Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2007 are 1
Results from 0 - 25
siRNA sequence "gacccccggcguaggucgcg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacccccggcguaggucgcg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2007 " record
Length: 20
GC Content:80 %
Starting position: 674
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:80 %
Starting position: 674
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gacccccggcguaggucgcg" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2007 | gacccccggcguaggucgcg | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm