Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1918 are 1
Results from 0 - 25
siRNA sequence "guguggguugagguaugaacacg" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1918 " record
Length: 23
GC Content:52 %
Starting position: 122857
Strain of Virus: HHV-8
GenBank Acc: AF148805
Incubation Time (Hours):72
Length: 23
GC Content:52 %
Starting position: 122857
Strain of Virus: HHV-8
GenBank Acc: AF148805
Incubation Time (Hours):72
Offtargets for "guguggguugagguaugaacacg" siRNA in Human Genome sequences
See AF148805 at Genbank
Pubmed:15190178
Article:Activation of alternative NF-kappa B pathway by human herpes virus 8-encoded Fas-associated death domain-like IL-1 beta-converting enzyme inhibitory protein (vFLIP).
Authors:Matta H, Chaudhary PM.
Journal:Proc Natl Acad Sci U S A. 2004 Jun 22;101(25):9399-404. Epub 2004 Jun 9.
Entrez:15190178
Article:Activation of alternative NF-kappa B pathway by human herpes virus 8-encoded Fas-associated death domain-like IL-1 beta-converting enzyme inhibitory protein (vFLIP).
Authors:Matta H, Chaudhary PM.
Journal:Proc Natl Acad Sci U S A. 2004 Jun 22;101(25):9399-404. Epub 2004 Jun 9.
Entrez:15190178
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1918 | guguggguugagguaugaacacg | Herpes Simplex Virus [HSV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm