 " record
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ccgggagcgauagagcagggccccg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1869 | ccgggagcgauagagcagggccccg | Epstein-Barr Virus [EBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm