Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2217 are 1
Results from 0 - 25
siRNA sequence "gguuuggguaaagucaucgau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gguuuggguaaagucaucgau" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2217 " record
Length: 21
GC Content:43 %
Strain of Virus: 3a
GenBank Acc: EU266536
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Strain of Virus: 3a
GenBank Acc: EU266536
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gguuuggguaaagucaucgau" siRNA in Human Genome sequences
See EU266536 at Genbank
Pubmed:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2217 | gguuuggguaaagucaucgau | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm