Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1982 are 1
Results from 0 - 25
siRNA sequence "ucacccaaauguacaccaaug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ucacccaaauguacaccaaug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1982 " record
Length: 21
GC Content:43 %
Starting position: 2027
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 2027
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ucacccaaauguacaccaaug" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1982 | ucacccaaauguacaccaaug | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm