Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1991 are 1
Results from 0 - 25
siRNA sequence "ggagcuucugcugauucaacu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ggagcuucugcugauucaacu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1991 " record
Length: 21
GC Content:48 %
Starting position: 1240
Strain of Virus: HKU-39849
GenBank Acc: AY278491
Transfection Reagent: Profectin
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 1240
Strain of Virus: HKU-39849
GenBank Acc: AY278491
Transfection Reagent: Profectin
Incubation Time (Hours):48
Offtargets for "ggagcuucugcugauucaacu" siRNA in Human Genome sequences
See AY278491 at Genbank
Pubmed:21317844
Article:Identification and characterization of three novel small interference RNAs that effectively down-regulate the isolated nucleocapsid gene expression of SARS coronavirus.
Authors:Cao YL, Wang Y, Guo R, Yang F, Zhang Y, Wang SH, Liu L.
Journal:Molecules. 2011 Feb 11;16(2):1544-58.
Entrez:21317844
Article:Identification and characterization of three novel small interference RNAs that effectively down-regulate the isolated nucleocapsid gene expression of SARS coronavirus.
Authors:Cao YL, Wang Y, Guo R, Yang F, Zhang Y, Wang SH, Liu L.
Journal:Molecules. 2011 Feb 11;16(2):1544-58.
Entrez:21317844
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1991 | ggagcuucugcugauucaacu | SARS Coronavirus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm