Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1952 are 1
Results from 0 - 25
siRNA sequence "agucuagacucgugguggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agucuagacucgugguggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1952 " record
Length: 21
GC Content:52 %
Starting position: 91
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Length: 21
GC Content:52 %
Starting position: 91
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96
Offtargets for "agucuagacucgugguggacu" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1952 | agucuagacucgugguggacu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm