Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2177 are 1
Results from 0 - 25
siRNA sequence "cccccccucccgggagagcc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cccccccucccgggagagcc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2177 " record
Length: 20
GC Content:85 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:85 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cccccccucccgggagagcc" siRNA in Human Genome sequences
See NC_004102 at Genbank
Pubmed:16566896
Article:Inhibition of hepatitis C virus RNA replication by short hairpin RNA synthesized by T7 RNA polymerase in hepatitis C virus subgenomic replicons.
Authors:Hamazaki H, Ujino S, Miyano-Kurosaki N, Shimotohno K, Takaku H.
Journal:Biochem Biophys Res Commun. 2006 May 12;343(3):988-94. Epub 2006 Mar 29.
Entrez:16566896
Article:Inhibition of hepatitis C virus RNA replication by short hairpin RNA synthesized by T7 RNA polymerase in hepatitis C virus subgenomic replicons.
Authors:Hamazaki H, Ujino S, Miyano-Kurosaki N, Shimotohno K, Takaku H.
Journal:Biochem Biophys Res Commun. 2006 May 12;343(3):988-94. Epub 2006 Mar 29.
Entrez:16566896
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2177 | cccccccucccgggagagcc | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm